CN116144562B - Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells - Google Patents

Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells Download PDF

Info

Publication number
CN116144562B
CN116144562B CN202211297855.6A CN202211297855A CN116144562B CN 116144562 B CN116144562 B CN 116144562B CN 202211297855 A CN202211297855 A CN 202211297855A CN 116144562 B CN116144562 B CN 116144562B
Authority
CN
China
Prior art keywords
scutp1
chi19
recombinant
lpmo
scut
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202211297855.6A
Other languages
Chinese (zh)
Other versions
CN116144562A (en
Inventor
罗晓春
张明舒
陆德林
杨振东
陆雯珺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China University of Technology SCUT
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN202211297855.6A priority Critical patent/CN116144562B/en
Publication of CN116144562A publication Critical patent/CN116144562A/en
Application granted granted Critical
Publication of CN116144562B publication Critical patent/CN116144562B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2442—Chitinase (3.2.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083—Miscellaneous (1.14.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01014—Chitinase (3.2.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/465—Streptomyces
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a recombinant streptomycete strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells. The strain takes Streptomyces sp as an initial strain, and utilizes a high-efficiency promoter scutP1 to overexpress the lyase monooxygenase LPMO and chitinase Chi19. Compared with the Streptomyces sp SCUT-1, the chitinase activity of the strain is obviously improved, the chitin degradation efficiency of the strain is obviously enhanced, and the low-cost shrimp shell raw material can be directly utilized as the sole carbon-nitrogen source for fermentation production of chitosan oligosaccharide, and the yield is 2.60 times of that of the original strain. The invention has great significance in the production of the chitosan oligosaccharide, and has great value in reducing the production cost and improving the yield.

Description

Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells
Technical Field
The invention relates to the technical fields of genetic engineering and biological engineering, in particular to a streptomycete recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells.
Background
Chitin, also called chitin, is a biological macromolecule formed by connecting N-acetylglucosamine through beta- (1, 4) glycosidic bonds, and is a natural polymer compound with reserve next to cellulose on earth. Chitin has a highly ordered internal structure, and a large number of hydrogen bonds are formed between sugar chains, so that the chitin has a firm structure and is insoluble in water, dilute acid, dilute alkali and common organic solvents, and the application of the chitin is severely limited. The chitosan oligosaccharide is a water-soluble oligomeric compound obtained by hydrolyzing chitin, has biological effects of resisting tumor, regulating immunity, resisting oxidation and the like, and has application prospect and economic value far higher than those of chitin.
The production of chitosan oligosaccharide mainly comprises two modes of enzymolysis and microbial fermentation at present. The enzymolysis method is to hydrolyze chitin by using chitinase preparation to obtain chitooligosaccharide, wherein the enzyme preparation can be obtained by carrying out heterologous recombinant expression on chitinase genes or is prepared by culturing natural strains with chitinase production capability. However, the chitinase preparation obtained by any mode is generally low, and the enzyme adding amount is huge when the chitin is hydrolyzed, so that the cost for preparing the chitooligosaccharide by using the chitinase preparation is high, and the requirement of industrial application is difficult to meet. In order to improve the hydrolysis efficiency of the enzyme preparation, chitin can be pretreated by using a strong acid reagent (such as concentrated sulfuric acid and the like), and colloidal chitin is prepared by breaking hydrogen bonds in the chitin, but the method increases the complexity of the process on one hand and generates a large amount of acid-containing wastewater on the other hand, thereby causing serious secondary pollution. In addition, the enzymolysis method for preparing the chitosan oligosaccharide needs a separate preparation process of an enzyme preparation, so that raw materials such as carbon and nitrogen sources required by the growth of the strain are additionally input in an enzyme preparation stage, the process is complex, and the production time and the economic cost are increased.
The microbial fermentation method is to utilize a microorganism with chitin degradation capability, and take chitin or a raw material containing chitin as a carbon source and/or a nitrogen source required by the growth of the microorganism to ferment and culture a strain, so that a substrate can be hydrolyzed in the growth process of the strain to obtain the chitosan oligosaccharide. Compared with the enzymolysis method, the method does not need a separate enzyme preparation process, has simpler and more convenient process and lower production cost; and a strain of microorganism can express and secrete a plurality of chitinase to carry out synergistic degradation on a substrate, and simultaneously express and secrete a schizolysis type polysaccharide monooxygenase to destroy chitin, so that chitin is not required to be pretreated into colloid chitin, the process flow is further simplified, and meanwhile, the waste water pollution can be effectively reduced, and the method is more efficient and environment-friendly. However, the chitin degradation capability of the natural strain is generally low, and the improvement of the chitin degradation efficiency of the strain is a problem to be solved in the industry.
Shrimp shell is a byproduct produced in the processing process of shrimp aquatic products, contains about 20% of chitin, and is a cheap raw material for producing chitosan oligosaccharide. But the shrimp shell has a firm structure, is difficult to directly utilize, is mostly directly discarded as waste, not only can not create any economic and application value, but also brings serious environmental pollution. At present, the raw material price of the shrimp shell is only about 1000 yuan/ton, and the price of chitin extracted from the shrimp shell can reach 5-10 ten thousand yuan/ton, so that the economic value of the shrimp shell is further converted into chitosan oligosaccharide, and the economic value is greatly improved. The chitin degradation capability of the strain is improved, and the production of the chitosan oligosaccharide by using the shrimp shells as raw materials is a key for realizing the conversion of the low-cost shrimp shells into the high-value chitosan oligosaccharide.
Therefore, there is a need for new strains that can efficiently degrade shrimp shells to produce chitosan oligosaccharides.
Disclosure of Invention
The primary aim of the invention is to provide a recombinant streptomycete strain aiming at the defects of the prior art; the recombinant strain of streptomycete overexpresses the schizochy polysaccharide monooxygenase and GH19 family chitinase, so that the efficiency of producing chitosan oligosaccharide by degrading shrimp shells by the strain is improved.
The invention further aims at providing a construction method of the streptomycete recombinant strain.
It is still another object of the present invention to provide the use of said recombinant Streptomyces bacteria for the production of chitooligosaccharides from shrimp shells.
In order to achieve the above purpose, the invention adopts the following technical scheme:
a recombinant Streptomyces strain contains recombinant vector;
the recombinant vector contains a promoter scutP1, a coding gene of a schizophrenic polysaccharide monooxygenase LPMO and a coding gene of chitinase Chi19.
The nucleic acid sequence of the promoter scutP1 is (also shown as SEQ ID No. 1):
CGGCCCCTGAGCACGAAGTAGGCGCCGACGGCCAGCAGCAGCGCCAGCTGCGCCCAGGCCGCCAGGAGCACCAGTCCCCGGTCCGCCATCGTCCGCCCTCCGCCCTTGCCTCCGTGTGGGCGGCCGCCTACCCCGGCCCCCGCGTCCGGATGCGCGCGGCGGCCGGCAGGCACCCGTCCGGGTGTGCGGCCGGGCGGGGGGCCGTCCCGCCGGGCGGGGGCCGTCCCGCCGGGCGGGGCCCGGGTCCTACCACTCCGGGGCGTGGATTTTCGGACGTTTCCCGCCGGGCGAGGGGGTACGGCGCCCGCGGGCCCGGCCCCACCCCTATGCTTCTACATGTCTGTAGAAACAAGCGAGGGCGGTGCGGGCCTCCCCTGCCGTCCTGCGGGACGCGGTCGTCCGGCCCGGCCGGGCCCCGGCCCGCACCTCTCTCTTTCGCATTCGTCCCCGGAAGGACCGTC。
the nucleic acid sequence of the encoding gene of the schizophrenic polysaccharide monooxygenase LPMO is (shown as SEQ ID No. 2):
ATGCGCAGAAGACTCGGAGCAGCCGCGCTCGGCCTCGGCCTGCTCGGCACCACCCTCGCCGCGGCGGGCAGTGCCGTCGGCCACGGCTACACCAGCACCCCGCCCAGCCGTGCGGCCCTGTGCGCCCAGCGCGTCGTCACCGGCTGCGGCGACATCCAGTGGGAGCCGCAGAGCGTCGAGGGCCCCAAGGGCTTCCCGTCCGCGGGCCCCGCGGACGGCAGGATCTGCAGCGGGGGCAACACCCGCTTCGCCGAGCTCGACGACCCCCGGGGCGGGAACTGGCCCGCCACACAACTGACCGGCGGCCAGGGCTACGACTTCAAGTGGACCCTGACGGCCCGTCACGCCACCACCTCGTTCCGGTACTTCATCACCAGGGACGACTGGGACCCGACACGACCCCTGACCCGCGCGGACCTGGAACCGGAACCGTTCATGACCGTCCACTACGGCGGGCGGCAGCCGGAGGCCGTCGCCGTGCACCGGGGGACCGTGCCGACGCAGAAGACCGGCCGGCACCTGATCCTCGGGGTGTGGGACATCGCCGACACCCCGAACGCCTTCTACTCGTGCGCGGACGTGCGGTTCTGA。
the nucleic acid sequence of the coding gene of the chitinase Chi19 is (also shown as SEQ ID No. 3):
ATGTCAGGGAAGCGCATGGCGGCCTCTGCCGCCGCCGTGACCGCCGCCGTGGCCGTGGCGAGTGCACTGACGGTCTTCCTGCCCCTGCCCTCCGCCGCCGCGGCGGACTGCGCGGCGGCGTGGAGTTCCGCCACCGCCTACCAGGGCGGCGCGACCGTCTCGCACGGCGGCCGCAACTGGTCGGCGAAGTGGTGGACGCAGAACGAGACGCCCGGCGGGTCCTCCGGCGTGTGGGCGGACCGGGGAGCCTGCGGGACCACGTCCCCCGACCCCGACCCCGACCCCGATCCCTCGGGGTTCGTCGTCAGCGAGGCGCAGTTCGAGCAGATGTTCCCGAACCGGAGCGCCTTCTACACCTACAGCGGCCTGACCGCGGCGCTGAACGCGTACCCCGGCTTCACGAACACCGGCAGCGACACCGTCAGGAAGCAGGAGGCCGCGGCCTTCCTCGCCAACGTCAACCACGAGACGGGCGGGCTGGTCCACGTCGTCGAGCAGAACCGGGACAACTACCCGCACTACTGCGACAACAGCCTGCCCTACGGCTGCCCCGCCGGGCAGGCCGCCTACTACGGCCGCGGACCGATCCAGCTGAGCTGGAACTTCAACTACAAGGCGGCGGGTGACGCGCTCGGCCTCGACCTGCTGCGCGACCCGTACCTGGTGGAACGGGACTCGGCCGTGGCCTGGAAGACCGCCCTGTGGTACTGGAACACCCAGCGCGGCCCGGGCCGGATGACCCCGCACGACGCCATGGTCGGCGGCCACGGGTTCGGGGAGACGATACGCAGCATCAACGGCGCCCTGGAGTGCGACGGGAGGAATCCGGCCCAGGTGCAGAGCCGGATCGACTCCTACCAGCGGTTCACGCAGATCCTGGGCACCACTCCGGGCGGCAACCTCAGCTGCTGA。
the construction method of the streptomycete recombinant strain comprises the following steps:
(1) Obtaining a pSET152 plasmid skeleton by PCR amplification by taking a pSET152-ermE plasmid as a template; obtaining a scutP1 promoter fragment by PCR amplification by taking streptomycete SCUT-1 genome DNA as a template;
(2) Connecting the pSET152 plasmid skeleton obtained in the step (1) with the scutP1 promoter fragment through seamless cloning to obtain a recombinant plasmid pSET152-scutP1 with the scutP1 promoter;
(3) The genome DNA of streptomycete SCUT-1 is used as a template, and a gene fragment LPMO of the encoding gene of the schizochytrium polysaccharide monooxygenase LPMO and a gene fragment Chi19 of the encoding gene of the chitinase Chi19 are obtained through PCR (polymerase chain reaction) respective amplification;
(4) Performing enzyme tangentially on the recombinant plasmid pSET152-scutP1 obtained in the step (2) by NdeI restriction endonuclease; respectively connecting the linearized recombinant plasmid pSET152-scutP1 with the lpmo fragment and the chi19 fragment obtained in the step (3) through seamless cloning to obtain the recombinant plasmid pSET152-scutP1-lpmo and the recombinant plasmid pSET152-scutP1-chi19;
(5) Taking the recombinant plasmid pSET152-scutP1-chi19 obtained in the step (4) as a template, and obtaining a fragment scutP1-chi19 through PCR amplification; performing enzyme tangential digestion on the recombinant plasmid pSET152-scutP1-lpmo obtained in the step (4) by NdeI restriction endonuclease; the linearized recombinant plasmid pSET152-scutP1-lpmo and a fragment scutP1-chi19 are connected through seamless cloning to obtain the recombinant plasmid pSET152-scutP1-lpmo-scutP1-chi19;
(6) And (3) converting the recombinant plasmid pSET152-scutP1-lpmo-scutP1-chi19 obtained in the step (5) into escherichia coli ET12567/pUZ8002, and transferring into streptomycete SCUT-1 in a bacterial conjugation mode to obtain the streptomycete recombinant strain.
The Streptomyces sp SCUT-1 described in the step (1) is Streptomyces sp SCUT-1 described in Chinese patent application CN 201910491700.8.
The extraction steps of the streptomycete SCUT-1 genomic DNA described in the step (1) are as follows:
inoculating streptomycete SCUT-1 into a solid Gaoshan No.1 culture medium plate, and culturing until the gray green spores are generated; inoculating spores of streptomycete SCUT-1 into a seed liquid culture medium, and carrying out shake culture to obtain streptomycete SCUT-1 seed liquid; 1mL of Streptomyces SCUT-1 seed solution was taken, and genomic DNA was extracted using a DNA rapid extraction kit.
The solid culture medium No.1 comprises the following components: 20g/L of soluble starch, 1g/L of potassium nitrate, 0.5g/L of dipotassium hydrogen phosphate, 0.5g/L of magnesium sulfate heptahydrate, 0.5g/L of sodium chloride, 0.01g/L of ferrous sulfate heptahydrate and 20g/L of agar powder.
The solid culture medium No.1 also comprises distilled water.
The seed culture medium comprises the following components: 10g/L tryptone, 10g/L sodium chloride and 5g/L yeast extract.
The seed culture medium also comprises distilled water.
The shake culture conditions are 30-45 ℃ and 150-250 rpm for shake culture for 19-29 hours; preferably, it is: shake culturing at 37deg.C and 220rpm for 24 hr.
The DNA rapid extraction kit is preferably a soil genome DNA rapid extraction kit.
Preferably, the primers and primer sequences used for PCR amplification in step (1) to obtain the pSET152 plasmid backbone are as follows:
pET152ProLineFw：5’-catatgttggggatcctctagaggatccg-3’；
pET152ProLineRv：5’-agtcgacctgcagcccaagc-3’。
preferably, the primer used for PCR amplification to obtain the scutP1 promoter fragment in the step (1) has the following primer sequence:
scutP1-Fw：5’-gcttgggctgcaggtcgactCGGCCCCTGAGCACGAA-3’；
scutP1-Rv：5’-tagaggatccccaacatatgGACGGTCCTTCCGGG-3’。
preferably, the primer and primer sequences used for PCR amplification in the step (3) to obtain the gene fragment LPMO encoding the lyase monooxygenase LPMO are as follows:
lpmo-Fw：5’-cccggaaggaccgtccaATGCGCAGAAGACTCGGAG-3’；
lpmo-Rv：5’-ctagaggatccccaacatatgTCAGAACCGCACGTCCGC-3’。
preferably, the primer used for PCR amplification to obtain chitinase Chi19 encoding gene fragment Chi19 in the step (3) has the following primer sequences:
chi19-Fw：5’-cccggaaggaccgtccaATGTCAGGGAAGCGCATGG-3’；
chi19-Rv：5’-ctagaggatccccaacatatgTCAGCAGCTGAGGTTGCCG-3’。
preferably, the primers and primer sequences used in the PCR amplification of the fragment scutP1-chi19 in step (5) are as follows:
scutP1-chi19-Fw：5’-acgtgcggttctgacaCGGCCCCTGAGCACGAAG-3’；
scutP1-chi19-Rv：5’-TCCTCTAGAGGATCCCCAACA-3’。
the method of conversion described in step (6) is preferably electroconversion.
The bacterial conjugation of step (6) specifically comprises the following steps:
s1: the transformed E.coli is inoculated into LB medium containing apramycin, chloramphenicol and kanamycin for culture. Taking bacterial liquid obtained after culture, centrifuging and removing the supernatant; re-suspending the thallus with LB culture medium, centrifuging, and removing supernatant to obtain colibacillus thallus;
s2: taking streptomycete SCUT-1 spore preservation solution for incubation, uniformly mixing with the escherichia coli thalli collected in the step S1, coating the mixture on a solid MS culture medium plate, and culturing;
s3: taking out the cultured solid MS culture medium plate; uniformly covering the apramycin and nalidixic acid aqueous solution on a solid MS culture medium flat plate; culturing the flat plate after fully airing; after obvious single colony grows on the MS culture medium plate, single colony is selected to be inoculated into a seed liquid culture medium containing apramycin and nalidixic acid, and shake culture is carried out.
The LB medium containing apramycin, chloramphenicol and kanamycin described in step S1 comprises the following components: 10g/L of tryptone, 10g/L of sodium chloride, 5g/L of yeast extract, 50mg/L of apramycin, 25mg/L of chloramphenicol and 50mg/L of kanamycin.
The LB medium containing apramycin, chloramphenicol, and kanamycin described in step S1 also includes distilled water.
The culture conditions described in step S1 are: culturing at 30-45 deg.c and 150-250 rpm for 12-20 hr; preferably at 37℃and 220rpm, for 16 hours.
The centrifugation conditions described in step S1 are preferably: centrifuge 6000 Xg for 2min.
The resuspension of the cells with LB medium as described in step S1 is preferably carried out with 2mL of LB medium.
The Streptomyces SCUT-1 spore stock solution described in step S2 is preferably prepared by the following preparation steps:
inoculating streptomycete SCUT-1 into a solid Gaoshan No.1 culture medium plate, and culturing until the gray green spores are generated; inoculating Streptomyces SCUT-1 spores to a spore preservation culture medium, and preserving at 4 ℃ to obtain Streptomyces SCUT-1 spore preservation solution.
The solid culture medium No.1 comprises the following components: 20g/L of soluble starch, 1g/L of potassium nitrate, 0.5g/L of dipotassium hydrogen phosphate, 0.5g/L of magnesium sulfate heptahydrate, 0.5g/L of sodium chloride, 0.01g/L of ferrous sulfate heptahydrate and 20g/L of agar powder.
The solid culture medium No.1 also comprises distilled water.
Culturing for 5-7 days at 30-45 ℃ until the culture condition for generating the gray green spores; preferably at 37℃for 5 to 7 days.
The spore preservation culture medium comprises the following components: 16g/L tryptone, 10g/L yeast extract and 5g/L sodium chloride.
The spore preservation culture medium also comprises distilled water.
The incubation condition in the step S2 is that the incubation is carried out for 5-15 min at the temperature of 40-60 ℃; preferably, it is: incubate at 50℃for 10min.
The solid MS culture medium in the step S2 comprises the following components: 20g/L mannitol, 20g/L soybean powder, 10mmol/L magnesium chloride and 20g/L agar powder.
The solid MS medium described in step S2 further comprises distilled water.
The culture conditions described in step S2 are: inversion culture is carried out for 12-20 h at 20-40 ℃; preferably, it is: inverted culturing at 30 ℃ for 16h.
The solute of the aqueous solution of apramycin and nalidixic acid described in step S3 is composed of the following components: 1mg/L of apramycin and 0.5mg/L of nalidixic acid; the solvent is distilled water.
The culture conditions described in step S3 are: culturing for 3-5 days at 30-45 ℃; preferably, it is: culturing at 37 deg.c for 3-5 days.
The seed solution culture medium containing the apramycin and the nalidixic acid in the step S3 comprises the following components: 10g/L of tryptone, 10g/L of sodium chloride, 5g/L of yeast extract, 50mg/L of apramycin and 25mg/L of nalidixic acid.
The seed solution culture medium containing the apramycin and the nalidixic acid in the step S3 also comprises distilled water.
The shake culture conditions in the step S3 are as follows: shake culturing at 30-45 deg.c and 150-250 rpm for 45-51 hr; preferably, it is: shake culturing at 37deg.C and 220rpm for 48 hr.
The application of the recombinant streptomycete strain in the production of chitosan oligosaccharide by utilizing shrimp shells.
In the application, the shrimp shell is used as the only carbon source and nitrogen source to prepare a fermentation medium, and the recombinant streptomycete strain is inoculated into the fermentation medium for fermentation culture, so that chitin components in the recombinant streptomycete shrimp shell can be degraded to obtain the chitosan oligosaccharide.
The application preferably comprises the steps of:
p1: inoculating the streptomycete recombinant strain into a seed culture medium, and culturing to obtain streptomycete recombinant strain seed liquid.
P2: inoculating the streptomyces recombinant strain seed liquid obtained in the step P1 into a fermentation medium, fermenting, and collecting supernatant to obtain a chitosan oligosaccharide solution.
The seed medium described in step P1 comprises the following components: 10.0g/L tryptone, 10.0g/L sodium chloride and 5.0g/L yeast extract.
The seed medium described in step P1 further comprises distilled water.
The culture conditions described in step P1 are: the culture time is 15-35 h at 30-45 ℃ and 150-250 rpm. Preferably 37℃and 220rpm, for a incubation time of 24 hours.
The fermentation medium described in step P2 comprises the following components: 100g/L of dried shrimp shell, 0.5g/L of anhydrous magnesium sulfate, 0.4g/L of monopotassium phosphate, 0.8g/L of dipotassium phosphate trihydrate and 0.02g/L of ferrous sulfate heptahydrate.
The fermentation medium in step P2 further comprises distilled water
The seed liquid in the step P2 is inoculated in an amount of 1% by volume of the fermentation medium.
The fermentation culture conditions in the step P2 are as follows: the culture time is 15-35 h at 30-45 ℃ and 150-250 rpm. Preferably 40℃and 220rpm, for a incubation time of 72 hours.
Compared with the prior art, the invention has the following advantages and effects:
(1) The invention uses a high-efficiency promoter scutP1 endogenous to a streptomycete SCUT-1 starting strain, and constructs a streptomycete recombinant strain with the overexpression of the schizochypolysaccharide monooxygenase LPMO and the chitinase Chi19 through a genetic engineering technology, wherein the chitinase activity of the streptomycete recombinant strain is obviously improved compared with that of the starting strain;
(2) According to the invention, the shrimp shell is used as the only carbon source and nitrogen source to prepare the fermentation medium, and the fermentation product rich in the chitosan oligosaccharide can be obtained by fermenting and culturing the fermentation medium by utilizing the streptomycete recombinant bacteria. The raw materials are cheap and wide in sources, a large amount of waste shrimp shells can be converted into high-value chitosan oligosaccharide, and waste materials are changed into valuable materials;
(3) The invention does not need to use complex pretreatment technology, does not need a separate enzyme preparation process, does not need to use acid-base and toxic chemical reagents, and has the advantages of mild reaction conditions, simple technology, low cost and environmental protection;
(4) The chitosan oligosaccharide product obtained by the method can be used as a high-quality raw material of animal and plant nutrition additives and the like.
Drawings
FIG. 1 is a diagram of recombinant vector pSET152-scutP1-lpmo-scutP1-chi19.
FIG. 2 is a diagram of recombinant vector pSET 152-ermE-lpmo-ermE-chi 19.
FIG. 3 is a graph showing comparison of the yields of chitooligosaccharides produced by fermentation of shrimp shells by Streptomyces sp SCUT-1 and recombinant strain SCUT-Olpmo-Ochi19.
FIG. 4 is a comparison of chitinase activities of Streptomyces sp SCUT-1 and recombinant strain SCUT-Olpmo-Ochi19 when fermenting shrimp shells to produce chitooligosaccharides.
Detailed Description
The present invention will be described in further detail with reference to examples and the accompanying drawings, but embodiments of the present invention are not limited thereto. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art. The reagents and starting materials used in the present invention are commercially available unless otherwise specified.
Example 1
Construction of recombinant Streptomyces bacteria overexpressed by lyase polysaccharide monooxygenase LPMO and chitinase Chi19
1. Cultivation of Streptomyces SCUT-1
Streptomyces sp SCUT-1 was inoculated in an appropriate amount to a solid culture medium plate No.1 (solid culture medium No.1 is composed of 20g of soluble starch, 1g of potassium nitrate, 0.5g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate heptahydrate, 0.5g of sodium chloride, 0.01g of ferrous sulfate heptahydrate, 20g of agar powder and 1L of distilled water), and cultured at 37℃for 5 to 7 days to produce greyish green spores. The Streptomyces sp SCUT-1 has a deposit number of GDMCC No:60612 the strain was deposited at 3.20.2019 on the Guangdong province microorganism strain deposit center of No. 59 building of No. 100 of Mitsui, guangzhou, city, china, patent application CN 201910491700.8.
2. Extraction of Streptomyces SCUT-1 genomic DNA
(1) And (3) picking spores of the streptomyces SCUT-1 obtained in the step (1) by using an inoculating loop, inoculating the spores to a seed liquid culture medium (the seed culture medium consists of 10g of tryptone, 10g of sodium chloride, 5g of yeast extract and 1L of distilled water), and carrying out shake culture for 24 hours at 37 ℃ and 220rpm to obtain the streptomyces SCUT-1 seed liquid.
(2) 1mL of Streptomyces SCUT-1 seed solution was taken, genomic DNA was extracted using a soil genomic DNA rapid extraction kit (purchased from Biotechnology Co., ltd.) and the extraction procedure was performed according to the standard procedure of the kit specification.
3. Preparation of Streptomyces SCUT-1 spore preservation solution
And (3) picking spores of the streptomyces SCUT-1 obtained in the step (1) by using an inoculating loop, inoculating the spores to a spore preservation culture medium (the spore preservation culture medium consists of 16g of tryptone, 10g of yeast extract, 5g of sodium chloride and 1L of distilled water), and standing and preserving the spores at 4 ℃ for 5-7 days to obtain a SCUT-1 spore preservation solution.
4. Construction of vectors
(1) Construction of recombinant vector pSET152-scutP1
Primers pET152ProLineFw (5'-catatgttggggatcctctagaggatccg-3') and pET152ProLineRv (5'-agtcgacctgcagcccaagc-3') were designed using pSET152 plasmid of the NTSC type culture collection as pSET152 plasmid with promoter ermE as template, and the pSET152 plasmid backbone without promoter ermE was obtained by PCR amplification.
The primer scutP1-Fw (5' -)gcttgggctgcaggtcg actCGGCCCCTGAGCACGAA-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and scutP1-Rv (5')tagaggatccccaacatatgGACGGTCCTTCCGGG-3') (underlined indicates the homologous fragments required for seamless cloning ligation) and the scutP1 promoter fragment was obtained by PCR amplification.
The pSET152 plasmid backbone and the scutP1 promoter fragment were purified and recovered and reacted at 50℃for 30min for seamless cloning ligation using a ligation reagent TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (available from Beijing qing biosciences Co., ltd.) in a ligation reaction system as shown in Table 1:
TABLE 1 ligation reaction System
The ligation product was transformed into E.coli DH 5. Alpha. And single colonies were picked up on an LB medium plate containing Apramycin (Apramycin) (LB medium plate containing Apramycin consisting of tryptone 10g, sodium chloride 10g, yeast extract 5g, apramycin 50mg, agar powder 20g and distilled water 1L), plasmids were extracted and subjected to sequencing verification to obtain recombinant vector pSET152-scutP1.
(2) Construction of recombinant vectors pSET152-scutP1-lpmo and pSET152-scutP1-chi19
The pSET152-scutP1 plasmid was treated with NdeI restriction endonuclease and purified for recovery to obtain pSET152-scutP1 linearized vector.
The primer lpmo-Fw (5' -cccggaaggaccgtccaATGCGCAGAAGACTCGGAG-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and lpmo-Rv (5')ctagaggatccccaacatatgTCAGAACCGCACGTCCGC-3') (underlined indicates the homologous fragments required for seamless cloning ligation), and the lpmo fragment was recovered by PCR amplification and purification.
Primers chi19-Fw (5' -) were designed using Streptomyces SCUT-1 genomic DNA as a templatecccggaaggaccgtccaATGTCAGGGAAGCGCATGG-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and chi19-Rv (5'ctagaggatccccaacatatgTCAGCAGCTGAGGTTGCCG-3') (underlined indicates homologous fragments required for seamless cloning ligation), and the chi19 fragment was recovered by PCR amplification and purification.
The pSET152-scutP1 linearized vector was subjected to seamless cloning ligation with the lpmo fragment and the chi19 fragment, respectively, using a ligation reagent of TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (available from the company of Biotechnology, pteris, beijing) and a ligation reaction system as shown in Table 2:
TABLE 2 ligation reaction System
The ligation product was transformed into E.coli DH 5. Alpha. And single colonies were picked up on LB medium plates containing Apramycin (Apramycin) (LB medium plates containing Apramycin consisting of tryptone 10g, sodium chloride 10g, yeast extract 5g, apramycin 50mg, agar powder 20g and distilled water 1L), plasmids were extracted and sequenced to obtain recombinant vectors pSET152-scutP1-lpmo and pSET152-scutP1-chi19.
(3) Construction of recombinant vector pSET152-scutP1-lpmo-scutP1-chi19C
The pSET152-scutP1-lpmo plasmid was treated with NdeI restriction endonuclease and recovered by purification to obtain pSET152-scutP1-lpmo linearized vector.
The pSET152-scutP1-chi19 plasmid is used as a template, and a primer scutP1-chi19-Fw (5'acgtgcgg ttctgacaCGGCCCCTGAGCACGAAG-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and scutP1-chi19-Rv (5'TCCTCTAGAGGATCCCCAACA-3') (underlined indicates the homologous fragment required for seamless cloning ligation, and since pSET152-scutP1-lpmo and pSET152-scutP1-chi19 vector backbone moieties are identical, the primer amplification product can directly serve as the homologous fragment for seamless cloning), and the scutP1-chi19 fragment is obtained after amplification by PCR and purification and recovery. The pSET152-scutP1-lpmo linearized vector and the scutP1-chi19 fragment were subjected to seamless cloning and ligation using the ligation reagent TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (available from Beijing engine biosciences Co., ltd.) in the ligation reaction system shown in Table 3:
TABLE 3 ligation reaction System
The ligation product was transformed into E.coli DH 5. Alpha. And single colonies were picked up on an LB medium plate containing Apramycin (Apramycin) (LB medium plate containing Apramycin consisting of tryptone 10g, sodium chloride 10g, yeast extract 5g, apramycin 50mg, agar powder 20g and distilled water 1L), plasmids were extracted and sequenced to obtain recombinant vector pSET152-scutP1-lpmo-scutP1-chi19, the vector pattern of which is shown in FIG. 1.
5. Construction of recombinant Streptomyces
And (3) electrically transforming the recombinant vector pSET152-scutP1-lpmo-scutP1-chi19 obtained in the step (3) into an escherichia coli ET12567/pUZ8002 host to obtain an escherichia coli transformed strain ET/pSET152-scutP1-lpmo-scutP1-chi19. The above E.coli was inoculated into LB medium (comprising 10g of tryptone, 10g of sodium chloride, 5g of yeast extract, 50mg of Apramycin, 25mg of Chloramphenicol, 50mg of Kanamycin and 1L of distilled water) containing Apramycin, chloramphenicol (Chloramphenicol) and Kanamycin (Kanamycin) and cultured with shaking at 37℃and 220rpm for 16 hours. After 4mL of the culture, a bacterial solution of ET/pSET152-scutP1-lpmo-scutP1-chi19 was obtained, and the solution was centrifuged at 6000 Xg for 2 minutes, and the supernatant was removed. The cells were resuspended in 2mL of fresh LB medium, centrifuged at 6000 Xg for 2min and the supernatant removed to remove antibiotics from the culture.
100 mu L of spore preservation solution of streptomycete SCUT-1 prepared in the step 3 preserved at 4 ℃ is taken, incubated for 10min at 50 ℃, uniformly mixed with the collected escherichia coli transformed strain ET/pSET152-scutP1-lpmo-scutP1-chi19 thallus, and then coated on a solid MS culture medium flat plate (the solid MS culture medium consists of 20g of mannitol, 20g of soybean meal, 10mM of final concentration of magnesium chloride, 20g of agar powder and 1L of distilled water), and inversely cultured for 16h at 30 ℃.
The cultured MS medium plate was taken out. 1mL of an aqueous solution containing apramycin and nalidixic acid (the aqueous solution containing apramycin and nalidixic acid consists of 1mg of apramycin, 0.5mg of nalidixic acid and 1mL of sterile water) is taken and evenly covered on an MS culture medium plate. The flat plate is fully dried and then is placed at 37 ℃ for 3-5 days of culture. After obvious single colonies grow on a MS culture medium plate, picking single colonies into a seed solution culture medium containing apramycin and nalidixic acid by an inoculating needle (the seed culture medium containing apramycin and nalidixic acid consists of 10g of tryptone, 10g of sodium chloride, 5g of yeast extract, 50mg of apramycin, 25mg of nalidixic acid and 1L of distilled water), shake-culturing for 48h at 37 ℃ and 220rpm, taking 1mL of cultured bacterial solution, extracting genome DNA by using a soil genome DNA rapid extraction kit (purchased from biological engineering Co., ltd.), and performing experimental operation according to the standard procedure of the kit instruction. PCR verification was performed using the extracted genomic DNA as a template using the universal primers M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3') and M13-48 (5'-AGCGGATAACAATTTCACACAGGA-3') to obtain a recombinant Streptomyces strain designated SCUT-Olpmo-Ochi19.SCUT-Olpmo-Ochi19 is obtained by combining an escherichia coli transformed strain ET/pSET152-scutP1-lpmo-scutP1-chi19 with SCUT-1.
Comparative example 1
Steps 1, 2 and 3 are the same as in example 1.
4. Construction of vectors
(1) Construction of recombinant vectors pSET 152-ermE-lpmo and pSET 152-ermE-chi 19
pSET152-ermE plasmid (NTCC collection) was treated with NdeI restriction endonuclease and purified for recovery to obtain pSET152-ermE linearized vector.
The primer lpmo-E-Fw (5' -cgaccaaaggaggcgga catATGCGCAGAAGACTCGGA-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and lpmo-E-Rv (5')tagaggatccccaacatatgTCAGAACCGCACGTCCGC-3') (underlined indicates the homologous fragments required for seamless cloning ligation), and the lpmo-E fragment was recovered by PCR amplification and purification.
The primer chi19-E-Fw (5' -) is designed by taking streptomycete SCUT-1 genome DNA as a templatecgaccaaaggaggcgg acatATGTCAGGGAAGCGCATGG-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and chi19-E-Rv (5')tagaggatccccaacatatgTCAGCAGCTGAGGTTGCCG-3') (underlined indicates the homologous fragments required for seamless cloning ligation), and the chi19-E fragment was recovered by PCR amplification and purification.
The pSET152-ermE linearized vector was seamlessly cloned into the lpmo-E fragment and the chi19-E fragment, respectively, using the ligation reagent TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (available from Beijing qing Biotech Co., ltd.) and the ligation reaction system was as shown in Table 4:
TABLE 4 ligation reaction System
The ligation product was transformed into E.coli DH 5. Alpha. And single colonies were picked up on LB medium plates containing Apramycin (Apramycin) (LB medium plates containing Apramycin consisting of tryptone 10g, sodium chloride 10g, yeast extract 5g, apramycin 50mg, agar powder 20g, distilled water 1L), plasmids were extracted and sequenced to obtain recombinant vectors pSET152-ermE x-lpmo and pSET152-ermE x-chi 19.
(2) Construction of recombinant vector pSET 152-ermE-lpmo-ermE-chi 19
Primers SETlpmaLineFw (5'-catatgttggggatcctctagaggatccg-3') and SETlpmaLineRv (5'-tcagaaccgcacgtccgc-3') are designed by taking pSET 152-ermE-lpmo as a template, and the pSET 152-ermE-lpmo linearization vector is obtained through PCR amplification, purification and recovery.
The primer ermE-chi 19-Fw (5' -)gcggacgtgc ggttctgaCTAGTATGCATGCGAGTG-3 ') (underlined indicates homologous fragments required for seamless cloning ligation) and ermE x-chi 19-Rv (5'TCCTCTAGAGGATCCCCAACA-3') (underlined indicates homologous fragments required for seamless cloning ligation), amplified by PCR and purified for recovery to obtain the ermE x-chi 19 fragment. The pSET152-ermE x-lpmo linearized vector and the ermE x-chi 19 fragment were subjected to seamless cloning and ligation using the ligation reagent TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (available from Beijing engine biosciences Co., ltd.) in the ligation reaction system shown in Table 5:
TABLE 5 ligation reaction System
/>
The ligation product was transformed into E.coli DH 5. Alpha. And single colonies were picked up on LB medium plates containing Apramycin (Apramycin), plasmids were extracted and subjected to sequencing verification to obtain recombinant vector pSET 152-ermE-lpmo-ermE-chi 19, the vector profile of which is shown in FIG. 2.
5. Construction of recombinant Streptomyces
Electrotransformation of the recombinant vector pSET 152-ermE-lpmo-ermE-chi 19 obtained in the step 4 (2) into an E.coli ET12567/pUZ8002 host to obtain an E.coli transformed strain ET/pSET 152-ermE-lpmo-ermE-chi 19. The above E.coli was inoculated into LB medium (comprising 10g of tryptone, 10g of sodium chloride, 5g of yeast extract, 50mg of Apramycin, 25mg of Chloramphenicol, 50mg of Kanamycin and 1L of distilled water) containing Apramycin (Apramhecin), chloramphenicol (Chloramphenicol) and Kanamycin (Kanamycin), and shake-cultured at 37℃and 220rpm for 16 hours. Taking 4mL of ET/pSET 152-ermE-lpmo-ermE-chi 19 bacterial liquid obtained after culture, centrifuging for 2min under the condition of 6000 Xg, and removing the supernatant. The cells were resuspended in 2mL of fresh LB medium, centrifuged at 6000 Xg for 2min and the supernatant removed to remove antibiotics from the culture.
Taking 100 mu L of spore preservation solution of streptomycete SCUT-1 prepared in the step 3 preserved at 4 ℃, incubating for 10min at 50 ℃, uniformly mixing with the collected escherichia coli ET/pSET 152-ermE-lpmo-ermE-chi 19 thalli, coating the mixture on a solid MS culture medium plate (the solid MS culture medium consists of 20g of mannitol, 20g of soybean meal, 0.9521g of magnesium chloride, 20g of agar powder and 1L of distilled water), and culturing for 16h in an inversion way at 30 ℃.
The cultured MS medium plate was taken out. 1mL of an aqueous solution containing apramycin and nalidixic acid (the aqueous solution containing apramycin and nalidixic acid consists of 1mg of apramycin, 0.5mg of nalidixic acid and 1mL of distilled water) is taken and evenly covered on an MS culture medium plate. The flat plate is fully dried and then is placed at 37 ℃ for 3-5 days of culture. After obvious single colonies grow on a MS culture medium plate, picking single colonies into a seed solution culture medium containing apramycin and nalidixic acid by an inoculating needle (the seed culture medium containing apramycin and nalidixic acid consists of 10g of tryptone, 10g of sodium chloride, 5g of yeast extract, 50mg of apramycin, 25mg of nalidixic acid and 1L of distilled water), shake-culturing for 48h at 37 ℃ and 220rpm, taking 1mL of cultured bacterial solution, extracting genome DNA by using a soil genome DNA rapid extraction kit (purchased from biological engineering Co., ltd.), and performing experimental operation according to the standard procedure of the kit instruction. PCR was performed using the general primers M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3') and M13-48 (5'-AGCGGATAACAATTTCACACAGGA-3') and the extracted genomic DNA as a template to obtain a recombinant Streptomyces strain designated SCUT-Elpmo-Echi19.SCUT-Elpmo-Echi19 is obtained by joining E.coli transformant strain ET/pSET152-ermE x-lpmo-ermE x-chi 19 with Streptomyces SCUT-1.
Example 2
Evaluation of ability of Streptomyces recombinant bacteria SCUT-Olpmo-Ochi19 and SCUT-Elpmo-Echi19 to produce chitooligosaccharide Using shrimp Shell
(1) Streptomyces sp SCUT-1, recombinant bacteria SCUT-Olpmo-Ochi19 obtained in example 1 and recombinant bacteria SCUT-Elpmo-Echi19 obtained in comparative example 1 were inoculated respectively into seed liquid culture medium (the seed culture medium consists of tryptone 10g, sodium chloride 10g, yeast extract 5g and distilled water 1L), and shake culture was carried out at 37℃and 220rpm for 24 hours to obtain Streptomyces sp SCUT-1 seed liquid, recombinant bacteria SCUT-Olpmo-Ochi19 seed liquid and recombinant bacteria SCUT-Elpmo-Echi19 seed liquid.
(2) Streptomyces SCUT-1 seed solution, recombinant bacteria SCUT-Olpmo-Ochi19 seed solution and recombinant bacteria SCUT-Elpmo-Echi19 seed solution are respectively inoculated to a fermentation medium according to the inoculation amount of 1% of the volume of the fermentation medium (the fermentation medium consists of 100g of shrimp shell, 0.5g of anhydrous magnesium sulfate, 0.4g of monopotassium phosphate, 0.8g of dipotassium phosphate trihydrate, 0.02g of ferrous sulfate heptahydrate and 1L of distilled water), and shake culture is carried out for 72 hours at 40 ℃ and 220 rpm. The culture was centrifuged at 12000 Xg at 4℃for 5min, and the supernatant fermentation broth of each strain was collected for determination of chitooligosaccharide content and chitinase activity, respectively.
(3) The determination of the chitosan oligosaccharide content comprises the following specific steps:
taking 80 mu L of the supernatant obtained in the step (2)The fermentation liquor is put into a centrifuge tube, 10 mu L of 10% snailase solution (the 10% snailase solution is composed of 100g of snailase dry powder and 1L of distilled water) (the snailase dry powder is purchased from the company of biological engineering Co., ltd.), the step is that the snailase treatment is adopted to convert the whole chitosan oligosaccharide into beta-N-acetylglucosamine so as to improve the accuracy of measurement, and the mixture is reacted for 1h at 37 ℃. To the centrifuge tube, 40. Mu.L of solution A was added, and the mixture was subjected to a water bath at 100℃for 5 minutes. Centrifuge the tube at 12000 Xg for 3min, take 70. Mu.L supernatant into another clean centrifuge tube, add 300. Mu.L B solution, mix well and react at 37℃for 20min. 200. Mu.L of the reaction solution was used as a 96-well ELISA plate, and absorbance was measured at 585nm wavelength of the ELISA plate. The measured OD 585 Substituting the chitosan oligosaccharide into a standard curve, and calculating to obtain the content of the chitosan oligosaccharide. The standard curve is prepared by dissolving beta-N-acetylglucosamine powder in distilled water to prepare standard solutions of 0, 12.5, 25, 37.5, 50, 62.5, 75, 87.5 and 100 mug/mL, and constructing by adopting the same measuring method as the sample to be measured.
The preparation method of the solution A comprises the following steps: 5g of sodium tetraborate powder was weighed, dissolved in 80mL of hot water (85 ℃) and fixed to 100mL.
The preparation steps of the solution B are as follows: 1g of p-dimethylaminobenzaldehyde is weighed, 15mL of acetic acid is added for dissolution, 1.25mL of concentrated hydrochloric acid (6M) is added, and after uniform mixing, the volume is fixed to 100mL.
The yield pairs of the production of chitosan oligosaccharide by fermentation of shrimp shells by the Streptomyces sp SCUT-1, the recombinant strain SCUT-Olpmo-Ochi19 obtained in example 1 and the recombinant strain SCUT-Elpmo-Echi19 obtained in comparative example 1 are shown in FIG. 3. The measurement result shows that the yield of the streptomycete SCUT-1 chitosan oligosaccharide is 0.726g/L; the yield of the recombinant strain SCUT-Olpmo-Ochi19 chitosan oligosaccharide is 1.89g/L, which is 2.60 times of that of the original strain; the yield of the recombinant SCUT-Elpmo-Echi19 chitosan oligosaccharide is 0.813g/L, which is 1.12 times of that of the original strain.
(4) The method for measuring the chitinase activity comprises the following specific steps:
60 mu L of the supernatant fermentation broth obtained in the step (2) is taken in a centrifuge tube, and another 60 mu L of the supernatant fermentation broth inactivated at high temperature (10 min in boiling water) is taken in another centrifuge tube to serve as a control group. To the two centrifuge tubes, 40. Mu.L of a 2% colloidal chitin solution was added, respectively, 120. Mu.L of a phosphate buffer solution pH7.0 was added, and the mixture was reacted at 40℃for 1 hour after mixing. The reaction was terminated by boiling water bath for 5min to obtain a reaction solution. Centrifuge the tube at 12000 Xg for 3min, take 80. Mu.L of the reaction supernatant in another clean centrifuge tube and determine the chitosan content of the supernatant by the method described in step (3) of example 2. The chitinase activity is calculated according to the content of the soluble chitosan which can be released by the hydrocolloid chitin of the fermentation liquid in unit time and unit volume.
The chitinase activity pairs of the starting strain Streptomyces scUT-1, the recombinant strain SCUT-Olpmo-Ochi19 obtained in example 1 and the recombinant strain SCUT-Elpmo-Echi19 obtained in comparative example 1 when fermenting shrimp shells to produce chitooligosaccharides are shown in FIG. 4. The measurement result shows that the chitinase activity of the recombinant bacteria SCUT-Olpmo-Ochi19 is 3.28 times that of the streptomycete SCUT-1; the chitinase activity of the recombinant strain SCUT-Elpmo-Echi19 is 1.44 times that of the Streptomyces sp SCUT-1.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. A recombinant Streptomyces strain, characterized in that:
contains a recombinant vector; the recombinant vector contains a promoter scutP1, a coding gene of a schizophrenic polysaccharide monooxygenase LPMO and a coding gene of chitinase Chi19;
the nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No. 1;
the nucleic acid sequence of the encoding gene of the schizophrenic polysaccharide monooxygenase LPMO is shown as SEQ ID No. 2;
the nucleic acid sequence of the coding gene of the chitinase Chi19 is shown in SEQ ID No. 3;
the host bacterium of the Streptomyces recombinant bacterium is Streptomyces (Streptomyces sp.) SCUT-1;
the Streptomyces sp SCUT-1 has a deposit number of GDMCC No:60612 the strain was deposited at 3.20.2019 with the Guangdong province microorganism strain deposit center of No. 59 building of No. 100, mitsui, guangzhou, city.
2. The method for constructing recombinant Streptomyces bacteria according to claim 1, comprising the steps of:
(1) Obtaining a pSET152 plasmid skeleton by PCR amplification by taking a pSET152-ermE plasmid as a template; obtaining a scutP1 promoter fragment by PCR amplification by taking streptomycete SCUT-1 genome DNA as a template;
(2) Connecting the pSET152 plasmid skeleton obtained in the step (1) with the scutP1 promoter fragment through seamless cloning to obtain a recombinant plasmid pSET152-scutP1 with the scutP1 promoter;
(3) The genome DNA of streptomycete SCUT-1 is used as a template, and a gene fragment LPMO of the encoding gene of the schizochytrium polysaccharide monooxygenase LPMO and a gene fragment Chi19 of the encoding gene of the chitinase Chi19 are obtained through PCR (polymerase chain reaction) respective amplification;
(4) Performing enzyme tangentially on the recombinant plasmid pSET152-scutP1 obtained in the step (2) by NdeI restriction endonuclease; respectively connecting the linearized recombinant plasmid pSET152-scutP1 with the lpmo fragment and the chi19 fragment obtained in the step (3) through seamless cloning to obtain the recombinant plasmid pSET152-scutP1-lpmo and the recombinant plasmid pSET152-scutP1-chi19;
(5) Taking the recombinant plasmid pSET152-scutP1-chi19 obtained in the step (4) as a template, and obtaining a fragment scutP1-chi19 through PCR amplification; performing enzyme tangential digestion on the recombinant plasmid pSET152-scutP1-lpmo obtained in the step (4) by NdeI restriction endonuclease; the linearized recombinant plasmid pSET152-scutP1-lpmo and a fragment scutP1-chi19 are connected through seamless cloning to obtain the recombinant plasmid pSET152-scutP1-lpmo-scutP1-chi19;
(6) And (3) converting the recombinant plasmid pSET152-scutP1-lpmo-scutP1-chi19 obtained in the step (5) into escherichia coli ET12567/pUZ8002, and transferring into streptomycete SCUT-1 in a bacterial conjugation mode to obtain the streptomycete recombinant strain.
3. The construction method according to claim 2, wherein:
the primers used for PCR amplification to obtain pSET152 plasmid backbone in step (1) are as follows:
pET152ProLineFw： 5’-catatgttggggatcctctagaggatccg-3’；
pET152ProLineRv： 5’-agtcgacctgcagcccaagc-3’；
the primers used for PCR amplification to obtain the scutP1 promoter fragment in the step (1) are as follows:
scutP1-Fw：
5’-gcttgggctgcaggtcgactCGGCCCCTGAGCACGAA-3’；
scutP1-Rv：
5’-tagaggatccccaacatatgGACGGTCCTTCCGGG-3’；
the primers used for PCR amplification in the step (3) to obtain the gene fragment LPMO encoding the LPMO of the schizophrenic polysaccharide monooxygenase are shown as follows:
lpmo-Fw：
5’-cccggaaggaccgtccaATGCGCAGAAGACTCGGAG-3’；
lpmo-Rv：
5’-ctagaggatccccaacatatgTCAGAACCGCACGTCCGC-3’；
the primer used for PCR amplification in the step (3) to obtain the chitinase Chi19 encoding gene fragment Chi19 is as follows:
chi19-Fw：
5’-cccggaaggaccgtccaATGTCAGGGAAGCGCATGG-3’；
chi19-Rv：
5’-ctagaggatccccaacatatgTCAGCAGCTGAGGTTGCCG-3’；
the primers used for PCR amplification to obtain fragment scutP1-chi19 in step (5) are as follows:
scutP1-chi19-Fw：
5’-acgtgcggttctgacaCGGCCCCTGAGCACGAAG-3’；
scutP1-chi19-Rv：
5’-TCCTCTAGAGGATCCCCAACA-3’。
4. the construction method according to claim 2, wherein:
the method of conversion in step (6) is electroconversion;
the bacterial conjugation of step (6) specifically comprises the following steps:
s1: inoculating the transformed escherichia coli into LB culture medium containing apramycin, chloramphenicol and kanamycin, and culturing; taking bacterial liquid obtained after culture, centrifuging and removing the supernatant; re-suspending the thallus with LB culture medium, centrifuging, and removing supernatant to obtain colibacillus thallus;
s2: taking streptomycete SCUT-1 spore preservation solution for incubation, uniformly mixing with the escherichia coli thalli collected in the step S1, coating the mixture on a solid MS culture medium plate, and culturing;
s3: taking out the cultured solid MS culture medium plate; uniformly covering the apramycin and nalidixic acid aqueous solution on a solid MS culture medium flat plate; culturing the flat plate after fully airing; after obvious single colony grows on the MS culture medium plate, single colony is selected to be inoculated into a seed liquid culture medium added with apramycin and nalidixic acid, and shake culture is carried out;
the Streptomyces SCUT-1 spore preservation solution in the step S2 is prepared through the following preparation steps:
inoculating streptomycete SCUT-1 into a solid Gaoshan No.1 culture medium plate, and culturing until the gray green spores are generated; inoculating Streptomyces SCUT-1 spores to a spore preservation culture medium, and shake culturing to obtain Streptomyces SCUT-1 bacterial liquid.
5. The construction method according to claim 4, wherein:
the LB medium containing apramycin, chloramphenicol and kanamycin described in step S1 comprises the following components: tryptone 10g/L, sodium chloride 10g/L, yeast extract 5g/L, apramycin 50mg/L, chloramphenicol 25/mg/L, and kanamycin 50 mg/L;
the culture conditions described in step S1 are: culturing at 30-45 ℃ and 150-250 rpm for 12-20 h
The incubation condition in the step S2 is that incubation is carried out for 5-15 min at the temperature of 40-60 ℃;
the solid MS culture medium in the step S2 comprises the following components: 20g/L mannitol, 20g/L soybean powder, 10mmol/L magnesium chloride and 20g/L agar powder;
the culture conditions described in step S2 are: inverted culturing at 20-40 ℃ for 12-20 h;
the solute of the aqueous solution of apramycin and nalidixic acid described in step S3 is composed of the following components: apramycin 1mg/L and nalidixic acid 0.5mg/L; the solvent is distilled water;
the culture conditions described in step S3 are: culturing for 3-5 days at 30-45 ℃;
the seed solution culture medium containing the apramycin and the nalidixic acid in the step S3 comprises the following components: tryptone 10g/L, sodium chloride 10g/L, yeast extract 5g/L, apramycin 50mg/L and nalidixic acid 25 mg/L;
the shake culture conditions in the step S3 are as follows: shake culturing at 30-45 deg.c and 150-250 rpm for 45-51 hr.
6. The construction method according to claim 4, wherein:
the solid culture medium No.1 comprises the following components: 20g/L soluble starch, 1g/L potassium nitrate, 0.5g/L dipotassium hydrogen phosphate, 0.5g/L magnesium sulfate heptahydrate, 0.5g/L sodium chloride, 0.01g/L ferrous sulfate heptahydrate and 20g/L agar powder;
culturing for 5-7 days at the temperature of 30-45 ℃ until the culture condition for producing the gray green spores;
the spore preservation culture medium comprises the following components: 16g/L tryptone, 10g/L yeast extract, 5g/L sodium chloride.
7. Use of the recombinant Streptomyces strain according to claim 1 for producing chitooligosaccharides from shrimp shells.
8. The use according to claim 7, characterized in that:
preparing a fermentation medium by taking shrimp shells as the only carbon source and nitrogen source, inoculating the streptomycete recombinant strain of claim 1 into the fermentation medium for fermentation culture, and degrading chitin components in the recombinant strain shrimp shells to obtain the chitosan oligosaccharide.
9. The use according to any one of claims 7 or 8, wherein: the method comprises the following steps:
p1: inoculating streptomycete recombinant bacteria into a seed culture medium, and culturing to obtain streptomycete recombinant bacteria seed liquid;
p2: inoculating the streptomycete recombinant strain seed liquid obtained in the step P1 into a fermentation medium, fermenting, and collecting supernatant to obtain a chitosan oligosaccharide solution;
the seed medium described in step P1 comprises the following components: 10.0g/L tryptone, 10.0. 10.0g/L sodium chloride and 5.0. 5.0g/L yeast extract;
the fermentation medium described in step P2 comprises the following components: 100g/L dried shrimp shell, 0.5g/L anhydrous magnesium sulfate, 0.4g/L monopotassium phosphate, 0.8g/L dipotassium phosphate trihydrate and 0.02g/L ferrous sulfate heptahydrate.
10. The use according to claim 9, characterized in that:
the culture conditions described in step P1 are: culturing for 15-35 hours at 30-45 ℃ and 150-250 rpm;
the inoculation amount of the seed liquid in the step P2 is 1% of the volume of the fermentation medium;
the fermentation culture conditions in the step P2 are as follows: the culture time is 15-35 hours at 30-45 ℃ and 150-250 rpm.
CN202211297855.6A 2022-10-21 2022-10-21 Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells Active CN116144562B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211297855.6A CN116144562B (en) 2022-10-21 2022-10-21 Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211297855.6A CN116144562B (en) 2022-10-21 2022-10-21 Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells

Publications (2)

Publication Number Publication Date
CN116144562A CN116144562A (en) 2023-05-23
CN116144562B true CN116144562B (en) 2023-11-03

Family

ID=86357096

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211297855.6A Active CN116144562B (en) 2022-10-21 2022-10-21 Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells

Country Status (1)

Country Link
CN (1) CN116144562B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115927332B (en) * 2022-10-21 2023-09-26 华南理工大学 Promoter for over-expressing protease, streptomycete recombinant bacterium, construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109337843A (en) * 2018-11-19 2019-02-15 常熟理工学院 One plant of production chitinase bacterial strain and application
CN113106044A (en) * 2021-03-25 2021-07-13 华南理工大学 Streptomyces modified bacterium and application thereof in feather degradation
CN114438144A (en) * 2022-01-26 2022-05-06 华南理工大学 Method for producing amino acid, oligopeptide, calcium lactate and chitin by treating shrimp shell waste through streptomyces solid state fermentation and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109337843A (en) * 2018-11-19 2019-02-15 常熟理工学院 One plant of production chitinase bacterial strain and application
CN113106044A (en) * 2021-03-25 2021-07-13 华南理工大学 Streptomyces modified bacterium and application thereof in feather degradation
CN114438144A (en) * 2022-01-26 2022-05-06 华南理工大学 Method for producing amino acid, oligopeptide, calcium lactate and chitin by treating shrimp shell waste through streptomyces solid state fermentation and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Streptomyces sp. SCUT-3 chromosome, complete genome.GenBank: CP046907.1.2020,参见核苷酸序列及相关信息. *

Also Published As

Publication number Publication date
CN116144562A (en) 2023-05-23

Similar Documents

Publication Publication Date Title
CN108753669B (en) Adenine production strain and construction method and application thereof
CN110484471B (en) Acid-resistant strain for high yield of bacterial cellulose and method for producing bacterial cellulose by using acid-resistant strain
CN116144562B (en) Streptomyces recombinant strain and application thereof in production of chitosan oligosaccharide by utilizing shrimp shells
CN108546660B (en) Chitin deacetylase high-yield strain and application thereof
CN114874964A (en) Construction method and application of recombinant escherichia coli for high yield of 2' -fucosyllactose
CN113106044A (en) Streptomyces modified bacterium and application thereof in feather degradation
CN112251428A (en) Glutamic acid decarboxylase mutant and application thereof in production of gamma-aminobutyric acid
CN104342463B (en) A kind of preparation method of 1 cyanocyclohexanoic guanidine-acetic acid
CN111621454A (en) Production method and application of genetic engineering high-yield strain streptomyces diastatochromogenes and polylysine
CN113106112B (en) Genetically engineered bacterium for heterologously expressing xanthan endonuclease and application thereof
CN113151135A (en) Food safety-grade bacillus subtilis and application thereof in production of chitobiose deacetylase
CN113969256A (en) Bacterial strain for producing N-acetylglucosamine and construction method and application thereof
CN104212850A (en) Method for preparing 1-cyancyclohexylacetic acid by using nitrilase engineering bacterium
CN104087604A (en) Genetic expression sequence of inulin fructotransferase
CN112458022A (en) Bacillus licheniformis Bl22 for high yield of chitin deacetylase and related products and application thereof
CN115927332B (en) Promoter for over-expressing protease, streptomycete recombinant bacterium, construction method and application thereof
CN116286575B (en) Method for efficiently expressing raw starch alpha-amylase by using bacillus subtilis
CN114836361B (en) Bacillus amyloliquefaciens engineering strain for high yield of glucosamine and application thereof
CN107083375B (en) Medium-temperature alpha-amylase and gene and application thereof
CN104450595B (en) Glutamic acid decarboxylase recombinant bacterium and construction method and application thereof
CN113913483B (en) Method for co-production of trehalose and gluconic acid
CN117417874B (en) Engineering strain HC6-MT and application thereof in low-temperature production of trehalose
CN114672522B (en) Method for producing 2-keto-3-deoxy-D-gluconic acid by catalyzing N-acetyl-D-gluconolactone with double enzymes
CN115232805B (en) Chondroitin sulfate lyase, recombinant strain and application thereof
CN118291289A (en) Engineering bacterium for producing hyaluronidase and method for producing hyaluronidase by using wheat B starch

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant