CN116121402A - SNP molecular marker related to Su Shan pig total nipple number and application - Google Patents
SNP molecular marker related to Su Shan pig total nipple number and application Download PDFInfo
- Publication number
- CN116121402A CN116121402A CN202211715966.4A CN202211715966A CN116121402A CN 116121402 A CN116121402 A CN 116121402A CN 202211715966 A CN202211715966 A CN 202211715966A CN 116121402 A CN116121402 A CN 116121402A
- Authority
- CN
- China
- Prior art keywords
- pig
- site
- primer
- pigs
- nipple
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 210000002445 nipple Anatomy 0.000 title claims abstract description 42
- 239000003147 molecular marker Substances 0.000 title claims abstract description 26
- 241000282887 Suidae Species 0.000 claims abstract description 34
- 238000009395 breeding Methods 0.000 claims abstract description 23
- 230000001488 breeding effect Effects 0.000 claims abstract description 20
- 210000000349 chromosome Anatomy 0.000 claims abstract description 10
- 108700028369 Alleles Proteins 0.000 claims abstract description 6
- 239000003795 chemical substances by application Substances 0.000 claims abstract description 6
- 210000001766 X chromosome Anatomy 0.000 claims abstract description 5
- 230000035772 mutation Effects 0.000 claims abstract description 5
- 241000282898 Sus scrofa Species 0.000 claims description 50
- 238000000034 method Methods 0.000 claims description 9
- 239000002773 nucleotide Substances 0.000 claims description 8
- 125000003729 nucleotide group Chemical group 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000001514 detection method Methods 0.000 claims description 5
- 210000001519 tissue Anatomy 0.000 claims description 4
- 238000012360 testing method Methods 0.000 claims description 2
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 230000006651 lactation Effects 0.000 abstract description 4
- 239000000047 product Substances 0.000 description 10
- 230000002068 genetic effect Effects 0.000 description 9
- 238000012163 sequencing technique Methods 0.000 description 8
- 230000000694 effects Effects 0.000 description 7
- 230000006872 improvement Effects 0.000 description 7
- 238000004458 analytical method Methods 0.000 description 6
- 230000004069 differentiation Effects 0.000 description 6
- 238000012098 association analyses Methods 0.000 description 5
- 238000012986 modification Methods 0.000 description 5
- 230000004048 modification Effects 0.000 description 5
- 108020004414 DNA Proteins 0.000 description 4
- 230000008901 benefit Effects 0.000 description 4
- 239000011159 matrix material Substances 0.000 description 4
- 230000008569 process Effects 0.000 description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000003205 genotyping method Methods 0.000 description 3
- 230000001850 reproductive effect Effects 0.000 description 3
- 241001061264 Astragalus Species 0.000 description 2
- 235000010110 Astragalus glycyphyllos Nutrition 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 235000006533 astragalus Nutrition 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 244000144992 flock Species 0.000 description 2
- 238000012214 genetic breeding Methods 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 230000001737 promoting effect Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 102000002260 Alkaline Phosphatase Human genes 0.000 description 1
- 108020004774 Alkaline Phosphatase Proteins 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 108010007577 Exodeoxyribonuclease I Proteins 0.000 description 1
- 102100029075 Exonuclease 1 Human genes 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 208000005342 Porcine Reproductive and Respiratory Syndrome Diseases 0.000 description 1
- 101150041570 TOP1 gene Proteins 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 244000309466 calf Species 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 239000012636 effector Substances 0.000 description 1
- 239000000839 emulsion Substances 0.000 description 1
- 210000003754 fetus Anatomy 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 239000005457 ice water Substances 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000007918 intramuscular administration Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000004579 marble Substances 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000005065 mining Methods 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000009400 out breeding Methods 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 235000015277 pork Nutrition 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses SNP molecular markers related to total nipple numbers of Sushan pigs and application thereof, and aims to solve the technical problem that the current total nipple numbers of Sushan sows are insufficient and are difficult to meet the lactation requirements of piglets. The SNP molecular marker is as follows: the presence of a G/A mutation based on chromosome 98511381 base of version 11.1 of the International pig genome reference sequence number X; detecting and determining the genotype of the 98511381 th site of the X chromosome of the breeding pigs in the Su Shan pig core group; the 98511381 th site is AG and AA genotype individual, and the GG genotype individual is eliminated to raise the allele A frequency of the site and raise the nipple number of offspring pig.
Description
Technical Field
The application relates to the technical field of pig Marker Assisted Selection (MAS), in particular to an SNP molecular marker related to total nipple number of Sushan pigs and application thereof.
Background
Su Shan pig is a new variety of high-quality lean pigs bred by hybridization of local pigs with foreign good pigs in the national academy of agricultural sciences of Jiangsu province for 15 years, contains 25% of Taihu pig blood system and 75% of foreign pig blood system, has the characteristics of high quality (flesh color bright red, intramuscular fat content of 2.56% and marble grain of 3.1), high yield, stress resistance and the like, and has good carcass quality consistency. The Su Shan pigs are strong in physique and adaptability and suitable for being raised all over the country.
The total number of the sows is an important index for measuring the lactation capacity of the sows, and when the number of the sows is smaller than the litter size of the sows, the death rate of piglets can be obviously increased, so that larger economic loss is caused. Meanwhile, the number of the milk vetch and the number of the birth are related to a certain degree of phenotype and genetic correlation, and the effective combination of the number of the milk vetch and the number of the high birth is the physiological basis for realizing the high reproductive capacity of the sow. In recent years, with the increasing number of sows (such as French and Dan big white pigs), the contradiction that the limited nipple can not meet the need of piglet lactation is increasingly prominent, and the improvement of the nipple number of the sow by genetic improvement means is urgently needed.
However, nipple numbers as quantitative traits with moderate genetic transmission (about 0.3), it is difficult to obtain significant progress in genetic improvement in a short period of time using conventional breeding techniques and routes. The molecular breeding technology can effectively overcome the defects of traditional breeding and improve the breeding efficiency. Therefore, the development of SNP molecular markers affecting the total nipple number of Sushan pigs is of great significance for realizing innovation of basic theory and technical method for genetic improvement of pig reproduction traits and promoting high-quality development of pig industry.
The information disclosed in this background section is only for enhancement of understanding of the background of the disclosure and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art that is well known to a person skilled in the art.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to the total nipple number of a Sushan sow, and the SNP molecular marker is applied to the aspects of genotype identification, genetic breeding and the like, and aims to solve the technical problem that the current total nipple number of the Sushan sow is insufficient and the lactation requirement of piglets is difficult to meet.
The present application study developed a population differentiation index (fixation index,Fst) And genome-wide association analysis (GWAS), to identify molecular markers strongly associated with the total nipple number of Su Shan pigs, such as applying SNP with large effect to molecular marker-assisted selection and genome selection, thereby accelerating the genetic improvement progress of the total nipple number characters of Sushan pig groups and matched synthetic line groups, and further improving the economic benefit of pig breeding industry.
According to one aspect of the present disclosure, there is provided a SNP molecular marker associated with total nipple number of a su shan pig, wherein the SNP site thereof corresponds to the G/a mutation at nucleotide 98511381 of chromosome X of version 11.1 of the international genome, designated as mutation site rs332938314.
The primer pair for identifying the SNP molecular marker related to the total nipple number comprises a target product upstream primer P001, a target product downstream primer P002 and an SNPshot primer P003, and the nucleotide sequences are as follows:
primer P001: GTCTAGCCCAAACCCCATCT the number of the individual pieces of the plastic,
primer P002: CGGGAGAGGAGGGAGAAAAG the number of the individual pieces of the plastic,
primer P003: TTTTTTCATAGACTCCCTGAAAACTCA.
The nucleotide sequence of the SNP locus of the molecular marker is shown as SEQ ID NO.1, wherein M in the sequence is G or A, which leads to different distribution of the total nipple form of the Su Shan pig.
The SNP molecular marker and the primer thereof can be applied to identification of the effective nipple number character of Su Shan pigs and genetic breeding of pigs.
According to another aspect of the present disclosure, there is provided a method of identifying the SNP site affecting the Su Shan swine total nipple trait, comprising the steps of:
(1) Taking a tissue sample of a pig and extracting genome DNA;
(2) Performing PCR amplification and SNPshot reaction by using the primer of claim 2 and taking live pig genome DNA as a template;
(3) The SNPshot product was sequenced and based on the International pig genome version 11.1 reference sequence, the 98511381 nucleotide (rs 332938314) site on chromosome X was checked and the G/A polymorphism at that site was read.
According to another aspect of the present disclosure, there is provided a live pig strain breeding method for increasing the number of emulsion heads, comprising the steps of:
determining the positions of the SNP molecular markers related to nipple numbers of the breeding pigs in the Su Shan pig breeding core group, and making corresponding selections according to the molecular markers: selecting a pig breeding individual with AG and AA genotypes at the 98511381 th nucleotide (rs 332938314) locus on the 11.1 version X chromosome of the international pig reference genome from the pig breeding core group, and eliminating the pig breeding individual with GG genotype at the 98511381 th nucleotide (rs 332938314) locus to increase the frequency of the allele A at the locus generation by generation, thereby increasing the nipple number of offspring pigs.
The breeding pigs are Sushan pig groups and matched synthetic lines thereof.
One or more technical solutions provided in the embodiments of the present application at least have the following technical effects or advantages:
1. the application researches and determines that the molecular marker related to the total nipple number of the Su Shan pig is positioned on a nucleotide sequence on an X chromosome of the pig, verifies the influence effect of the molecular marker on the characteristics of the total nipple number, establishes a high-efficiency and accurate molecular marker assisted breeding method by using the molecular marker, is applied to the genetic improvement of the breeding pig for improving the nipple number, can rapidly and accurately carry out breeding on the pig, accelerates the breeding process, improves the reproductive performance of offspring pigs, improves enterprise profits and increases core competitiveness. The method specifically comprises the following steps: the dominant allele of the SNP is screened from generation to generation, so that the dominant allele frequency is improved, the total nipple number of pigs is further improved, and the progress of genetic improvement of the pigs is accelerated, so that the economic benefit of the pig raising industry is effectively improved.
2. The application provides a primer for identifying the SNP molecular marker on the X chromosome of the pig, which is related to the total nipple number, and establishes a high-efficiency and accurate molecular marker assisted breeding technology system, so that the pig is bred rapidly and accurately, and the breeding process is accelerated.
Drawings
FIG. 1 shows the population differentiation index of Sushan pig population on chromosome X with respect to the total nipple number trait in one embodiment of the present applicationFst) And a whole genome association analysis (GWAS) manhattan combinatorial graph; the solid line in the Manhattan diagram of the population differentiation index is a threshold line with Top1%, the abscissa is drawn by Su Shan pig chromosomes, and the ordinate represents the population differentiation index; full genome association analysis the abscissa in manhattan plot is plotted with chromosome, and the ordinate represents-lg @P) The dashed line represents a significant threshold line.
FIG. 2 shows the result of electrophoresis detection of PCR amplification of the target product using the primer P001 and the primer P002 according to one embodiment of the present application; agarose gel concentration was 2.0%; in the figure, lanes: m is DL 2000 Maker; lane 1 is a negative control; lane 2 is genotype GG,680, bp; lane 3 is genotype AG,680 bp; lane 4 is genotype AA,680 bp.
FIG. 3 is a peak diagram of the results of different genotypes of the main mutation site rs332938314 of the total papilla trait of Su Shan obtained by sequencing after SNPshot reaction using the primer P003 in an embodiment of the present application; wherein, (a) a peak pattern of sequencing results of genotype AG; (b) a peak plot of sequencing results of genotype GG; (c) peak pattern of sequencing result of genotype AA.
Detailed Description
For better understanding of the technical solutions of the present application, the following detailed description will refer to the accompanying drawings and specific embodiments.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related biochemical reagents and raw materials are all conventional products sold in the market unless specified; the test and detection methods are conventional methods unless otherwise specified.
Examples: cloning and genotyping of SNP markers
1. Test animal origin
The experimental population used in this example was 269 Sushan pig population from Hexagon field, the academy of agricultural sciences, jiangsu province. The pig flock can eat and drink water freely, and the whole feeding mode, feeding conditions and the like are kept consistent all the time, so that the pig flock is a conventional method.
2. Sample collection and phenotype recording
The ear tissues of the pigs were collected, stored in a 2 mL centrifuge tube containing 75% ethanol, stored in a refrigerator at-20 ℃ and the total nipple number was recorded in a counting manner.
3. DNA extraction and genotyping chip scanning
Genomic DNA was extracted from Porcine reproductive and respiratory syndrome tissue samples using a conventional phenol chloroform method, and genotyping was performed using Porcine SNP 55K Array.
4. Genotype filling
20 individuals were selected that were able to represent the entire blood margin of the population and subjected to whole genome resequencing (average sequencing depth 20×). In addition, 367 swine resequencing data were downloaded from the NCBI website SRA public database, including 184 chinese local pigs, 13 chinese wild pigs, 142 european commercial pigs, 21 european wild pigs and 7 exotic pigs. Performing SNP mining and quality control on the re-sequenced data of 387 pigs to obtain 3130000 SNP data sets; genotype filling and quality control are carried out on the data of the 269 Sushan pig 55K chip by using Beagle software, and 2676280 SNPs which can be used for subsequent data analysis are finally obtained.
5. Population differentiation index analysis
Dividing into two subgroups according to the first 10% and the last 10% of each character phenotype value, based on the filled SNP data set, using VCFtools v0.1.17 software, window size is 50 kb, and sliding window calculation is carried out on each SNPs in 20 kb stepsFstValues. Based onFstAs a result of (a), a manhattan diagram is drawn using the Cmplot package in the R language,Fstthe threshold is the first 1% of the Fst values ordered by size, points above the threshold are considered significantly differentiatedAn area.
6. Whole genome association analysis
Based on the genotype-filled SNP dataset, GWAS was performed on Su Shan pig total nipple number trait using GEMMA software, and in order to correct the impact on association analysis due to other factors such as genetic relationship, gender, and birth, this example uses a hybrid linear model (mixed linear model, MLM) for analysis, the model is as follows:
y = Wα + Xβ + u + ε；
y is a phenotype vector;Wtaking the weight, sex and fetus number as the covariates of the primary body ruler property as the association matrix of covariates (fixed effect); α is a vector of corresponding coefficients including intercept;Xis a SNP matrix; beta is the effect of SNP; u is a random effector vector of m×1, where u-MVN m （0, λ τ −1 K），τ −1 As variance of residual, λ is τ −1 And the ratio of epsilon,Kis an n×n relative matrix; epsilon is the vector of random residuals, epsilon-MVNn (0, τ) −1 I n ），I n Is a unit matrix; MVN n Representing an n-dimensional multivariate normal distribution. Definition of the definitionP = 1 × 10 -5 Is a significant threshold line. The GWAS results are visualized using Cmplot packages in the R language.
FstAnd GWAS analysis results are shown in fig. 1. From this figure, it can be seen that rs332938314 located on chromosome X significantly affects total nipple number in the data of intersection of common significant loci obtained based on two analysis methods in the Su Shan pig population, its population differentiation index and correlation analysisPThe values were 0.17 and 9.03E-06, respectively.
7. Correlation analysis of different genotypes and nipple number phenotypes
As can be seen from Table 1, the SNP locus of the molecular marker is extremely significantly related to the total nipple number traitP =2.92E-06), it is shown that the molecular marker significantly affects the overall nipple number trait of Su Shan pigs, and the total nipple number of Sushan pigs and matched synthetic line groups thereof can be increased by auxiliary selection of the locus of pigs, thereby accelerating the breeding process.
TABLE 1 SNP site G > A Effect analysis of molecular markers
Further, as can be seen from table 1, the average total nipple number of genotypes AG and AA is higher than that of genotype GG, and thus it is considered that the a gene is an allele contributing to an increase in the trait of the total nipple number of Su Shan pigs.
6. PCR amplification of target DNA sequence, SNPshot reaction and sequencing
The designed primer DNA sequences are shown below (SEQ ID NOS.2 to 4):
primer P001: GTCTAGCCCAAACCCCATCT
Primer P002: CGGGAGAGGAGGGAGAAAAG
Primer P003: TTTTTTCATAGACTCCCTGAAAACTCA
And (3) PCR amplification: to 25. Mu.L of the reaction system, 1.50. Mu.L of DNA template, 9.00. Mu.L of double distilled water, 12.50. Mu.L of 2X Taq PCR Mastermix (day root) and 1.00. Mu.L of each of the primers P001 and P002 were added.
The PCR reaction conditions were: after pre-denaturation at 94℃for 5 min, denaturation at 94℃for 30 s, annealing at 62.0℃for 30 s, elongation at 72℃for 40 s,30 cycles, and elongation at 72℃for 10 min. The result of the electrophoresis detection of the PCR amplification of the target product is shown in FIG. 2.
And (3) purifying a PCR product: mu.L of PCR amplification product was taken and 1U of exonuclease I (Exo I) and calf serum alkaline phosphatase (CIP) were added, respectively. The PCR reaction conditions were: purifying at 37deg.C for 1 hr, and denaturing at 72deg.C for 15 min.
SNPshot reaction: SNPshot Mul-primer reagent 1. Mu.L, purified product 1. Mu.L primer P003 0.2. Mu.L, and double distilled water was added to 5.00. Mu.L. The PCR reaction conditions were: after pre-denaturation at 94℃for 1 min, denaturation at 94℃for 10 s, annealing at 50.0℃for 5 s, elongation at 60℃for 30 s,30 cycles, and incubation at 4 ℃.
Sequencing on a machine: the SNPshot product was removed, CIP 1U was added, purified at 37℃for 1 h, and denatured at 72℃for 15 min. Further, 1. Mu.L of the product was taken, 9. Mu.L of Hi-Di was added thereto, denatured at 94℃for 5 minutes, and rapidly taken out to ice water for 5 minutes. Sequencing was performed on a sequencer (ABI 3730 XL). The relevant detection results are shown in fig. 3.
Effect analysis of molecular marker SNP locus rs 332938314: in the embodiment, by detecting rs332938314 and performing the correlation analysis between the genotype and the total nipple number character of the Su Shan pig group, a new molecular marker is provided for the auxiliary selection of the molecular marker of pigs. The molecular marker assisted selection can accelerate the breeding process of the Sushan pig, and increase the reproductive performance of the Sushan pig, thereby promoting the production of pork and driving the greater economic benefit of pig raising industry.
While certain preferred embodiments of the present application have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the application.
It will be apparent to those skilled in the art that various modifications and variations can be made in the present application without departing from the spirit and scope of the invention of the present application. Thus, if such modifications and variations are within the scope of the claims and their equivalents, the application is intended to cover such modifications and variations.
Claims (6)
1. A SNP molecular marker associated with total nipple number of su shan pigs, characterized in that the SNP site corresponds to the G/a mutation at nucleotide position 98511381 on chromosome X of international swine genome version 11.1 reference sequence.
2. A primer for identifying the SNP molecular marker of claim 1, comprising:
the upstream primer P001: GTCTAGCCCAAACCCCATCT the number of the individual pieces of the plastic,
downstream primer P002: CGGGAGAGGAGGGAGAAAAG the number of the individual pieces of the plastic,
SNPshot primer P003: TTTTTTCATAGACTCCCTGAAAACTCA.
3. A test kit comprising the primer of claim 2.
4. Use of the SNP molecular marker of claim 1, the primer of claim 2 or the detection kit of claim 3 in pig nipple trait breeding.
5. A method for identifying the nipple number trait genotype of a Sushan pig, comprising the steps of:
(1) Taking a tissue sample of a pig to be detected and extracting genome DNA;
(2) Performing PCR amplification and SNPshot reaction by using the primer of claim 2 and taking live pig genome DNA as a template;
(3) The SNPshot product was sequenced, and based on the International pig genome version 11.1 reference sequence, the 98511381 nucleotide site on chromosome X was checked, and the G/A polymorphism at that site was interpreted.
6. A breeding method for improving the total nipple number of Sushan pigs is characterized by comprising the following steps:
(1) Detecting and determining the genotype of the breeding pigs in the Su Shan pig core group at 98511381 th site on chromosome X based on the International pig reference genome version 11.1;
(2) Selecting a boar individual with AG and AA genotype at the 98511381 th site on the X chromosome from the boar core group, and eliminating the boar individual with GG genotype at the site to increase the frequency of allele A at the site by generations, thereby increasing the nipple number of offspring pigs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211715966.4A CN116121402A (en) | 2022-12-29 | 2022-12-29 | SNP molecular marker related to Su Shan pig total nipple number and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211715966.4A CN116121402A (en) | 2022-12-29 | 2022-12-29 | SNP molecular marker related to Su Shan pig total nipple number and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116121402A true CN116121402A (en) | 2023-05-16 |
Family
ID=86296723
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211715966.4A Pending CN116121402A (en) | 2022-12-29 | 2022-12-29 | SNP molecular marker related to Su Shan pig total nipple number and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116121402A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355398A (en) * | 2018-11-19 | 2019-02-19 | 南京农业大学 | One kind SNP marker primer relevant to Erhualian number born alive and its application |
-
2022
- 2022-12-29 CN CN202211715966.4A patent/CN116121402A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355398A (en) * | 2018-11-19 | 2019-02-19 | 南京农业大学 | One kind SNP marker primer relevant to Erhualian number born alive and its application |
Non-Patent Citations (2)
| Title |
|---|
| ENSEMBL: "rs332938314", EMSEMBL RELEASE 108, 31 October 2022 (2022-10-31), pages 1 * |
| 张昌政等: "基于全基因组填充重测序关联分析鉴别影响苏山猪初生体尺与乳头数性状的遗传位点", CNKI中国知网, 26 October 2022 (2022-10-26), pages 6 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108531608B (en) | BMP6 gene as molecular marker for black goat lambing number character | |
| CN107164463B (en) | SNP marker for determining and/or genetically improving growth traits of pigs | |
| CN110541038A (en) | SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application | |
| CN110144408B (en) | SNP molecular marker located on pig chromosome 7 and related to total papilla number and application | |
| CN110468212B (en) | SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application | |
| US20060172329A1 (en) | DNA markers for cattle growth | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN116590433A (en) | Molecular marker, primer, kit, identification method and application of reproductive performance of large white sow | |
| CN113637768B (en) | SNP molecular marker related to number of sow-produced malformed piglets on chromosome 13 of pig and application thereof | |
| CN113736890B (en) | SNP molecular marker related to healthy number and living number rate and application thereof | |
| CN112760387B (en) | SNP molecular marker related to total nipple number of pigs and application | |
| CN113736889B (en) | SNP molecular marker related to pig stillbirth number and live litter rate on chromosome 7 and application thereof | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN110438238B (en) | SNP (single nucleotide polymorphism) site related to premna ungula weight on chromosome 6 of meat Simmental cattle and application | |
| CN115011704A (en) | SNP molecular marker influencing litter interval traits and application thereof | |
| CN116121402A (en) | SNP molecular marker related to Su Shan pig total nipple number and application | |
| CN113355427B (en) | SNP (single nucleotide polymorphism) marker related to pig backfat thickness and utilization method thereof | |
| CN113699248A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN106755370B (en) | Method for detecting sheep FTH-1 gene single nucleotide polymorphism by using PCR-RFLP and application thereof | |
| CN112592984B (en) | SNP molecular marker affecting swine nipple number character and application thereof | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application | |
| CN110760593A (en) | SNP (single nucleotide polymorphism) site related to spleen weight on chromosome 6 of meat Simmental cattle and application | |
| CN109439766A (en) | Application of the ATG10 gene as ox superfecundation trait molecular marker | |
| CN114085914B (en) | SNP molecular marker located on chromosome 9 of pig and related to litter size and application thereof | |
| CN111850139B (en) | Molecular marker located on pig chromosome 12 and related to formation of pig monocrchidism and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |