CN116121349A - Method for amplifying nucleic acid sample containing ethanol - Google Patents

Method for amplifying nucleic acid sample containing ethanol Download PDF

Info

Publication number
CN116121349A
CN116121349A CN202310316926.0A CN202310316926A CN116121349A CN 116121349 A CN116121349 A CN 116121349A CN 202310316926 A CN202310316926 A CN 202310316926A CN 116121349 A CN116121349 A CN 116121349A
Authority
CN
China
Prior art keywords
ethanol
nucleic acid
trehalose
mol
acid sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310316926.0A
Other languages
Chinese (zh)
Other versions
CN116121349B (en
Inventor
吴恒
曹林
聂俊伟
董文敏
许莹莹
吴悦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Nuoweizan Animal Health Co ltd
Nanjing Novozan Biotechnology Co ltd
Original Assignee
Nanjing Nuoweizan Animal Health Co ltd
Nanjing Novozan Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Nuoweizan Animal Health Co ltd, Nanjing Novozan Biotechnology Co ltd filed Critical Nanjing Nuoweizan Animal Health Co ltd
Publication of CN116121349A publication Critical patent/CN116121349A/en
Application granted granted Critical
Publication of CN116121349B publication Critical patent/CN116121349B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method for amplifying a nucleic acid sample containing ethanol, and belongs to the technical field of biology. According to the invention, trehalose is added into an amplification system as a protective agent, so that the influence of ethanol residue on an amplification platform in the upstream nucleic acid extraction process can be effectively relieved.

Description

Method for amplifying nucleic acid sample containing ethanol
Technical Field
The invention relates to the field of biotechnology, in particular to a method for amplifying a nucleic acid sample containing ethanol.
Background
In recent years, as the heat of pathogen detection increases, pathogen nucleic acid detection has gradually become the gold standard for pathogen detection. Along with the need of detecting results of a large number of samples in a short time, the high throughput and high efficiency of nucleic acid extraction gradually become market demands, and the rapid extraction also gradually becomes a standard of a laboratory. The magnetic bead method rapid nucleic acid extraction consists of steps of cracking, washing, eluting and the like, and some impurity residues such as protein, guanidine salt, alcohols, EDTA and the like exist in the process. Wherein the washing step is critical during the extraction process, and the purity of the nucleic acid directly affects the application of the downstream PCR experiments. The conventional washing liquid contains ethanol substances, and after repeated washing, ethanol residues can be caused by incomplete elution, the ethanol substances have a large influence on a qPCR amplification platform, and the amplification platform gradually descends along with the increase of the ethanol concentration.
Disclosure of Invention
The present invention aims to address the deficiencies of the prior art and provides a method for amplifying an ethanol-containing nucleic acid sample that can significantly reduce the effect of ethanol residue on downstream amplification during extraction.
A first aspect of the present application provides a method of amplifying a nucleic acid sample comprising ethanol, the method comprising: (1) providing a nucleic acid sample comprising ethanol; (2) Preparing a qPCR amplification system by taking the nucleic acid sample in the step (1) as a template; (3) performing a qPCR amplification reaction under suitable conditions.
In some embodiments, the amount of ethanol (volume fraction) in the qPCR amplification system is 0.1-10%, preferably 0.1% -8%, more preferably 0.1% -7%, including 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5.5%, 6% and 7% within the stated range.
In some embodiments, the nucleic acid sample is DNA, such as gDNA, plasmid DNA, and mitochondrial DNA; preferably, the concentration of said DNA in the qPCR amplification system is 0.01-1 ng/. Mu.L, preferably 0.01-0.5 ng/. Mu.L, including 0.01 ng/. Mu.L, 0.02 ng/. Mu.L, 0.03 ng/. Mu.L, 0.04 ng/. Mu.L, 0.05 ng/. Mu.L, 0.06 ng/. Mu.L, 0.07 ng/. Mu.L, 0.08 ng/. Mu.L, 0.09 ng/. Mu.L, 0.1 ng/. Mu.L, 0.15 ng/. Mu.L, 0.2 ng/. Mu.L, 0.25 ng/. Mu.L, 0.3 ng/. Mu.L, 0.35 ng/. Mu.L, 0.4 ng/. Mu.L and 0.5 ng/. Mu.L within said range.
In some embodiments, the nucleic acid sample is RNA, such as Total RNA, mRNA, miRNA, and other small molecule RNAs; preferably, the concentration of said RNA in the qPCR amplification system is 0.01-1 ng/. Mu.L, preferably 0.01-0.5 ng/. Mu.L, including 0.01 ng/. Mu.L, 0.02 ng/. Mu.L, 0.03 ng/. Mu.L, 0.04 ng/. Mu.L, 0.05 ng/. Mu.L, 0.06 ng/. Mu.L, 0.07 ng/. Mu.L, 0.08 ng/. Mu.L, 0.09 ng/. Mu.L, 0.1 ng/. Mu.L, 0.15 ng/. Mu.L, 0.2 ng/. Mu.L, 0.25 ng/. Mu.L, 0.3 ng/. Mu.L, 0.35 ng/. Mu.L, 0.4 ng/. Mu.L and 0.5 ng/. Mu.L within said range.
In some embodiments, the qPCR amplification system further comprises buffer substances, dNTPs, metal salts, DNA polymerase, trehalose, primers, probes, and/or fluorescent dyes.
In some embodiments, the concentration of trehalose in the qPCR amplification system is 0.01-5mol/L, preferably 0.01-2mol/L, more preferably 0.01-1mol/L, including 0.01mol/L, 0.02mol/L, 0.03mol/L, 0.04mol/L, 0.05mol/L, 0.06mol/L, 0.07mol/L, 0.08mol/L, 0.09mol/L, 0.1mol/L, 0.15mol/L, 0.2mol/L, 0.25mol/L, 0.3mol/L, 0.35mol/L, 0.4mol/L, 0.45mol/L, 0.5mol/L, 0.55mol/L, 0.6mol/L, 0.65mol/L, 0.7mol/L, 0.75mol/L, 0.8mol/L, 0.85mol/L, 0.9mol/L, and 1.95 mol/L within the stated ranges.
In some embodiments, the buffer substance comprises one or more of Tris, tris-HCl, tris base or HEPES, preferably Tris-HCl, more preferably the concentration of Tris-HCl in the qPCR amplification system is 5-50mmol/L, including 5mmol/L,10mmol/L,12mmol/L,15mmol/L,18mmol/L,20mmol/L,22mmol/L,25mmol/L,28mmol/L,30mmol/L,32mmol/L,35mmol/L,38mmol/L,40mmol/L,42mmol/L,45mmol/L,48mmol/L and 50mmol/L within the stated ranges.
In some embodiments, the concentration of the dNTPs in the qPCR amplification system is 0.1-1mmol/L, including 0.1mmol/L,0.2mmol/L,0.3mmol/L,0.4mmol/L,0.5mmol/L,0.6mmol/L,0.7mmol/L,0.8mmol/L,0.9mmol/L, and 1mmol/L within the stated range.
In some embodiments, the metal salt is Mg 2+ Salt, K + Salts, mn 2+ Salts, na + Salts and Ca 2+ One or more of the salts; in some embodiments, the concentration of the metal salt in the qPCR amplification system is 30-80mmol/L, including 30, 35, 40, 45, 50, 55, 58, 60, 62, 65, 68, 70, 75 and 80mmol/L within the ranges.
In some embodiments, the metal salt comprises Mg 2+ Salts and K + A salt; preferably, the metal salt comprises MgCl 2 And KCl, more preferably, the MgCl 2 The concentration in the qPCR amplification system is 2-10mmol/L, including 2mmol/L,3mmol/L,4mmol/L,5mmol/L,6mmol/L,7mmol/L,8mmol/L,9mmol/L and 10mmol/L in the range, and the concentration of KCl in the qPCR amplification system is 30-80mmol/L, including 30mmol/L,32mmol/L,35mmol/L,38mmol/L,40mmol/L,42mmol/L,45mmol/L,48mmol/L,50mmol/L,52mmol/L,55mmol/L,58mmol/L,60mmol/L,62mmol/L,65mmol/L,68mmol/L,70mmol/L,72mmol/L,75mmol/L,78mmol/L and 80mmol/L in the range.
In some embodiments, the DNA polymerase is a thermostable DNA polymerase, preferably Taq DNA polymerase, at a concentration of 1-5U/μL in the qPCR amplification system, including 1U/μL,1.2U/μL,1.5U/μL,1.8U/μL,2U/μL,2.5U/μL,3U/μL,3.5U/μL,4U/μL,4.5U/μL, and 5U/μL within the range.
In some embodiments, the primers comprise at least one pair of an upstream primer and a downstream primer, the concentration of the upstream primer and the downstream primer in the qPCR amplification system is 0.2 to 0.5. Mu. Mol/L, including 0.2. Mu. Mol/L, 0.3. Mu. Mol/L, 0.4. Mu. Mol/L, and 0.5. Mu. Mol/L within the range.
In some embodiments, the probe is a TaqMan probe at a concentration of 0.1-0.5. Mu. Mol/L in the qPCR amplification system, including 0.1. Mu. Mol/L, 0.2. Mu. Mol/L, 0.3. Mu. Mol/L, 0.4. Mu. Mol/L, and 0.5. Mu. Mol/L within the range. The TaqMan probe comprises a reporting fluorescent group (Reporter) marked at the 5 'end and a quenching fluorescent group (Quencher) marked at the 3' end; the reporter fluorophore is, for example, FAM, VIC, HEX or TET, and the quencher fluorophore is, for example, BHQ1, TAMRA, MGB.
In some embodiments, the fluorescent dye is SYBRGreen or EvaGreenTM, preferably SYBRGreen.
In some embodiments, the qPCR amplification reaction comprises a pre-denaturation and a cycling reaction; the temperature of the pre-denaturation is from 90 to 98 ℃, e.g. from 92 to 96 ℃, e.g. 95 ℃, incubation for 20s to 60s, e.g. 25s to 40s, e.g. 30s; the cyclic reaction comprises denaturation at 95 ℃ for 8-12s, annealing at 55-65 ℃ and extension for 10-30s for 40-50 cycles.
In some embodiments, when the nucleic acid sample is RNA, the qPCR amplification system further comprises a reverse transcriptase including, but not limited to, any reverse transcriptase known in the art having RNA-guided DNA polymerase activity, such as MMLV, HIV or AMV, preferably MMLV reverse transcriptase, more preferably at a concentration of 1-10U/μl in the qPCR amplification system, including 1U/μl,2U/μl,2.5U/μl,3U/μl,3.5U/μl,4U/μl,4.5U/μl,5U/μl,5.5U/μl,6U/μl,6.5U/μl,7U/μl,7.5U/μl,8U/μl,8.5U/μl,9U/μl, 9.5/μl and 10U/μl within the range.
In some embodiments, when the nucleic acid sample is RNA, the qPCR amplification reaction is RT (Reverse transcription) -qPCR amplification reaction/reverse transcription qPCR, the RT-qPCR amplification reaction comprising reverse transcription, pre-denaturation, and cycling reactions; the temperature of the reverse transcription is 50-60 ℃, e.g. 52-58 ℃, e.g. 55 ℃, for 10-20min, e.g. 12-18min, e.g. 15min; the temperature of the pre-denaturation is from 90 to 98 ℃, e.g. from 92 to 96 ℃, e.g. 95 ℃, incubation for 20s to 60s, e.g. 25s to 40s, e.g. 30s; the cyclic reaction comprises denaturation at 95 ℃ for 8-12s, annealing at 55-65 ℃ and extension for 10-30s for 40-50 cycles.
In some embodiments, the qPCR amplification system comprises: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, 0.1-0.5. Mu. Mol/L of probe and optionally 1-10U/. Mu.L of reverse transcriptase; more preferably, the qPCR amplification system comprises: 0.5-8% (volume fraction) ethanol, 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2mol/L trehalose, 20-30mmol/L Tris-HCl,0.1-0.5mmol/L dNTPs,2-5mmol/L MgCl 2 40-60mmol/L KCl, 1-3U/. Mu.L Taq DNA polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, 0.1-0.4. Mu. Mol/L probe and optionally 3-6U/. Mu.L MMLV reverse transcriptase; most preferably, the qPCR amplification system comprises: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 50mmol/L KCl, 2U/. Mu.L Taq DNA polymerase, 0.2. Mu. Mol/L upstream and downstream primers, 0.2. Mu. Mol/L probe and optionally 4U/. Mu.L MMLV reverse transcriptase.
In some embodiments, the qPCR amplification system comprises: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, fluorescent dye and optionally 1-10U/. Mu.L of reverse transcriptase; more preferably, the qPCR amplification system comprises: 0.5-8% (volume fraction) ethanol 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2mol/L trehalose, 20-30mmol/L Tris-HCl,0.1-0.5mmol/L dNTPs,2-5mmol/L MgCl 2 40-60mmol/L KCl, 1-3U/. Mu.L Taq DNA polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, SYBR GREEN fluorescent dye and optionally 3-6U/. Mu.L MMLV reverse transcriptase; most preferably, the qPCR amplification system comprises: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 KCl, 50mmol/L, 2U/. Mu.L Taq DNA polymerase, 0.2. Mu. Mol/L upstream and downstream primer, SYBR GREEN fluorescent dye and optionally 4U/. Mu.L MMLV reverse transcriptase.
In a second aspect the present application provides the use of trehalose to increase the activity of Taq enzyme retention after PCR amplification of an ethanol-containing nucleic acid sample.
In some embodiments, the ethanol content (volume fraction) in the PCR amplification system is 0.1-10%, preferably 0.1% -8%, more preferably 0.1% -7%, including 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6% and 7% within the stated range.
In some embodiments, the concentration of trehalose in the PCR amplification system is 0.01-5mol/L, preferably 0.01-2mol/L, more preferably 0.01-1mol/L, including 0.01mol/L, 0.02mol/L, 0.03mol/L, 0.04mol/L, 0.05mol/L, 0.06mol/L, 0.07mol/L, 0.08mol/L, 0.09mol/L, 0.1mol/L, 0.15mol/L, 0.2mol/L, 0.25mol/L, 0.3mol/L, 0.35mol/L, 0.4mol/L, 0.45mol/L, 0.5mol/L, 0.55mol/L, 0.6mol/L, 0.65mol/L, 0.7mol/L, 0.75mol/L, 0.8mol/L, 0.85mol/L, 0.9mol/L, and 1.95 mol/L within the stated ranges.
A third aspect of the present application provides the use of trehalose to increase the efficiency of PCR amplification of ethanol-containing nucleic acid samples.
In some embodiments, the ethanol content (volume fraction) in the PCR amplification system is 0.1-10%, preferably 0.1% -8%, more preferably 0.1% -7%, including 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6% and 7% within the stated range.
In some embodiments, the concentration of trehalose in the PCR amplification system is 0.01-5mol/L, preferably 0.01-2mol/L, more preferably 0.01-1mol/L, including 0.01mol/L, 0.02mol/L, 0.03mol/L, 0.04mol/L, 0.05mol/L, 0.06mol/L, 0.07mol/L, 0.08mol/L, 0.09mol/L, 0.1mol/L, 0.15mol/L, 0.2mol/L, 0.25mol/L, 0.3mol/L, 0.35mol/L, 0.4mol/L, 0.45mol/L, 0.5mol/L, 0.55mol/L, 0.6mol/L, 0.65mol/L, 0.7mol/L, 0.75mol/L, 0.8mol/L, 0.85mol/L, 0.9mol/L, and 1.95 mol/L within the stated ranges.
In some embodiments, the PCR includes, but is not limited to, PCR, qPCR, and RT-qPCR as known in the art.
A fourth aspect of the present application provides a PCR amplification reaction solution comprising: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, 0.1-0.5. Mu. Mol/L of probe and optionally 1-10U/. Mu.L of reverse transcriptase.
In some embodiments, the reaction solution comprises: 0.5-8% (volume fraction) ethanol, 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2mol/L trehalose, 20-30mmol/L Tris-HCl,0.1-0.5mmol/L dNTPs,2-5mmol/L MgCl 2 40-60mmol/L KCl, 1-3U/. Mu.L Taq DNA polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, 0.1-0.4. Mu. Mol/L probe and optionally 3-6U/. Mu.L MMLV reverse transcriptase.
In some embodiments, the reaction solution comprises: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 50mmol/L KCl, 2U/. Mu.L Taq DNA polymerase, 0.2. Mu. Mol/L upstream and downstream primers, 0.2. Mu. Mol/L probe and optionally 4U/. Mu.L MMLV reverse transcriptase.
A fifth aspect of the present application provides a PCR amplification reaction solution comprising: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, fluorescent dye and optionally 1-10U/. Mu.L of reverse transcriptase.
In some embodiments, the reaction solution comprises: 0.5-8% (volume fraction) ethanol, 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2moltrehalose/L, tris-HCl of 20-30mmol/L, dNTPs of 0.1-0.5mmol/L, mgCl of 2-5mmol/L 2 40-60mmol/L KCl, 1-3U/. Mu.L Taq DNA polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, SYBR GREEN fluorescent dye and optionally 3-6U/. Mu.L MMLV reverse transcriptase.
In some embodiments, the reaction solution comprises: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 50mmol/L KCl, 2U/. Mu.L Taq DNA polymerase, 0.2. Mu. Mol/L upstream and downstream primers, SYBR GREEN fluorescent dye and optionally 4U/. Mu.L MMLV reverse transcriptase.
Drawings
Fig. 1: when the sample contains 0% ethanol (the amplification system contains 0% ethanol), the influence of trehalose with different concentrations on the amplification curve is added;
fig. 2: when the sample contains 6% ethanol (the amplification system contains 3% ethanol), the influence of trehalose with different concentrations on the amplification curve is added;
fig. 3: when the sample contains 8% ethanol (the amplification system contains 4% ethanol), the influence of trehalose with different concentrations on the amplification curve is added;
fig. 4: when the sample contains 10% ethanol (the amplification system contains 5% ethanol), the effect of trehalose with different concentrations on the amplification curve is added.
Interpretation of the terms
Trehalose: trehalose is also known as uniforms, mycoses, and is a non-reducing disaccharide consisting of two glucose molecules. The structural formula is alpha-D-glucopyranosyl-alpha-D-glucopyranoside, which is usually present as a dihydrate and has a molecular formula of C 12 H 22 O 11 ·2H 2 O. The protective film formed on the cell surface under the adverse conditions of high temperature, high cold and the like can effectively protect the biological molecular structure from being damaged.
Taq enzyme: taq enzyme is a thermostable DNA polymerase isolated from Thermus aquaticus ThermusAquaticus (Taq). DNA polymerase is a class of enzymes that catalyze the polymerization of substrate dNTP molecules to form daughter DNA in the presence of primers using parent DNA as a template.
Enzyme activity: the unit of measurement of the enzyme activity is U.
qPCR: the qPCR technology is a method of adding a fluorescent group into a PCR reaction system, monitoring the whole PCR process in real time by utilizing fluorescent signal accumulation, and finally quantitatively analyzing an unknown template through a standard curve.
Amplification platform: qPCR amplification platform refers to the arrival of qPCR reaction at the platform phase. The amplification of the target DNA fragment initially appears as an exponential rise, and as the target DNA fragment gradually accumulates, when the reaction substrates such as primer/template/dNTP/polymerase reach a certain ratio, the catalytic reaction of the enzyme tends to saturate, and the concentration of the target DNA product does not increase anymore, so-called platform effect occurs.
Detailed Description
The technical scheme of the invention is further described below by means of specific embodiments in combination with the accompanying drawings. However, the following examples are merely illustrative of the present invention and are not representative or limiting of the scope of the present invention. The protection scope of the invention is subject to the claims. In the examples below, reagents and consumables were purchased from commercial suppliers, and experimental methods and techniques were used as conventional in the art, unless otherwise specified.
Example 1
Human throat swab samples were taken and Total RNA samples from humans were extracted using the Vazyme#Rc313 kit. Pure ethanol (concentration about 95%) was added to the extracted RNA template so that the final concentration of ethanol in the template was 0%, 6%, 8%, 10% (volume fraction), respectively, to prepare RNA samples containing ethanol at different concentrations.
An amplification system as shown in Table 1 was prepared, in which,
10×Buffer：Tris-HCl(pH 8.7)，200mM；MgCl2，30mM；KCl，500mM；dNTP，2mM。
enzyme Mix: 80U/. Mu.l of reverse transcriptase (Vazyme #P132); taqDNA polymerase 40U/. Mu.l (Vazyme #R312)
The final concentrations of trehalose in the amplification system were 0, 0.1M, 0.2M, 0.4M and 0.6M, respectively, and the final concentrations of ethanol in the amplification system (volume fraction) were 0%, 3%, 4%, 5%, respectively, and the sequences of the used upstream and downstream primers and probes (directions: 5 '. Fwdarw.3') were:
upstream primer F (SEQ ID NO. 1): ATCATTGCTCCTCCTGAGCG
Downstream primer R (SEQ ID NO. 2): CATCTGCTGGAAGGTGGACA
Probe (SEQ ID No. 3): FAM-CTCCGTGTGGATCGGCGGCT-BHQ1
TABLE 1 qPCR System
Component (A) Addition amount of
10×Buffer 2μl
Upstream primer/downstream primer (20. Mu. Mol/L) 0.2μl
Probe (20 mu mol/L) 0.2μl
EnzymeMix 1μl
Template RNA (0.1 ng/. Mu.l) 10μl
Trehalose (2 mol/L) 0/1/2/4/6μl
Pure water Supplement to 20 mul
qPCR amplification was performed according to the procedure described in Table 2, and the reaction amplification curves are shown in FIGS. 1 to 4.
TABLE 2 PCR procedure
Figure BDA0004150379040000081
As can be seen from fig. 1-4, the amplification plateau gradually decreases as the ethanol concentration increases in the reaction. When the trehalose protecting agent is not added in the amplification reaction and the template contains 10% ethanol (5% ethanol is contained in the amplification system), the reaction is not amplified. When trehalose is added into the amplification reaction liquid, and when the template contains 10% ethanol (the amplification system contains 5% ethanol), the amplification platform is gradually lifted along with the lifting of the trehalose concentration, when the trehalose concentration in the reaction system is lifted from 0.1M to 0.2M, the lifting of the amplification platform is obvious, and when the trehalose concentration is lifted from 0.4M to 0.6M, the lifting effect of the trehalose of 0.6M on the amplification platform is slightly better than that of the trehalose of 0.4M.
Example 2
Control amplification system: the preparation was performed according to example 1, table 1, wherein the RNA template was ethanol-free and stored at-20 ℃;
experimental group amplification system: the enzyme activities of the control and experimental groups were determined after 42 cycles of preparation according to example 1, table 1 and amplification according to the procedure of example 1, table 2.
1. And (3) standard curve preparation: taq enzyme labels (Vazyme, P101) were subjected to gradient dilution to 15 mU/. Mu.l, 7.5 mU/. Mu.l, 3.75 mU/. Mu.l, 1.875 mU/. Mu.l, 0.9375 mU/. Mu.l, 0 mU/. Mu.l, 50. Mu.l each were taken with M13Mix (M13 single-stranded template 50ng, single-stranded oligonucleotide 0.1. Mu.M, dNTP 0.2mM,Tris HCl 10mM,KCl 50mM,MgCl) 2 1.5 mM, pH 8.0). PCR was performed at 72℃for 30min. And (3) adding a certain amount of PicoGreen into the reaction product, reading the fluorescence value by an enzyme-labeled instrument, and drawing an enzyme activity standard curve according to the fluorescence value of each concentration.
2. And (3) measuring the enzyme activity of a sample to be measured: gradient dilution of Taq enzyme to be tested to 6 mU/. Mu.l and 3 mU/. Mu.l, eachMu.l of the mixture was taken with M13Mix (M13 single-stranded template 50ng, single-stranded oligonucleotide 0.1. Mu.M, dNTP 0.2mM,Tris HCl 10mM,KCl 50mM,MgCl) 2 1.5 mM, pH 8.0), and PCR was performed at 72℃for 30min. And adding a certain amount of Picogreen into the reaction product, reading a fluorescence value by an enzyme label instrument, substituting the measured fluorescence value into a standard Taq enzyme fluorescence curve to convert the enzyme activity of the to-be-detected product, and taking the average value of the two as a final enzyme activity result, wherein the final enzyme activity result is shown in Table 3.
TABLE 3 Effect of trehalose on residues of Taq enzymatic Activity on ethanol residues of different concentrations
Figure BDA0004150379040000091
Figure BDA0004150379040000101
As shown in table 3, there was no significant difference in Taq enzyme activity between the control and experimental groups in the absence of ethanol; when ethanol with different concentrations exists in the template, the Taq enzyme activity gradually decreases with the increase of the ethanol concentration after 42 cycles are completed. When the ethanol content in the template is 10% (the amplification system contains 5% ethanol) and the reaction system is free of protective agent (trehalose), the residual percentage of the activity of Taq enzyme is below 5%. When the trehalose serving as a protective agent is added into the reaction system, after 42 cycles are completed, compared with the case that the trehalose is not added, the residual percentage of the enzyme activity is obviously improved, and along with the improvement of the concentration of the trehalose, the enzyme activity of Taq is kept higher and higher, wherein the protection effect of the trehalose of 0.6M is optimal.

Claims (14)

1. A method of amplifying a nucleic acid sample comprising ethanol, the method comprising: (1) providing a nucleic acid sample comprising ethanol; (2) Preparing a qPCR amplification system containing buffer substances, dNTPs, metal salts, DNA polymerase, trehalose, primers, probes and/or fluorescent dyes by taking the nucleic acid sample in the step (1) as a template; (3) performing a qPCR amplification reaction under suitable conditions.
2. The method according to claim 1, wherein the ethanol content (volume fraction) in the qPCR amplification system is 0.1-10%, preferably 0.1-8%, more preferably 0.1-7%.
3. The method according to claim 1, wherein the concentration of trehalose in the qPCR amplification system is 0.01-5mol/L, preferably 0.01-2mol/L, more preferably 0.01-1mol/L.
4. The method according to claim 1, wherein the buffer substance comprises Tris-HCl, preferably 5-50mmol/L Tris-HCl;
the metal salt comprises Mg 2+ Salts and K + Salts, preferably MgCl 2 And KCl, more preferably MgCl of 2-10mmol/L 2 And 30-80mmol/L KCl;
the DNA polymerase is a thermostable DNA polymerase, preferably TaqDNA polymerase, more preferably 1-5U/. Mu.LTaqDNA polymerase;
the primer comprises at least one pair of an upstream primer and a downstream primer, and preferably the concentration of the upstream primer and the downstream primer in the qPCR amplification system is 0.2-0.5 mu mol/L;
the concentration of dNTPs in a qPCR amplification system is 0.1-1mmol/L;
the probe is a TaqMan probe, preferably a TaqMan probe of 0.1-0.5 mu mol/L;
the fluorescent dye is SYBRGreen or EvaGreenTM, preferably SYBRGreen.
5. The method according to claim 1, wherein the nucleic acid sample is DNA, preferably 0.01-1 ng/. Mu.LDNA.
6. The method of claim 5, wherein the qPCR amplification reaction comprises a pre-denaturation comprising 25s-40s at 92-96 ℃ and a cycling reaction comprising 8-12s at 95 ℃, annealing and extension at 55-65 ℃ for a total of 40-50 cycles.
7. The method according to claim 1, wherein the nucleic acid sample is RNA, preferably 0.01-1 ng/. Mu.LRNA.
8. The method of claim 7, wherein the qPCR amplification system further comprises a reverse transcriptase, preferably MMLV reverse transcriptase, more preferably 1-10U/μl MMLV reverse transcriptase.
9. The method of claim 8, wherein the qPCR amplification reaction is reverse transcription qPCR, the reverse transcription qPCR comprising reverse transcription, pre-denaturation comprising 52-58 ℃ reverse transcription for 12-18min, pre-denaturation comprising 92-96 ℃ pre-denaturation for 25s-40s, and cycling reaction comprising 95 ℃ denaturation for 8-12s, annealing at 55-65 ℃ and extension for 10-30s for a total of 40-50 cycles.
10. Use of trehalose to increase the activity of Taq enzyme retention after PCR amplification of ethanol-containing nucleic acid samples.
11. Use of trehalose to increase the efficiency of PCR amplification of ethanol-containing nucleic acid samples.
12. Use according to any one of claims 10-11, wherein the ethanol content (volume fraction) in the PCR amplification system is 0.1-10%, preferably 0.1-8%, more preferably 0.1-7%; the concentration of trehalose in the PCR amplification system is 0.01 to 5mol/L, preferably 0.01 to 2mol/L, more preferably 0.01 to 1mol/L.
13. A PCR amplification reaction solution, the reaction solution comprising: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, 0.1-0.5. Mu. Mol/L of probe and optionally 1-10U/. Mu.L of reverse transcriptase;
preferably, the reaction liquid includes: 0.5-8% (volume fraction) ethanol, 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2mol/L trehalose, 20-30mmol/L Tris-HCl,0.1-0.5mmol/L dNTPs,2-5mmol/L MgCl 2 ，40-60mmol/L KCl, 1-3U/. Mu.l taq dna polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, 0.1-0.4. Mu. Mol/L probe and optionally 3-6U/. Mu.l MMLV reverse transcriptase;
preferably, the reaction liquid includes: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 50mmol/L KCl, 2U/. Mu.L TaqDNA polymerase, 0.2. Mu. Mol/L upstream and downstream primers, 0.2. Mu. Mol/L probe and optionally 4U/. Mu.L MMLV reverse transcriptase.
14. A PCR amplification reaction solution, the reaction solution comprising: 0.1-10% (volume fraction) ethanol, 0.01-1 ng/. Mu.L nucleic acid sample, 0.01-5mol/L trehalose, 5-50mmol/L Tris-HCl,0.1-1mmol/L dNTPs,2-10mmol/L Mg 2+ Salts, K at 30-80mmol/L + Salts, 1-5U/. Mu.L of DNA polymerase, 0.2-0.5. Mu. Mol/L of upstream and downstream primers, fluorescent dye and optionally 1-10U/. Mu.L of reverse transcriptase;
preferably, the reaction liquid includes: 0.5-8% (volume fraction) ethanol, 0.01-0.5 ng/. Mu.L nucleic acid sample, 0.05-2mol/L trehalose, 20-30mmol/L Tris-HCl,0.1-0.5mmol/L dNTPs,2-5mmol/L MgCl 2 40-60mmol/L KCl, 1-3U/. Mu.L Taq DNA polymerase, 0.2-0.4. Mu. Mol/L upstream and downstream primers, SYBRGREEN fluorescent dye and optionally 3-6U/. Mu.L MMLV reverse transcriptase;
preferably, the reaction liquid includes: 1-5% (volume fraction) ethanol, 0.1 ng/. Mu.L nucleic acid sample, 0.1-1mol/L trehalose, 20mmol/L Tris-HCl,0.2mmol/L dNTPs,3mmol/L MgCl 2 50mmol/L KCl, 2U/. Mu.L TaqDNA polymerase, 0.2. Mu. Mol/L upstream and downstream primer, SYBRGREEN fluorescent dye and optionally 4U/. Mu.L MMLV reverse transcriptase.
CN202310316926.0A 2022-12-20 2023-03-29 Method for amplifying nucleic acid sample containing ethanol Active CN116121349B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022116390543 2022-12-20
CN202211639054 2022-12-20

Publications (2)

Publication Number Publication Date
CN116121349A true CN116121349A (en) 2023-05-16
CN116121349B CN116121349B (en) 2024-04-09

Family

ID=86312056

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310316926.0A Active CN116121349B (en) 2022-12-20 2023-03-29 Method for amplifying nucleic acid sample containing ethanol

Country Status (1)

Country Link
CN (1) CN116121349B (en)

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5620869A (en) * 1995-09-28 1997-04-15 Becton, Dickinson And Company Methods for reducing inhibition of nucleic acid amplification reactions
US5834254A (en) * 1995-02-10 1998-11-10 Gen-Probe Incorporated Stabilized enzyme compositions for nucleic acid amplification
KR20020091463A (en) * 2001-05-30 2002-12-06 주식회사 바이오그랜드 Enzyme reaction pre-mixture with improved stability
JP2006262777A (en) * 2005-03-24 2006-10-05 Japan Science & Technology Agency Method for synthesizing nucleic acid using samples containing contaminant, and additive
US20090155777A1 (en) * 2005-02-28 2009-06-18 Bioquest, Inc. Methods for performing direct enzymatic reactions involving nucleic acid molecules
JP2010200660A (en) * 2009-03-03 2010-09-16 Toyobo Co Ltd Improved amplification reagent
US20120171728A1 (en) * 2009-06-22 2012-07-05 Qiagen Gmbh Process for amplifying dna using tetratethylene glycol, kit of parts therefor and use thereof
CN103131694A (en) * 2011-11-25 2013-06-05 上海绿宇生物科技有限公司 Trace and complex DNA amplification method
US20140045221A1 (en) * 2011-04-20 2014-02-13 Mesa Tech International, Inc. Oscillating Amplification Reaction for Nucleic Acids
CN106591287A (en) * 2016-12-13 2017-04-26 湖南圣湘生物科技有限公司 Polymerase chain reaction enhancing method
CN110218778A (en) * 2019-06-21 2019-09-10 珠海宝锐生物科技有限公司 PCR reaction system, reagent, kit and PCR method
CN111808847A (en) * 2020-08-12 2020-10-23 济南国益生物科技有限公司 Release agent for rapidly extracting nucleic acid by one-step method and preparation and use methods thereof
CN111826427A (en) * 2020-07-24 2020-10-27 珠海丽珠试剂股份有限公司 Freeze-drying protective agent of reagent for PCR amplification, product, preparation method and application thereof
CN112695076A (en) * 2021-02-05 2021-04-23 青岛农业大学 Nucleic acid constant-temperature amplification quantitative detection method
CN113981139A (en) * 2021-09-27 2022-01-28 厦门健康工程与创新研究院 Nucleic acid isothermal amplification detection reagent, kit, detection system and method
WO2022024935A1 (en) * 2020-07-29 2022-02-03 東洋紡株式会社 Method for suppressing non-specific nucleic acid amplification

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834254A (en) * 1995-02-10 1998-11-10 Gen-Probe Incorporated Stabilized enzyme compositions for nucleic acid amplification
US5620869A (en) * 1995-09-28 1997-04-15 Becton, Dickinson And Company Methods for reducing inhibition of nucleic acid amplification reactions
KR20020091463A (en) * 2001-05-30 2002-12-06 주식회사 바이오그랜드 Enzyme reaction pre-mixture with improved stability
US20090155777A1 (en) * 2005-02-28 2009-06-18 Bioquest, Inc. Methods for performing direct enzymatic reactions involving nucleic acid molecules
JP2006262777A (en) * 2005-03-24 2006-10-05 Japan Science & Technology Agency Method for synthesizing nucleic acid using samples containing contaminant, and additive
JP2010200660A (en) * 2009-03-03 2010-09-16 Toyobo Co Ltd Improved amplification reagent
US20120171728A1 (en) * 2009-06-22 2012-07-05 Qiagen Gmbh Process for amplifying dna using tetratethylene glycol, kit of parts therefor and use thereof
US20140045221A1 (en) * 2011-04-20 2014-02-13 Mesa Tech International, Inc. Oscillating Amplification Reaction for Nucleic Acids
CN103131694A (en) * 2011-11-25 2013-06-05 上海绿宇生物科技有限公司 Trace and complex DNA amplification method
CN106591287A (en) * 2016-12-13 2017-04-26 湖南圣湘生物科技有限公司 Polymerase chain reaction enhancing method
CN110218778A (en) * 2019-06-21 2019-09-10 珠海宝锐生物科技有限公司 PCR reaction system, reagent, kit and PCR method
CN111826427A (en) * 2020-07-24 2020-10-27 珠海丽珠试剂股份有限公司 Freeze-drying protective agent of reagent for PCR amplification, product, preparation method and application thereof
WO2022024935A1 (en) * 2020-07-29 2022-02-03 東洋紡株式会社 Method for suppressing non-specific nucleic acid amplification
CN111808847A (en) * 2020-08-12 2020-10-23 济南国益生物科技有限公司 Release agent for rapidly extracting nucleic acid by one-step method and preparation and use methods thereof
CN112695076A (en) * 2021-02-05 2021-04-23 青岛农业大学 Nucleic acid constant-temperature amplification quantitative detection method
CN113981139A (en) * 2021-09-27 2022-01-28 厦门健康工程与创新研究院 Nucleic acid isothermal amplification detection reagent, kit, detection system and method

Also Published As

Publication number Publication date
CN116121349B (en) 2024-04-09

Similar Documents

Publication Publication Date Title
JP5770085B2 (en) Method for direct amplification from crude nucleic acid samples
EP3150723B1 (en) Compositions, kits, and methods for synthesis and/or detection of nucleic acids
EP2280079A1 (en) Ligation-based method of normalized quantification of nucleic acids
CN109477150B (en) Compositions, methods and kits for detecting microorganisms
RU2757416C2 (en) Compositions, methods and sets for synthesizing and detecting nucleic acids
EP3083961B1 (en) An improved oligonucleotide inhibitor of dna polymerases
CN110358865A (en) For detecting kit and its application of Respirovirus
CN111334608A (en) Dual-fluorescence freeze-drying microchip, kit and method for detecting novel coronavirus 2019-nCoV
CN111926114A (en) Multiplex-time PCR (polymerase chain reaction) kit for detecting parainfluenza virus, method and application
CN109182493B (en) Primer and kit for detecting human 16p11.2 microdeletion syndrome and detection method thereof
KR102055447B1 (en) Method for Detecting Fungi Contaminated in Therapeutic Cells or Biological Medicine By Using Polymerase Chain Reaction and Real-time Polymerase Chain Reaction and Kit for the Same Method
CN116121349B (en) Method for amplifying nucleic acid sample containing ethanol
CN113186257A (en) Constant-temperature hybridization method after PCR amplification based on liquid chip technology
CN117535386A (en) Fluorescence quenching PCR method for detecting gene polymorphism and application thereof
CN110885902B (en) Freeze-drying microchip, kit and method for detecting porcine reproductive and respiratory syndrome virus and identifying highly pathogenic classical variant strain of porcine reproductive and respiratory syndrome virus
US20050123924A1 (en) Compositions for in vitro amplification of nucleic acids
CN111286320A (en) Fluorescent dye for nine-color fluorescent STR typing, specific amplification primer pair and typing method
Hamidah et al. Prenatal diagnosis of aneuploidies in amniotic fluid by multiple ligation-dependent probe amplification (MLPA) analysis.
CN112430664A (en) Primer group, kit and method for detecting PML-RAR alpha fusion gene
CN105441556A (en) Judgment method of DNA (deoxyribonucleic acid) methylation conversion efficiency as well as kit adopting judgment method and application of judgment method
CN116287478B (en) Primer probe composition and kit for detecting multiple respiratory pathogens
US20230227893A1 (en) Method for detecting genetic events
WO2024046097A1 (en) Method for measuring terminal transferase activity and kit
OKULMUS et al. PCR AND ITS ROLE IN BİOCHEMİSTRY
CN118531132A (en) Composite amplification kit containing species specific sites and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant