CN116121279A - Hemagglutinin and screening method and application thereof - Google Patents

Abstract

The application relates to a hemagglutinase, a screening method and application thereof, wherein the hemagglutinase has an amino acid sequence, the amino acid sequence is obtained by mutating the amino acid sequence of the hemagglutinase I shown in SEQ ID NO.1, and the mutation site of the amino acid sequence of the hemagglutinase comprises: mutation at position 9 to Thr and mutation at position 216 to Cys. The hemagglutinase has higher enzyme activity, in the amino acid sequence of the hemagglutinase, the mature protein of the encoded single-chain glycoprotein contains 236 amino acids, the molecular weight of the single-chain glycoprotein is 28 kDa-38 kDa, and the mature protein contains 13 cysteines, and six pairs of disulfide bonds are formed, so that the gene sequence of the encoded amino acids can treat the folding of the protein, realize the expression of the hemagglutinase gene in mammalian cells, has higher enzyme activity, and can be further used in hemostatic and coagulants.

Description

Hemagglutinin and screening method and application thereof

The present application claims priority from China patent office, application No. 2021111731706, entitled "hemagglutination enzyme Gene and screening methods and applications thereof," filed on App. 10 and 08 of 2021, the entire contents of which are incorporated herein by reference.

Technical Field

The application relates to the technical field of biomedicine, in particular to a hemagglutinase, a screening method and application thereof.

Background

The hemagglutinin of snake venom is a protein with serine protease activity, and most proteins also have esterase activity. The functions of the device are converted under different conditions. The sequence of the gene cloned at present is more than ten times, and nevertheless, the amino acid encoding the mature peptide can also be different due to the naturally occurring sequence diversity, so that an isozyme effect is formed. The preparation of such enzymes mainly results from biological extraction to form biochemical drugs, prokaryotic expression represented by E.coli is often insoluble inclusion bodies due to difficult handling of protein folding, especially correct formation of 6 pairs of disulfide bonds, specific activity is limited after renaturation, and activity and stability are changed compared with natural proteins due to no glycosylation. The mammalian expression system has stronger post-translational processing and protein folding capability, the glycosylation mode is more natural, and the characteristics of the secretion of the product to the culture medium are easier to realize affinity purification. From the information of available resources, recombinant expression is expected to obtain functional proteins, and the functional proteins are not used for clinical application due to the limitations of expression product forms, yield and glycosylation types.

Disclosure of Invention

In view of the above, the application provides the thrombin and the screening method and application thereof, and the thrombin with high activity is obtained by expressing in mammalian cells, so that the application of the thrombin in the thrombin medicine is widened.

In a first aspect, an embodiment of the present application provides a hemagglutinase, where the hemagglutinase has an amino acid sequence, the amino acid sequence is obtained by mutation of an amino acid sequence of the hemagglutinase i as shown in SEQ ID No.1, and a mutation site of the amino acid sequence of the hemagglutinase includes: mutation at position 9 to Thr and mutation at position 216 to Cys.

In combination with the first aspect, the amino acid sequence of the hemagglutinin is shown in SEQ ID NO. 3.

In a second aspect, an embodiment of the present application provides another hemagglutinase, where an amino acid sequence of the hemagglutinase is obtained by mutating a hemagglutinase i with an amino acid sequence shown in SEQ ID No.1, and a mutation site of the hemagglutinase includes: mutation at position 5 to Asp, mutation at position 191 to His, and mutation at position 233 to Thr.

In combination with the second aspect, the amino acid sequence of the hemagglutinin is shown in SEQ ID NO. 5.

In a third aspect, embodiments provide a hemagglutinase gene for encoding a hemagglutinase according to the first or second aspect.

In a fourth aspect, embodiments of the present application provide an expression vector comprising the hemagglutinin gene of the third aspect, which is capable of expression in CHO cells and is active.

In a fifth aspect, embodiments of the present application provide a host cell comprising the expression vector of the fourth aspect, wherein the host cell is a CHO cell.

In a sixth aspect, embodiments of the present application provide a method for screening for a hemagglutinin enzyme, comprising the steps of:

(1) Extracting total RNA of snake venom glands;

(2) Reverse transcription of total snake venom gland RNA:

(3) Amplifying a snake venom gland gene by PCR;

(4) Degenerate primers are carried out on the snake venom gland gene sequence obtained by amplification and the hemagglutinase gene I, the hemagglutinase gene is obtained by adopting an overlap extension PCR technology, and the constructed hemagglutinase gene is cloned to construct a hemagglutinase combined gene library;

the amino acid sequence of the hemagglutinin I is shown as SEQ ID NO.1, and the DNA sequence of the hemagglutinin I is shown as SEQ ID NO. 2;

(5) The method comprises the steps of designing a target gene in a hemagglutinin combined gene library by adopting an overlap extension PCR technology, amplifying and constructing a recombinant expression vector plasmid by PCR, carrying out expression in CHO cells transfected by the recombinant expression vector plasmid, and screening out a coding sequence with the specific activity of an expression product of 2000U/mg-3000U/mg, wherein the expression product comprises a mutation site in the first aspect and/or a mutation site in the second aspect.

In combination with the fourth aspect, the PCR amplification of the snake venom gland gene comprises:

the reverse transcription product is used as a template for amplifying the snake venom gland gene, and the primers are as follows:

the upstream primer KCS-F is 5'-ATGGTGCTGATCAGAGTGMTAG-3';

the downstream primer KCS-R is 5'GTAGTTGGATATGGTTAGGGA-3';

the PCR amplification system was as follows:

reverse transcription product, 1 μl;2.5mM dNTPs, 4. Mu.l; pfu DNA polymerase Buffer (10×), 5 μl;2. Mu.l of the upstream primer; 2. Mu.l of downstream primer; pfu DNA polymerase, 0.2. Mu.l; ddH ₂ O, make up to a total volume of 50. Mu.l;

the PCR amplification conditions were as follows:

after 5min of pre-denaturation at 95℃30 cycles of denaturation at 94℃45s, annealing at 60℃45s and extension at 72℃90s were performed and finally incubated at 72℃for 10min.

In a seventh aspect, embodiments of the present application provide the use of the thrombin gene according to the first aspect or the thrombin gene according to the second aspect or the thrombin gene according to the third aspect in a clotting medicament.

The technical scheme of the application has the following beneficial effects:

the amino acid sequences of the hemagglutinin prepared by the method are shown as SEQ ID NO.3 and SEQ ID NO.5, mature protein of the encoded single-chain glycoprotein contains 236 amino acids, the molecular weight of the single-chain glycoprotein is 28 kDa-38 kDa, and 13 cysteines are contained to form six pairs of disulfide bonds, so that the gene sequence of the encoded amino acid can treat protein folding, realize the expression of the hemagglutinin gene in mammalian cells, have higher enzyme activity and can be further used in hemostatic and coagulants.

According to the screening method of the hemagglutinase, a bioengineering means is utilized, a target gene is optimized by establishing a hemagglutinase combined gene library, and the hemagglutinase gene with high enzyme activity is screened out by expression in CHO cells.

Drawings

For a clearer description of embodiments of the present application or of the prior art, the drawings that are used in the description of the embodiments or of the prior art will be briefly described, it being apparent that the drawings in the description that follow are only some embodiments of the present application, and that other drawings may be obtained from these drawings by a person of ordinary skill in the art without inventive effort.

FIG. 1 is an electrophoresis detection diagram of total RNA of snake venom glands according to the application;

FIG. 2 is a diagram showing the electrophoresis detection of PCR amplified hemagglutinase gene products according to the present application;

FIG. 3 shows the result of PCR amplification of fragment A in the overlap extension PCR technique of the present application;

FIG. 4 shows the result of PCR amplification of the B fragment in the overlap extension PCR technique of the present application;

FIG. 5 shows the result of PCR amplification of the C fragment in the overlap extension PCR technique of the present application;

FIG. 6 shows the result of PCR amplification of the D fragment in the overlap extension PCR technique of the present application;

FIG. 7 is an electrophoretogram of transient transfection of recombinant plasmids in the gene combinatorial libraries of the present application;

FIG. 8 is a diagram of immunoblotting detection of polyclonal antibodies prepared in the present application;

FIG. 9 is a purity measurement of KCL-4 hemagglutinase of the present application with a blank;

FIG. 10 shows purity measurements of KCL-8 hemagglutinin and a blank;

FIG. 11 is an electrophoretically detected pattern of KCL-4 and KCL-8 coagulase of the present application;

FIG. 12 is a graph showing the comparison of prothrombin time measurements of KCL-4 and KCL-8 coagulase of the present application with that of a naturally isolated and purified coagulase.

Detailed Description

For a better understanding of the technical solutions of the present application, embodiments of the present application are described in detail below with reference to the accompanying drawings.

It should be understood that the described embodiments are merely some, but not all, of the embodiments of the present application. All other embodiments, based on the embodiments herein, which would be apparent to one of ordinary skill in the art without making any inventive effort, are intended to be within the scope of the present application.

The terminology used in the embodiments of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in this application and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

It should be understood that the term "and/or" as used herein is merely one relationship describing the association of the associated objects, meaning that there may be three relationships, e.g., a and/or B, may represent: a exists alone, A and B exist together, and B exists alone. In addition, the character "/" herein generally indicates that the front and rear associated objects are an "or" relationship.

Furthermore, the terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature.

EXAMPLE 1 extraction and sequencing of snake venom hemagglutinin

1. The extraction method for extracting total RNA of snake venom glands comprises the following steps:

(1) About 100mg of snake venom gland tissue was taken, ground to powder by adding liquid nitrogen, added with 0.5mL of total RNA extraction buffer (TRIzol solution, product of Invitrogen Co., U.S.A.), and shaken until thoroughly mixed.

(2) After 5min at room temperature, the supernatant was centrifuged at 12000rpm at 4℃for 2min, and the resulting supernatant was transferred to a new RNase-free centrifuge tube.

(3) 0.1mL of 5M NaCl (DEPC (diethyl pyrocarbonate) treated water) was added to the centrifuge tube, and the mixture was mixed at room temperature.

(4) Then, 0.3mL of chloroform was added to the centrifuge tube, and the mixture was inverted and homogenized.

(5) Centrifuging at 12000rpm at 4deg.C for 10min, and transferring the upper aqueous phase into a new RNase-free centrifuge tube.

(6) Adding isopropanol with the same volume as the water phase into a centrifuge tube, uniformly mixing, and standing at-20 ℃ for 10min.

(7) Centrifuge at 12000rpm for 10min at 4℃and discard supernatant and add 1mL of 75% ethanol.

(8) Centrifuging at 4 ℃ and 12000rpm for 3min, pouring out the supernatant, centrifuging the residual liquid in the centrifuge tube, sucking out sediment at the bottom of the tube by using a gun head, standing at room temperature for 2-3 min, and airing to obtain total RNA of snake venom glands.

(9) Adding 50 μl of DEPC water into the obtained total RNA of snake venom gland, repeatedly blowing and mixing, dissolving RNA sufficiently, measuring concentration, detecting by small amount of electrophoresis, and preserving the rest at-80deg.C for use.

(10) Taking 1 mu gRNA according to the measured concentration to carry out 2% agarose electrophoresis, wherein the electrophoresis system is as follows: 2% agarose, 1 xTAE, 4V/cm,45min. As shown in FIG. 1, the electrophoresis pattern is shown in FIG. 1, S1 is a snake venom RNA sample 1, S2 is a snake venom RNA sample 2, and the molecular weight Marker is a molecular weight Marker Dl2000 (TaKaRa Co.) as shown in FIG. 1: the snake venom gland RNA is successfully extracted.

2. Reverse transcription of total RNA from snake venom glands

Thawing the extracted RNA as template on ice, performing reverse transcription to synthesize cDNA after thawing, and adding buffer solution and other reagents (Beijing Hua macroprotein)Mass research and development center Co., ltd.) includes 5X Buffer, DTT, dNTP, RNase-Free ddH ₂ O was thawed at room temperature and placed on ice immediately after thawing, each solution was vortexed and mixed well before use and centrifuged briefly to collect the liquid remaining on the tube wall.

Mu.l of 2.5. Mu.g/. Mu.l oligo (dT) 18, 1. Mu.l total RNA extracted from snake venom (about 5. Mu.g) were added to an RNase-Free centrifuge tube, mixed, incubated at 68℃for 5min, immediately placed on ice for 5min, followed by 1. Mu.l RNase OUT (Invitrogen), 4. Mu.l of 0.1M Dithiothreitol (DTT), 8. Mu.l 5 XRT buffer, 3. Mu.l of 5mM dNTP, 19. Mu.l RNase-Free ddH were added sequentially ₂ O, mixing, water-bathing at 42 deg.C for 2min, adding 2 μl of Power-MMLR reverse transcriptase (Beijing Hua big protein research and development center Co., ltd.), mixing, water-bathing at 42 deg.C for 1h, then preserving at 70 deg.C for 15min, and preserving the obtained reverse transcription product at-80 deg.C.

3. PCR amplification of snake venom gland Gene

The cDNA of the reverse transcription product is used as a template for amplifying the snake venom gland gene sequence, the conserved sequence of the template is selected as an upstream primer and a downstream primer for PCR amplification, and two groups of samples are arranged corresponding to the two groups of samples in the PCR amplification reaction. Preferably, the addition of degenerate bases increases the efficiency of PCR amplification.

The upstream primer KCS-F is 5'-ATGGTGCTGATCAGAGTGMTAG-3';

the downstream primer KCS-R is 5'GTAGTTGGATATGGTTAGGGA-3'.

The PCR amplification system was as follows in Table 1.1:

TABLE 1.1 PCR amplification System

Reverse transcription product	1μl
		2.5mM dNTPs	3μl
pfu DNA polymerase Buffer(10×)	5μl
		Upstream primer	2μl
Downstream primer	2μl
		pfu DNA polymerase	0.2μl
ddH 2 O	Make up the total volume to 50. Mu.l

1U (0.2. Mu.l) pfu DNA polymerase was supplied by Beijing Hua Large protein research and development center Co.

The PCR amplification conditions were as follows:

after 5min of pre-denaturation at 95 ℃,30 cycles of denaturation at 94 ℃,45 s of annealing at 60 ℃ and 90s of extension at 72 ℃ are performed, and finally the temperature is kept at 72 ℃ for 10min;

after the reaction, the PCR product was detected by 1% agarose gel electrophoresis, the electrophoresis detection chart is shown in FIG. 2, D1 is the snake venom gene amplification product 1, D2 is the snake venom gene amplification product 2, and marker is a molecular weight marker Dl2000 (TaKaRa Co.) as shown in FIG. 2: the length of the amplified gene fragment is about 750bps, which is consistent with the expected sequence.

4. Sequencing and analysis

The specific band with the molecular weight of 700bps is cut off after electrophoresis of the PCR amplification product, the specific band is recovered by a gel purification DNA recovery kit and then is connected with a pMD19T vector to obtain an expression vector, DH5 alpha cells are transformed by the connected expression vector, a single clone is selected for culture, a recombinant expression plasmid is constructed, the recovery kit and the pMD19T vector are both products of Beijing Tiangen biotechnology Co, and the gene sequence result of the recombinant expression plasmid is as follows:

typical sequence 1:

ATGGTGCTGATCAGAGTGCTAGCAAATCTTCTGATACTACAGCTTTCTTACGCTCAAAAGTCTTCTGAACTGGTCATTGGAGGTGTTGAATGTGACATAAATGAACATCGTTTCCTTGTAGCCTTGTATGAGTTAACATCTATGACTTTTCTCTGCGGTGGGACTTTGATCAACCAGGAATGGGTGGTCACTGCTGCACACTGCGACAGGTTACAGCTCTACCTATACATTGGTATGCATGACAAATATGTAAAATTTGATGATGAGCAAGGAAGAGAGCCAATTGAGAAGTACTTTTATAACTGTAGCAACAACCTTACCACACGGGACAAGGACATCATGTTGATCAGGCTGGACAGACCTGTTGACAATAGTACACACATCGCGCCTCTCAGCTTGCCTTCCAGGCCACCCAGTGTGGGCTCAGTTTGCCGTGTTATGGGATGGGGCGCAATCTCACCTTCTCGTGACGTTTTGCCTGATGTCCCTCATTGTGTTAACATTAACCTAGTAAATAATGCGGAGTGTCGAAGAGCTTACCCAAGGTTGCCGGCGACAAGCAGAACATTGTGTGCAGGTGTCATGCAAGGAGGCATAGATTCATGTAACCGTGACTCTGGGGGACCTCTCATATGTGATGGACAATTCCAGGGCGTTGTAAATTGGGGAGGCAATCCTTGTGCCCGACCGAATATGCCTGCCCTCTACACCAAGGTCTACGATTATAATGATTGGATCCAGAGCATTACTGCAGGAAATACAACTGCGACTTGCCCGTGA

typical sequence 2:

ATGGTGCTGATCAGAGTGCTAGCAAACCTTCTGATACTACAGCTTTCTTACGCACAAAAGTCTTCTGAACTGGTCATTGGAGGTGATGAATGTGACATAAATGAACATCGTTTCCTTGCAGCCTTGTATACGTCTGAGCCTTGGACTTTTCACTGCGCTGGGACTTTGATCCACAGACAATGGGTGCTCGGTGCTGCACACTGCTACAAGAGAGGCCTGAACATATACCTTGGTATGCATAACCAAAGCATACAATTTGACGATGAGCAAAGAAGATACGCAATTGAGGAGCACTATTATCGCTGTGACGAAAAACTTACCAAATGGGAGAACGACGTCGTGTTGCTCAAGCTGGACAAACCTGTTAGGAGAAGTACACACATCGCACCTCTCAGCTTGCCTTCCAGCCCTCCCAGTATCGGCTCAGTTTGCCGTGTTATGGGATGGGGCATAATGTCATCTACTAAAGACATTTTGCCCGATGTCCCTCATTGTGCTAACATTAACCTGTTAAATTATACGGAATGTGTAGCACATTACCCAGATGTACTGGAGACAACAAGACTATTGTGTGCAGGTGTCCTGGAAGGAGGCATAGATACATGTAACCAAGACTCTGGGGGACCTCTCATATGTGATGGACAATTCCAGGGCATTGTATCTTGGGGACGCTATCCTTGTGCCCAACCGAATATTCCTGCCCTCTACAGCAAGATCTTCATTTATATTGACTGGATCCAGAACATTATTGCAGGAAATACAACTCCGACTTGCCCCACATGAAAATTTTTGAAAAAGTTAGGAGGAGAAAATGTAACATGTTAGTACATCTCTTCTATATCCCTAACCATATCCAACTAC

typical sequence 3:

ATGGTGCTGATCAGAGTGCTAGCAAACCTTCTGATACTACAGCTTTCTTACGCACAAAAGTCTTCTGAACTGGTCATTGGAGGTAATGAATGTGACATAAATGAACATCGTTTCCTTGTAGCCTTCTTTAACACTACTGGATTTTTCTGTGGTGGGACTTTGATCAACCCGGAATGGGTGGTCACTGCTGCACACTGCGACAGTACAAATTTCCAGATGCAGCTTGGTGTGCATAGCAAAAAGGTACTAAATGAGGATGAGCAGACAAGAAACCCAAAGGAGAAGTTCATTTGTCCCAATAAGAACAACAATGAAGTACTGGACAAGGACATCATGTTGATCAAGCTGGACAAACCTATTAGCAACAGTAAACACATCGCGCCTCTCAGCTTGCCTTCCAGCCCTCCCAGTGTGGGCTCAGTTTGCCGTATTATGGGATGGGGATCAATCACACCTGTTAAAGAGACTTTTCCCGATGTCCCTTATTGTGCTAACATTAACCTACTTGATCATGCAGTGTGTCAAGCAGGTTATCCAGAGTTGCTGGCGGAATACAGAACATTGTGTGCAGGTATCGTGCAAGGAGGCAAAGATACATGTGGGGGTGACTCTGGGGGACCCCTCATCTGTAATGGACAATCCCAGGGCATTGTATCTTATGGGGCGCATCCTTGTGGCCAAGGTCCTAAGCCTGGTATCTACACCAATGTCTTCGATTATACTGACTGGATCCAGAGAAATATTGCAGGAAATACAACTGCGACATGCCCGTGA

the mass spectrum analysis of the amino acids coded by the three groups of genes obtained by cloning and the amino acid sequence of the hemagglutinin I shows that: the amino acids of the 3 groups of genes cloned in the application have several amino acid diversity compared with the amino acid sequence of the hemagglutinase I, and can be presumed that in the hemagglutinase of natural snake venom, the amino acid sequences corresponding to the sites also have corresponding diversity, and although the amino acids of the individual sites are different, functional protein products can be encoded, and the physicochemical property differences of the different amino acid sequence products can exist.

The amino acid sequence of the hemagglutinase I is shown as SEQ ID NO.1, see a www.uniprot.org database, wherein the ID in the database is Q9I8X2, the linkage is https:// www.uniprot.org/uniprot/Q9I8X2, the corresponding gene mRNA sequence in the GenBank database is AF159057, the linkage is https:// www.ebi.ac.uk/ena/browser/view/AF159057, and the linkage is Wang YM, wang SR, tsai IH.Serine protease isoforms of Deinagkistrodon acutus venom: cloning, sequencing, and physiogenic analysis J.2001 Feb 15;354 (Pt 1) 161-8.Doi:10.1042/0264-6021:3540161.PMID:11171091; PMCID PMC1221640 discloses that the nucleotide sequence of the hemagglutinin I is a protein sequence reported earlier in Agkistrodon acutus, and the sequence, glycosylation modification and enzyme activity of the hemagglutinin I are studied intensively.

Example 2 construction of a Combined Gene library of hemagglutinases

Degenerate primers are carried out on the snake venom gland gene sequence amplified by the method and the hemagglutinin I sequence (the nucleotide sequence of the hemagglutinin I is shown as SEQ ID NO. 2), the hemagglutinin gene is designed by adopting an overlap extension PCR technology (SOE-PCR), the constructed hemagglutinin gene is connected and transformed with a pMD19T vector, plasmids are extracted, and a hemagglutinin combined gene library with site diversity is constructed.

In some embodiments, the combinatorial gene library comprises 48 sets of gene sequences, each of the 48 sets of gene sequences comprising three active sites: the positions corresponding to the mature peptide are 43 His, 88 Asp and 182 Ser, the active sites are key sites of the hemagglutinin, and the mutation sites in the hemagglutinin gene combination library comprise: the mutation at position 5 is Asp, the mutation at position 5 is Val, the mutation at position 9 is Thr, the mutation at position 191 is Tyr, the mutation at position 205 is Gln, the mutation at position 216 is Cys, the mutation at position 223 is Gln and the mutation at position 233 is Thr.

As shown in Table 2.1 below, the positions of the designed mutation sites and the mutation designs in the combinatorial gene library of the present application are shown.

TABLE 2.1 design of mutation sites and diversity

Position of	Original amino acid	Mutant design
			29	N	N/V/D
33	T	T/I
			43	N	N/Y
229	Q	Q/R
			247	R	R/Q
257	A	A/T

Specifically, degenerate primers are carried out on the gene sequences of the snake venom gland and the gene sequences of the hemagglutinin I, the sequences are divided into A, B, C sections, overlapping PCR is carried out, and a PCR reaction system is as follows:

(1) The reaction system without propeptide D1 is shown in table 2.2: 3 reaction systems, 25. Mu.l each.

TABLE 2.2.D1 fragment amplification reaction System

Components (Reagents)	Master volume Vol. (μl)
		dNTPs(2.5mM stock)	6
10×Ex Taq Buffer	7.5
		1F-1&1R recovery of the product	2.8
2F&2R recovery of the product	3
		3F&Recovery of the product from 3R-2	2
Ex Taq Hot Start	0.5
		Add ddH 2 O	To 75

The reaction procedure is: pre-denaturation at 95 ℃,5min, amplification: 95 ℃,30s,50 ℃ 30s,72 ℃,50s,5 cycles, extension 72 ℃,10min, after the PCR is finished, 4F-1&4R is added to continue the PCR: pre-denaturation at 95 ℃,5min, amplification: 95 ℃,30s,55 ℃,30s,72 ℃,50s,5 cycles, extension 72 ℃ for 10min.

(2) The reaction system without propeptide D2 is shown in table 2.3: 3 reaction systems, 25. Mu.l each.

TABLE 2.3 pretreatment-free D2 fragment amplification reaction System

Components (Reagents)	Master volume Vol. (μl)
		dNTPs(2.5mM stock)	6
10×Ex Taq Buffer	7.5
		1F-1&1R recovery of the product	2.8
2F&2R recovery of the product	3
		3F&Recovery of the product from 3R-2	2.1
Ex Taq Hot Start	0.5
		Add ddH 2 O	To 75

The reaction procedure is: pre-denaturation at 95 ℃,5min, amplification: 95 ℃,30s,50 ℃ 30s,72 ℃,50s,5 cycles, extension 72 ℃,10min, after the PCR is finished, 4F-1&4R is added to continue the PCR: pre-denaturation at 95 ℃,5min, amplification: 95 ℃,30s,55 ℃,30s,72 ℃,50s,5 cycles, extension 72 ℃ for 10min.

The 4F-1&4R ligand system is shown in Table 2.4 below:

TABLE 2.4F-1 &4R ligand System

Components (Reagents)	Master volume Vol. (μl)
		dNTPs(2.5mM stock)	6
10×Ex Taq Buffer	7.5
		4F-2	5
4R	6
		Ex Taq Hot Start	3
Add ddH 2 O	To 75

(3) The reaction system containing the propeptide D3 is shown in Table 2.5: 3 reaction systems, 25. Mu.l each.

TABLE 2.5 reaction System containing propeptide

(4) The reaction system containing the propeptide D4 is shown in Table 2.6: 3 reaction systems, 25. Mu.l each.

TABLE 2.6 reaction System containing propeptide D4

Components (Reagents)	Master volume Vol. (μl)
		dNTPs(2.5mM stock)	6
10×Ex Taq Buffer	7.5
		1F-4&1R recovery of the product	2.8
2F&2R recovery of the product	3
		3F&Recovery of the product from 3R-2	2
Ex Taq Hot Start	0.5
		Add ddH 2 O	To 75

The reaction procedure is: pre-denaturation at 95 ℃,5min, amplification: 95 ℃,30s,50 ℃,30s,72 ℃,50s,5 cycles, extension at 72 ℃,10min, after the PCR is finished, 4F &4R is added to continue the PCR, the pre-denaturation is carried out at 95 ℃ for 5min, and the amplification is carried out: 95 ℃,30s,55 ℃,30s,72 ℃,50s,5 cycles, extension 72 ℃ for 10min.

And (3) carrying out 1% agarose gel electrophoresis on the product obtained by PCR amplification, and judging whether the PCR amplification product is consistent with the target product. Marker molecular weight Marker Dl2000 (TaKaRa). Wherein, the A fragment is divided into four sub-fragments A1-A4 according to whether the A fragment carries degenerate genes and whether the A fragment carries a propeptide sequence (propeptide is used for blocking the active center of protease, so that zymogen or protein precursor is not active), and the full-length genes obtained by amplifying by a PCR method are four types of genes D1, D2, D3 and D4, and the electrophoresis results of the four types of PCR amplified products are as follows:

the PCR amplification results of the A fragment are shown in FIG. 3, and it can be seen from FIG. 3: 1-3: a PCR product of A1 fragment without propeptide and double degeneracy; 4-6: a non-degenerate A2 fragment PCR product; 7-9: a PCR product containing a propeptide, a double degeneracy A3 fragment; 10-12: a PCR product containing a propeptide, a nondegenerate A4 fragment; m DNA Ladder2000 (TaKaRa), 1% agarose gel.

The PCR amplification results of the B fragment are shown in FIG. 4, and it can be seen from FIG. 4: 1-3: b fragment PCR products; m DNA Ladder2000 (TaKaRa), 1% agarose gel.

The result of PCR amplification of the C fragment is shown in FIG. 5, and it can be seen from FIG. 5 that: 1-2: c fragment PCR products; m DNA Ladder2000 (TaKaRa), 1% agarose gel.

The results of the PCR amplification of the D fragment are shown in FIG. 6, and as can be seen from FIG. 6: 1-2: full-length D1 fragment product without propeptide; 3-4: full-length D2 fragment product without propeptide; 5-6: full-length D3 fragment product containing the propeptide; 7-8: a full-length D41 fragment product containing the propeptide, M1% agarose gel M DNA Ladder2000 (TaKaRa), 1% agarose gel.

And (3) cutting off specific bands with the molecular weight of 700bps after electrophoresis of the PCR amplification products of the D1-D4, recovering the specific bands by using a gel purification DNA recovery kit, and then connecting the specific bands into a pMD19T carrier, wherein the recovery kit and the T carrier are products of Beijing Tiangen biotechnology limited company, and sequencing confirms that bases of mutation sites of each design are in accordance with the design.

The above constructed hemagglutinin combined gene library is a mixture of several genes, the upper and lower streams of each gene are respectively equipped with EcoRI and XhoI cleavage sites, the products of two groups of genes (containing propeptide and no propeptide) are recovered, then the products are recovered after double cleavage by EcoRI and XhoI, and the products are connected into vector pBPIL2His (Beijing Hua Dairy protein research and development center Co., ltd.) which is also undergone the linearization treatment by using T4DNA ligase, DH5 alpha competent cells are transformed, and the signal peptide with IL2 protein on the upper stream and 6 histidines at the tail end are constructedThe recombinant protein with acid tag, the signal peptide with IL2 protein is used for secretory expression, 6 histidine tags are used for purification, and the two types of prepared recombinant plasmids containing the propeptide and not containing the propeptide are named pBPIL2PKC and pBPIL2KC respectively. Two sets of recombinant plasmid DNA were used for transient transfection of cells ExpiCHO ^M (Thermo Fisher), the detection of transfected plasmids was performed by 1% agarose gel electrophoresis, as shown in FIG. 7, which is an electrophoretogram of transiently transfected plasmids, and the amount and concentration of transfected plasmid DNA are shown in Table 2.7, and the method of plasmid preparation and transfection and cell culture is not limited.

TABLE 2.7 plasmid DNA dosage and concentration for transient transformation

After transfection of cells, the results of cell growth monitoring are shown in tables 2.8 (containing propeptide expression) and 2.9 (without propeptide expression), and under normal growth conditions, the culture medium supernatants were harvested for detection and purification at cell viability below about 70%.

TABLE 2.8 cell growth parameters after transfection of expression of propeptide

TABLE 2.9 cell growth parameters after transfection of plasmid without propeptide

Days after transfection	Cultivation time (h)	Cell count (10) 6 /ml)	Cell viability (%)
				0	/	2.5	97
2	48	5.12	95
				5	120	4.99	79
6	138	3.07	72

Through the transfer membrane of the purified protein after SDS-PAGE, rabbit polyclonal antibodies are prepared for immunoblotting detection, and the specificity of the expression product is determined, and the specific steps are as follows:

the cultured cells were collected by centrifugation, the precipitated cells were discarded, 5. Mu.l of the culture medium supernatant was added to 5. Mu.l of a loading buffer for protein electrophoresis, and subjected to electrophoresis separation by 12% SDS-PAGE, and after electrophoresis, electrotransformation and immunoblotting hybridization were performed with a primary antibody of 1: a5000-diluted rabbit anti-snake venom polyclonal antibody prepared by immunizing rabbits with natural snake venom protein, wherein the secondary antibody is 1: the HRP-labeled goat anti-rabbit antibody diluted 20000 is shown in FIG. 8, the immunoblotting detection shows that after the antibody hybridization, the color development and imaging are carried out, 1 is natural snake venom hemagglutinin, 2 is recombinant expression product containing propeptide, 3 is recombinant expression product without propeptide, and as can be seen in FIG. 8, the snake venom protein with propeptide and without propeptide is expressed, the molecular weight is about 40kDa, one protein band exists at the position below 40kDa, and the possibility of different glycosylated protein products is presumed.

The expression products of the gene combination library of the detected hemagglutinin have enzyme activity, which indicates that the monoclonal sequences with enzyme activity exist in the gene combination library of the application, and the monoclonal sequences with activity may not be unique in sequence and may not be consistent with the reported sequences, so that the sequence range of the detection needs to be further reduced.

Notably, the presence or absence of the propeptide was found to have no significant effect on the expression of the enzyme in the mixed expression in the gene sequence pool. The sequences selected included a different number of mutations, the least mutated sequences differing from the disclosed sequences by only one amino acid, the most mutated sequences having 6 site mutations including individual cysteines, aspartic acids that are not potential glycosylation sites, and other amino acids, but none involving amino acids in the center of enzymatic activity.

Example 3 screening of target Gene among hemagglutinin genes

The expression vector in the hemagglutinin combinatorial gene library obtained in example 2 was modified, the His tag was removed, and the recombinant vector was concentrated about 10-fold without purification. The modified gene sequence is as follows:

ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCAGAATTCGCAAAAGTCTTCTGAACTGGTCATTGGAGGTRWTGAATGTGACAYAAATGAACATCGTTTCCTTGTAGCCTTGWATGAGTTAACATCTATGACTTTTCTCTGCGGTGGGACTTTGATCAACCAGGAATGGGTGGTCACTGCTGCACACTGCGACAGGTTACAGCTCTACCTATACATTGGTATGCATGACAAATATGTAAAATTTGATGATGAGCAAGGAAGAGAGCCAATTGAGAAGTACTTTTATAACTGTAGCAACAACCTTACCACACGGGACAAGGACATCATGTTGATCAGGCTGGACAGACCTGTTGACAATAGTACACACATCGCGCCTCTCAGCTTGCCTTCCAGGCCACCCAGTGTGGGCTCAGTTTGCCGTGTTATGGGATGGGGCGCAATCTCACCTTCTCGTGACGTTTTGCCTGATGTCCCTCATTGTGTTAACATTAACCTAGTAAATAATGCGGAGTGTCGAAGAGCTTACCCAAGGTTGCCGGCGACAAGCAGAACATTGTGTGCAGGTGTCATGCAAGGAGGCATAGATTCATGTAACCGTGACTCTGGGGGACCTCTCATATGTGATGGACAATTCCAGGGCGTTGTAAATTGGGGAGGCAATCCTTGTGCCCRACCGAATATGCCTGCCCTCTACACCAAGGTCTACGATTATAATGATTGGATCCRGAGCATTACTGCAGGAAATACAACTGCGRCCTGCCCCCCATAACTCGAG。

TAACTCGAG in the above sequence is the termination code and cleavage site.

Designing an upstream primer and a downstream primer for the gene sequences:

an upstream primer: 5'-CACGAATTCGGTCATTGGAGGTRWTGAA-3';

a downstream primer: 5'-ATCCTCGAGTTATGGGGGGCAGGYCGCAGT-3';

the PCR amplification conditions are shown in Table 3.1:

TABLE 3.1 PCR amplification conditions

Component (A)	Volume (mul)
		dNTPs(2.5mM stock)	5
10×Ex Taq Buffer	5
		Upstream primer	2
Downstream primer	2
		Ex Taq Hot Start	1(5U)
Template DNA	1
		Add ddH 2 O	To 34

The amplified target gene is connected with pcDNA3.4 vector by enzyme digestion, expression vectors are constructed, the prepared expression vectors are numbered KCL-1 to KCL-9, the 9 expression vectors are prepared, the concentration is regulated to be about 1mg/ml by ultrapure water after concentration measurement, and then two 2ml of ExcpiCHO are transfected by each expression vector ^TM Cells (Thermo Fisher), the amount and concentration of DNA of the plasmid used for transfection are shown in Table 3.2 below.

TABLE 3.2 plasmid DNA dosage and concentration for transient transformation

The expression products of the nine groups of clones are subjected to indirect ELISA detection, cell culture supernatants of the clones are respectively coated with 50 μl, standard curves of estimated concentration are prepared by using purified natural snake venom proteins, initial concentration is 2 μg/ml, 10-fold gradient serial dilution is carried out until 2ng/ml, and PBS is used as blank control. Coating for 4 hours, removing coating liquid, blocking with PBS solution containing 4% BSA, removing blocking liquid after blocking for 4 hours, washing the plate three times with PBS buffer solution containing 0.05% Tween, adding 1:5000 dilutions of rabbit anti-snake venom polyclonal antibody. Incubation at 37 ℃ for 1 hour, the supernatant was discarded, the plate was washed three times with PBS buffer containing 0.05% tween, 1:20000 diluted HRP-labeled goat anti-rabbit antibody, incubating for 1 hr at 37deg.C, discarding supernatant, washing the plate four times with PBS buffer solution containing 0.05% Tween, drying, adding color development solution, developing for 6 min, and adding 2M H ₂ SO ₄ The reaction was stopped, the absorbance at 450nm was read, and the product concentration of each sample was estimated from the reading of the snake venom sample, and the results are shown in Table 3.3 below.

TABLE 3.3 estimation of the concentration of the products

Cloning	KCL-1	KCL-2	KCL-3	KCL-4	KCL-5	KCL-6	KCL-7	KCL-8	KCL-9
										OD450	1.086	0.1535	0.9535	0.911	0.166	0.146	0.1415	0.735	0.150
ng/ml	17.73	ND	15.21	14.40	0.21	ND	ND	11.04	ND

As can be seen from table 3.3: because the sequences are different, the expression conditions of the genes are different, wherein KCL-2, KCL-6, KCL-7 and KCL-9 cannot be detected due to the too low expression quantity, and four cloning antibodies (KCL-1, KCL-3, KCL-4 and KCL-8) with higher expression yield of the detectable expression products are subjected to amplification culture expression.

The four cloned antibodies (KCL-1, KCL-3, KCL-4 and KCL-8) were transfected into HEK 293 cells, the cell growth monitoring results are shown in Table 3.4, under normal growth conditions, when the cell viability was lower than 80%, the culture medium supernatant was collected, the corresponding ultrafiltration concentration was performed, 20ml of the culture supernatant was concentrated approximately 8 times, and the concentration was 2.5ml for activity measurement, and the parameters of the cell culture process were shown in Table 3.5.

TABLE 3.4 plasmid DNA dosage and concentration for transient transformation

Gene code number	Plasmid concentration (mg/ml)	Volume (mu L)	Supplement H 2 O volume (mu L)	Concentration after adjustment (mg/ml)
					KCL-1	1.4	15	5	1.05
KCL-3	2.9	7.5	12.5	1.08
					KCL-4	1.4	15	5	1.05
KCL-8	2.5	8	12	1.00

TABLE 3.5 technical parameters during cell culture

As can be seen from table 3.5: after the expression vector is transferred into CHO cells for induction culture, the expression vector has higher cell activity rate, which indicates that the expression vector containing the hemagglutinin gene provided by the application can be used for expressing CHO cells. CHO cells are short for chinese hamster ovary cells (Chinese Hamster Ovary), which are eukaryotic cells. That is, the present application can provide a host cell comprising the expression vector, wherein the host cell is a eukaryotic cell, and further wherein the host cell is a CHO cell.

The specific measurement steps for measuring the enzyme activity are as follows:

1. the experimental method comprises the following steps:

1. standard curve preparation

1.1 dilution of active reference

Adding 1ml of purified water into one standard sample of the activity of the hemagglutinin, re-dissolving for 1min, and mixing gently. Then diluted with the diluent to six concentrations of 0.6ml each, 1.0 unit/ml, 1.5 unit/ml, 1.0 unit/ml, 0.5 unit/ml, 3.6 units/ml according to the following table 3.6.

TABLE 3.6 dilution parameters of standard for hemagglutination enzyme activity

1.0 units

1.0 units

1.5 units

2.0 units

3.0 units

4.0 units

Reference article

40μL

80μL

120μL

160μL

240μL

320μL

Sample diluent

560μL

520μL

480μL

440μL

360μL

280μL

6 1.5ml centrifuge tubes were taken and numbered sequentially. Firstly, adding a diluent into a pipe in a reverse beating mode; and then the reference after re-dissolution is removed to the diluent, and the diluent is blown for 5 times, and the suction nozzle of the pipettor is replaced for each concentration.

When pipetting, the volume is smaller than or equal to 0.1ml, and a maximum range 0.1ml pipettor is used; the volume is more than 0.1ml and less than or equal to 0.2ml, and a pipette with the maximum measuring range of 0.2ml is used; the volume is larger than 0.2ml, and a pipette with the maximum measuring range of 1ml is used.

The prepared active reference substances with various concentrations are inverted and mixed uniformly, the air bubbles on the surfaces are removed by centrifugation, and the mixture is put at 4 ℃ for temporary storage.

1.2 reference and reagent Placement

The diluted reference substances are sequentially placed in a full-automatic hemagglutination instrument according to the order of the concentration from high to low. The fibrinogen substrate was loaded into a 1.5ml centrifuge tube.

1.3 Curve set-up

Setting the calibrated six points as 4.0 units/ml, 3.0 units/ml, 2.0 units/ml, 1.5 units/ml, 1.0 units/ml and 0.5 units/ml, storing and exiting the device, wherein the corresponding standard is a solidification method L1-L6.

1.4 Standard Curve preparation

The number of calibration points is 6 points, and the instrument is to be tested. Print data is recorded and repeated three times.

2. Sample testing

Firstly, adding 0.2ml of sample into 3 1.5ml centrifuge tubes in a reverse beating mode; then 0.8ml of diluent is removed, blown for 5 times, each sample is replaced by a pipette nozzle, and the sample is preserved at 4 ℃ for standby.

3. Testing

3.1 sample Loading

The prepared KCL-4 and KCL-8 clone antibodies are placed in a full-automatic hemagglutination instrument, a machine can pop up a sample loading test interface, and each sample is tested once.

2. Data computation

1. The standard curve was obtained using a double logarithmic method of activity and time, i.e., y=a+bx, (y= lgU, x= lgT), where U is activity, and the unit U/mg, T is time.

2. Inputting the solidification time repeatedly measured for three times under each concentration of the active reference into a reference detection time column, and automatically calculating the detection mean value, standard deviation and variation coefficient of each concentration, and fitting formula parameters a and b and related coefficient r after data conversion ² Values. When r is ² Standard curves are available at ≡ 0.990.

Because of the low protein content of the sample, one test of activity was performed after concentration.

The specific activity (IU/mg) of the sample is calculated as: specific activity = U/a/C

In the above formula: u is activity, unit U/mg, A is concentration multiple, C is concentration of sample, unit is mg/mL.

The activity of KCL-1 and KCL-3 is too low to be detected, and the KCL-4 and KCL-8 cloned antibodies have definite enzyme activity.

The KCL-4, KCL-8 clone antibody and hemagglutinin I genes are respectively expressed in CHO cells, the expressed samples are respectively placed for seven days at the temperature of 2-8 ℃ and the room temperature (10-30 ℃), specific activities (IU/mg) are respectively detected on days 0, 1, 3, 5 and 7, and the data are shown in the table 3.7:

TABLE 3.7 specific activities of samples at days 0, 1, 3, 5, 7

Conditions (conditions)	Sample of	Day 0	Day 1	Day 3	Day 5	Day 7
							2℃～8℃	KCL-4	2700	2800	2600	2700	2700
	KCL-8	2300	2400	2400	2300	2400
								Hemagglutinase I)	0	0	0	0	0
10℃～30℃	KCL-4	2700	2700	2800	2600	2600
								KCL-8	2300	2300	2400	2400	2300
	Hemagglutinase I)	0	0	0	0	0

As can be seen from table 3.7: the KCL-4 and KCL-8 clone antibodies have enzyme activity, the specific activity of the two groups of coding sequence expression products is 2300 IU/mg-2800 IU/mg, and the specific activity of the products is not changed greatly within one week, which indicates that the specific activity stability of the prepared hemagglutinase is good, and compared with the specific activity of the hemagglutinase I, the specific activity of the prepared hemagglutinase I is 0, which indicates that the hemagglutinase I cannot be expressed in CHO cells.

In the KCL-4 sequence, compared with the amino acid sequence of the hemagglutinin I, the mutation sites comprise: mutation at position 9 is Thr and mutation at position 216 is Cys.

The KCL-4 sequence is composed of 708 nucleotide codes, the DNA sequence of the KCL-4 is shown as SEQ ID NO.4, the mature protein of the single-chain glycoprotein coded by the DNA sequence contains 236 amino acids, the amino acid sequence is shown as SEQ ID NO.3, wherein the molecular weight of the single-chain glycoprotein is 28 kDa-38 kDa, and the single-chain glycoprotein contains 13 cysteines, so that six pairs of disulfide bonds are formed, namely the KCL-4 sequence can treat folding of the protein, realize the expression of a hemagglutinin gene in mammalian cells, has higher enzyme activity, and can be further used in hemostatic and coagulopathies.

In the KCL-8 sequence, compared with the amino acid sequence of the hemagglutinin I, the mutation sites comprise: mutation at position 5 to Asp, mutation at position 191 to His and mutation at position 233 to Thr.

The KCL-8 sequence is formed by 708 nucleotide codes, the DNA sequence of KCL-8 is shown as SEQ ID NO.6, the mature protein of the single-chain glycoprotein coded by the DNA sequence contains 236 amino acids, the amino acid sequence is shown as SEQ ID NO.5, the molecular weight of the single-chain glycoprotein is 28 kDa-38 kDa, and 13 cysteines are contained, six pairs of disulfide bonds are formed, namely the KCL-8 sequence of the application can treat the folding of the protein, realize the expression of a hemagglutinin gene in mammalian cells, has higher enzyme activity, and can be further used in hemostatic and coagulopathies.

Performance measurement:

1. determination of protein purity by size exclusion chromatography

The purity of KCL-4 and KCL-8 coagulase was determined using Agilent 1200 high performance liquid chromatograph and TSK G3000 SWX. PBS buffer solution with the mobile phase of 20mmol/L and pH of 6.8 is prepared by weighing 4.37g of disodium hydrogen phosphate, 1.22g of sodium dihydrogen phosphate and 8.77g of sodium chloride, and fixing the solution to 1L of purified water. The blank control group is: protein-free buffers, component 20mmol/L citrate buffer pH 6.4. The sample injection volume is 50 mu L; the flow rate is 0.8mL/min; the A280 nm value was measured and the SEC-HPLC experimental results are shown in FIGS. 9 and 10: the purities of KCL-4 and KCL-8 coagulase are both more than 95%.

2. SDS-PAGE electrophoresis identification

Preliminary quantification is carried out on KCL-4 and KCL-8 hemagglutinin proteins by adopting a Nanodrop spectrophotometer, 3 micrograms of purified KCL-4 and KCL-8 hemagglutinin proteins are respectively subjected to SDS-PAGE electrophoresis identification, the electrophoresis result is shown in figure 11, the protein molecular weight ranges of KCL-4 and KCL-8 hemagglutinin proteins are 28 kDa-38 kDa, and the molecular weight is basically consistent with the expected molecular weight, so that the application shows that the novel hemagglutinin is successfully prepared.

3. Prothrombin time assay

The prothrombin time of the thrombin, KCL-4 thrombin and KCL-8 thrombin extracted from the tissue of the snake venom gland is respectively measured by adopting a first-stage coagulation method of Chinese pharmacopoeia, the measurement results are shown in figure 12, and the results show that: the time of 0.1mg KCL-4 and 0.1mg KCL-8 hemagglutinase zymogen has equivalent activity with 1mg natural extraction separation hemagglutinase, which shows that compared with the natural separation purification hemagglutinase, the hemagglutinase of the application has more controllable quality and obviously better specific activity than the natural separation purification hemagglutinase.

In conclusion, the hemagglutinin obtained by CHO cell expression has high enzyme activity and high efficient amplification and expression capacity, and the expressed glycosylated drug protein can approach to natural protein molecules in molecular structure, physicochemical property and biological function, and can be applied to clinic and industrialized production.

The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims (10)

1. The hemagglutinase is characterized by having an amino acid sequence, wherein the amino acid sequence is obtained by mutation of the amino acid sequence of the hemagglutinase shown in SEQ ID NO.1, and the mutation site of the amino acid sequence of the hemagglutinase comprises: mutation at position 9 to Thr and mutation at position 216 to Cys.

2. The hemagglutinase according to claim 1, wherein the amino acid sequence of the hemagglutinase is set forth in SEQ ID No. 3.

3. The hemagglutinase is characterized by having an amino acid sequence, wherein the amino acid sequence is obtained by mutating the amino acid sequence of the hemagglutinase I shown in SEQ ID NO.1, and the mutation site of the hemagglutinase comprises: mutation at position 5 to Asp, mutation at position 191 to His, and mutation at position 233 to Thr.

4. The hemagglutinase according to claim 3, wherein the amino acid sequence of the hemagglutinase is set forth in SEQ ID No. 5.

5. A hemagglutinase gene, which encodes the hemagglutinase according to any one of claims 1 to 4.

6. An expression vector comprising the hemagglutinin gene of claim 5, which is capable of expression in CHO cells and is active.

7. A host cell comprising the expression vector of claim 6, wherein the host cell is a CHO cell.

8. A method for screening a hemagglutinin enzyme, comprising the steps of:

(1) Extracting total RNA of snake venom glands;

(2) Reverse transcription of total snake venom gland RNA:

(3) Amplifying a snake venom gland gene by PCR;

(4) Degenerate primers are carried out on the snake venom gland gene sequence obtained by amplification and the gene sequence of the hemagglutinase I, the hemagglutinase gene is obtained by adopting an overlap extension PCR technology, and the constructed hemagglutinase gene is cloned to construct a hemagglutinase combined gene library;

the amino acid sequence of the hemagglutinin I is shown as SEQ ID NO.1, and the gene sequence of the hemagglutinin I is shown as SEQ ID NO. 2;

(5) Designing a target gene in the hemagglutinin combined gene library by adopting an overlap extension PCR technology, carrying out PCR amplification, constructing a recombinant expression vector plasmid, carrying out expression in CHO cells transfected by the recombinant expression vector plasmid, and screening out a coding sequence with the specific activity of an expression product of 2300 IU/mg-2800 IU/mg, wherein the expression product comprises the mutation site of claim 1 or the mutation site of claim 3.

9. The method of screening according to claim 8, wherein the PCR amplification of the snake venom gland gene comprises:

the reverse transcription product is used as a template for amplifying the snake venom gland gene, and the primers are as follows:

the upstream primer KCS-F is 5'-ATGGTGCTGATCAGAGTGMTAG-3';

the downstream primer KCS-R is 5'GTAGTTGGATATGGTTAGGGA-3';

the PCR amplification system was as follows:

reverse transcription product, 1 μl;2.5mM dNTPs, 4. Mu.l; pfu DNA polymerase Buffer (10×), 5 μl;2. Mu.l of the upstream primer; 2. Mu.l of downstream primer; pfu DNA polymerase, 0.2. Mu.l; ddH ₂ O, make up to a total volume of 50. Mu.l;

the PCR amplification conditions were as follows:

after 5min of pre-denaturation at 95℃30 cycles of denaturation at 94℃45s, annealing at 60℃45s and extension at 72℃90s were performed and finally incubated at 72℃for 10min.

10. Use of the hemagglutinase according to any one of claims 1 to 4 or the hemagglutinase gene according to claim 5 in a clotting medicament.

Images