CN116121241A

CN116121241A - Probe, detection kit and method for detecting methylation of target nucleic acid

Info

Publication number: CN116121241A
Application number: CN202310048693.0A
Authority: CN
Inventors: 许林浩; 富国良
Original assignee: Guangzhou Zhenfu Technology Co ltd
Current assignee: Guangzhou Zhenfu Technology Co ltd
Priority date: 2023-02-01
Filing date: 2023-02-01
Publication date: 2023-05-16

Abstract

The invention relates to the field of biological detection, in particular to a probe, a detection kit and a detection method for target nucleic acid methylation. The invention provides a probe, which is characterized by comprising: a first oligonucleotide comprising a region complementary to a portion of a target nucleic acid, and at least one second oligonucleotide comprising a region complementary to the first oligonucleotide, such that the first and second oligonucleotides are capable of forming a double stranded portion. The detection methods provided herein allow for the simultaneous amplification and detection of a large number of different chemically and enzymatically treated target nucleic acid sequences for methylation analysis of genomes.

Description

Probe, detection kit and method for detecting methylation of target nucleic acid

Technical Field

The invention relates to the field of biological detection, in particular to a probe, a detection kit and a detection method for target nucleic acid methylation.

Background

Multiplex PCR, which uses multiple primer pairs to simultaneously amplify multiple target sequences in a single PCR reaction, is a more efficient PCR method than standard PCR using a single primer pair. Simultaneous amplification of different target nucleic acids reduces the cost and time consumption of PCR analysis, minimizes the risk of experimental degradation and cross-contamination, and improves the reliability of the final results. Multiplex PCR has been used in a variety of fields for DNA detection, including identification of microorganisms, gene expression analysis, mutation and polymorphism analysis, genotyping and DNA array analysis, and RNA detection.

Real-time PCR has been developed for quantifying the amplified products during the PCR reaction. Real-time PCR is based on the principle that fluorescence emitted from the dye is directly or indirectly related to the formation of newly synthesized amplicons, or that annealing between the primer and the DNA template can be detected and proportional to the amount of amplicon in each PCR cycle.

Another form of probe for PCR is a double-stranded linear probe with two complementary oligonucleotides. The probes described in the prior art have the same length, wherein at least one oligonucleotide is in a single stranded conformation as a probe against a target sequence. The 5 'end of one of the above oligonucleotides is labeled with a fluorescent group, while the 3' end of the other oligonucleotide is labeled with a quencher, such as an acceptor fluorescent group, or vice versa. When the two oligonucleotides anneal to each other, the two labels approach each other, thereby quenching the fluorescence. While a target nucleic acid that competitively binds to the probe can cause a lower than proportional increase in fluorescence of the probe with increasing concentration.

An improved double-stranded linear probe is also known in the art by shortening one of the two complementary oligonucleotides by a few bases to obtain a partially double-stranded linearized probe. In this prior art double-stranded linear probe, the longer oligonucleotide ends are labeled with a fluorescent group, while the shorter oligonucleotide ends are labeled with a quencher. When the probe is present in double-stranded form, the fluorescent emission is weaker due to the close proximity of the fluorophore and quencher positions. When a target nucleic acid is present, the shorter oligonucleotide with the quencher is replaced by the target nucleic acid. As a result, the fluorescent emission of longer oligonucleotides (present in the form of probe-target nucleic acid hybrids) is sufficiently intense.

DNA methylation is an important epigenetic mechanism with multiple regulatory functions (golnandbestor 2005). DNA methylation studies are an important piece of epigenetic science, in which methylation in eukaryotes occurs only at Cytosine (Cytosine), i.e., the 5 '-end of CpG dinucleotides is converted to 5' -methylcytosine by the action of DNA methyltransferase. DNA methylation generally inhibits gene expression, and demethylation induces reactivation and expression of the gene. This mode of DNA modification is involved in important regulatory roles in the embryonic development of vertebrates, and the pathogenesis of a variety of diseases, including various tumors, is a hotspot in current epigenetic studies.

Disclosure of Invention

In view of this, the present invention provides probes, detection kits, and methods for detecting methylation of target nucleic acids. The detection methods provided herein allow for the simultaneous amplification and detection of a large number of different chemically and enzymatically treated target nucleic acid sequences for methylation analysis of genomes.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a probe, which is characterized by comprising:

a first oligonucleotide comprising a region complementary to a portion of a target nucleic acid, an

At least one second oligonucleotide comprising a region complementary to the first oligonucleotide such that the first and second oligonucleotides are capable of forming a double stranded portion.

In some embodiments of the invention, the first oligonucleotide in the probe is 15 to 150bp in length and the second oligonucleotide is 4 to 150bp in length.

In some embodiments of the invention, the probe further comprises a label; the label includes a fluorescent reporter group and/or a quencher group.

In some embodiments of the invention, the combination of the labels or detectable labels in the above-described probes is capable of producing a variable signal that characterizes the presence or absence of a double stranded portion between the first and second oligonucleotides of the probe.

The invention also provides a detection kit comprising the probe and an acceptable auxiliary agent or carrier.

The invention also provides application of the probe or the detection kit in detecting methylation of target nucleic acid.

The invention provides a method for detecting methylation of target nucleic acid, which comprises the steps of mixing pretreated target nucleic acid with amplification reactants, and amplifying to obtain methylation state of the target nucleic acid;

The amplification reaction comprises: at least one pair of forward/reverse oligonucleotide primers and a probe according to claim 1 or 2 or a probe in a detection kit according to claim 3.

In some embodiments of the invention, the pretreatment in the detection methods described above employs a chemical or enzymatic process to convert unmethylated cytosine to uracil.

In some embodiments of the present invention, in the above detection method, the number of the probes is not less than 2.

In some embodiments of the invention, the methylation is detected using a chemical or enzymatic method.

In some embodiments of the invention, in the above detection method, the chemical method employs bisulfite; the enzyme method adopts TET enzyme.

In some embodiments of the invention, the oligonucleotide primers in the above detection methods comprise one identical 5' tail.

In some embodiments of the invention, the amplification in the above detection method comprises at least two steps of denaturation, annealing and primer extension.

In some embodiments of the invention, the amplification in the above detection method comprises the steps of:

s1: obtaining an amplification curve using the first oligonucleotide in combination with the target nucleic acid;

S2: obtaining a melting curve by hybridizing the first oligonucleotide with the second oligonucleotide;

s3: obtaining the methylation state of the target nucleic acid according to the amplification curve and the melting curve.

The present invention provides a method for methylation of a test sample for one or more target nucleic acids, the method comprising the steps of:

(a) Subjecting a sample comprising one or more target nucleic acids to chemical or enzymatic treatment such that unmethylated cytosine is converted to uracil;

(b) Contacting the sample of transformed nucleic acid with an amplification reaction mixture comprising:

(i) One or more pairs of forward/reverse oligonucleotide primers, wherein if one or more target nucleic acids are present in the sample, the primer pairs are capable of amplifying the one or more target nucleic acids;

(ii) Two or more probes, wherein each probe comprises:

At least one second oligonucleotide comprising a region complementary to the first oligonucleotide such that the first and second oligonucleotides are capable of forming a double stranded portion;

Wherein each probe comprises a detectable label or a combination of detectable labels, and wherein the melting characteristics of the double stranded portion between the first and second oligonucleotides of each of such probes are different;

(c) Performing an amplification reaction on said sample/reaction mixture under amplification conditions, wherein when a target nucleic acid is present, said first oligonucleotide of a probe complementary to a portion of the target nucleic acid hybridizes to said target nucleic acid and is therefore consumed, wherein said consumed oligonucleotide of a probe is no longer able to participate in forming a double stranded portion of said probe; and

(d) Amplification curves were obtained by detecting signals from probe hybridization either on the amplified products or by digestion.

In some embodiments of the invention, the chemical process treatment in the above method may be a bisulfite treatment. In this method, unmethylated cytosine (C) is converted to uracil (U) after sulfite treatment of DNA, and methylated cytosine is kept unchanged. The treated DNA was PCR-derived by using specific primers to obtain very accurate DNA sequence methylation site information. The methylation of DNA is first performed by methyl conversion, and there are currently two schemes, one by converting unmethylated C to U and the other by converting methylated C to U. The former is represented by bisulfite sequencing (BS-Seq): converting unmethylated C on DNA into U (methylation C is not affected) by utilizing Bisulfite (Bisulfite), thereby identifying methylation sites, wherein the conversion efficiency is up to 99%, but the BS-Seq defect is very prominent, and Bisulfite can cause DNA fracture damage; another method is an enzymatic method, represented by TAPS (TET-assisted pyridine borane sequencing) developed by the university of Oxford, which is a single base resolution DNA methylation analysis method that does not require bisulfite, is less destructive, and is more efficient. This technique uses TET enzyme to oxidize 5mC and 5hmC to 5-carboxycytosine (5 caC), then converts 5caC to U via pyridine borane, PCR amplification.

In some embodiments of the invention, the methods described above result in an amplification curve by detecting a signal from hybridization of a probe to an amplification product or digestion, analyzing the amplification curve to determine the intensity or amount of amplification by Ct value, and analyzing the melting curve to determine which probe is consumed and thus which target sequence is amplified.

In some embodiments of the invention, at least one detectable label in the above methods may be a fluorescent label.

In some embodiments of the invention, the amplification in the above methods may be an isothermal amplification or a thermocycling amplification reaction comprising two or more denaturation, annealing and primer extension steps.

In some embodiments of the invention, said consumption of said probe in the above method may be achieved by hybridization of said first oligonucleotide of said probe to said target sequence, followed by degradation of said first and/or second oligonucleotide of said probe, wherein said reaction mixture comprises double-stranded dependent nuclease activity when said first oligonucleotide of said probe is degraded during said reaction.

In some embodiments of the invention, the probe in the above method comprises a first label and a second label, wherein the first label is a fluorescent group and the second label is a quencher, or wherein the first label is a quencher and the second label is a fluorescent group.

In some embodiments of the invention, the label is on one oligonucleotide of the probe in the above method, either the first oligonucleotide or the second oligonucleotide.

In some embodiments of the invention, the one or more pairs of forward/reverse oligonucleotide primers in the above method may comprise one 5' tail in the same order.

In some embodiments of the invention, the reaction system in the above method may contain a universal primer that may contain a 5' tail of the same order as or similar to the forward/reverse oligonucleotide primer.

The invention also provides a kit for detection of one or more target nucleic acids, the kit comprising a probe comprising:

15-150 nucleotides, and at least one second oligonucleotide of 4-150 nucleotides.

In some embodiments of the invention, each probe in the above-described kit comprises a detectable label or a combination of detectable labels capable of generating a variable signal that characterizes the presence or absence of a double stranded portion between the first and second oligonucleotides of the probe.

In another aspect, the invention provides a method of detecting one or more target nucleic acids for methylation analysis in a sample, the method comprising:

(a) Contacting a sample comprising one or more target nucleic acids with a reaction mixture comprising:

a probe set comprising two or more probes, wherein at least one probe having a double-stranded portion may comprise:

a first oligonucleotide comprising a first region and a second region, wherein said first region is substantially complementary to a portion of a target nucleic acid, and at least one second oligonucleotide comprising a region substantially complementary to said second region of said first oligonucleotide;

such that the first and second oligonucleotides are capable of forming a double stranded portion of the probe;

wherein each probe comprises a detectable label or a combination of detectable labels capable of generating a variable signal, wherein said signal reflects the presence or absence of a target nucleic acid, and wherein at least two probes comprise the same detectable label or different detectable labels whose emission spectra are indistinguishable, and wherein each of said probes has a different melting characteristic (melting temperature T _m ) And can be distinguished in melting map analysis;

(b) Performing a reaction in a sample/reaction mixture, wherein the reaction is a primer extension reaction under extension conditions, wherein when a target (target) nucleic acid is present, the probe is extended as a primer and is therefore consumed, wherein a first oligonucleotide of the corresponding probe as an extendable primer hybridizes to the target (target) sequence and is thus consumed in the primer extension reaction, wherein the consumed oligonucleotide is no longer able to participate in forming a double stranded portion (duplex) of the probe; and

(c) Obtaining an amplification curve, followed by measuring a melting profile of the unconsumed probe in the reaction mixture at least once by detecting a signal from the label on the unconsumed probe as a function of temperature;

wherein the melting profile provides an indication of whether at least one target nucleic acid of interest is present in the sample.

In some embodiments of the invention, the first oligonucleotide of the probe in the above method may also function as a primer. In one primer extension reaction, the mixture of probes is added to a reaction mixture containing all of the components for extension under extension conditions. If a specific target nucleic acid is present in the reaction, the oligonucleotide corresponding to the probe hybridizes to the target sequence and is then extended and incorporated into the primer extension product and is therefore consumed. The consumed oligonucleotides can no longer participate in forming the double stranded portion of the probe. In melting profile analysis, the consumed probe appears as a decrease or disappearance of one peak.

In some embodiments of the invention, the amplification reaction in the above methods may be any amplification method, such as PCR, SDA, NASBA, LAMP,3SR,ICAN,TMA, helicase-dependent isothermal DNA amplification, and the like. PCR is a preferred amplification method.

In some embodiments of the invention, an amplification primer in the above methods may be a target-specific primer comprising a 3' initiation portion complementary to a target region of a target nucleic acid. The amplification primer may also be a universal primer having the same or substantially the same sequence as the 5' universal portion of the target-specific primer. The reaction may include a plurality of primers for amplification of a plurality of target sequences. The 5 'universal portion of the plurality of primers may have a substantially identical sequence composition that is identical or substantially identical to the 3' initiation portion of the universal amplification primer. Preferably, the primers are DNA primers, particularly those suitable for PCR amplification.

In some embodiments of the invention, the amplification reaction mixture in the above method includes primer pairs consisting of forward and reverse primers, such that if a target nucleic acid is present in the sample, the primer pairs will amplify the target nucleic acid, preferably in an exponential manner.

In some embodiments of the invention, the amplification reaction mixture in the above method comprises a probe set consisting of two or more probes. The probe comprises:

a first oligonucleotide comprising a first region and a second region, wherein said first region is substantially complementary to a portion of a target nucleic acid, and

a second oligonucleotide comprising a region substantially complementary to said second region of said first oligonucleotide;

the first and second oligonucleotides are thus capable of forming a double stranded portion of the probe.

In some embodiments of the invention, the first oligonucleotide in the above method is capable of binding to a portion of at least one of the target nucleic acids under suitable hybridization conditions. Preferably, each first oligonucleotide is specific for a portion of only one target nucleic acid. The first oligonucleotide should have a first region with a nucleotide sequence that is complementary or substantially complementary to a nucleotide sequence of a portion of a target nucleic acid. The length of this first complementary region is preferably 6 to 100 nucleotides, more preferably 15 to 30 nucleotides. The total length of the first oligonucleotide is preferably 15 to 150 nucleotides, more preferably 17 to 100 nucleotides, most preferably 20 to 80 nucleotides.

In some embodiments of the invention, in some of the above methods, including embodiments wherein the reaction includes primer extension or amplification, the portion of the target nucleic acid complementary to the first oligonucleotide must belong to or overlap with a sequence to be amplified by the forward and reverse primers. Alternatively, the first oligonucleotide may be one of the amplification primers, for example a forward or reverse primer. In some embodiments, the first and/or second oligonucleotide is not a forward or reverse primer.

In some embodiments of the invention, the second oligonucleotide in the above method comprises a region substantially complementary to a second region of the first oligonucleotide. The length of this second region is preferably 4 to 100 nucleotides, more preferably 15 to 30 nucleotides. The second region of the first oligonucleotide may or may not overlap with the first region of the first oligonucleotide. The total length of the second oligonucleotide is preferably 6 to 150 nucleotides, more preferably 10 to 100 nucleotides, most preferably 12 to 80 nucleotides. The first and second oligonucleotides may comprise 1 to 5 or 1 to 10 or more nucleotides at the 5 'or 3' end that are not complementary to the target nucleic acid or the first oligonucleotide, respectively.

In some embodiments of the invention, the first region of the first oligonucleotide does not overlap or does not overlap sufficiently with the second region of the first oligonucleotide in the above methods.

In some embodiments of the invention, the first region of the first oligonucleotide in the above method substantially overlaps with the second region of the first oligonucleotide or the second region is comprised in the first region. In these embodiments, the first oligonucleotide hybridizes to the target sequence to form a duplex T _m Preferably above T of the duplex formed by hybridization of said first oligonucleotide with said second oligonucleotide _m Thus, if a target nucleic acid is present, the first oligonucleotide forms a stronger hybrid with the target nucleic acid and melts at a higher temperature than the first/second oligonucleotide duplex.

In some embodiments of the invention, at least one probe of the above methods is capable of forming a double stranded portion. Because of this double-stranded portion, the probe has a melting temperature T _m And a characteristic melting profile. In particular, a mixture of probes of the invention also has a characteristic melting profile.

In some embodiments of the invention, multiple target nucleic acid sequences can be analyzed in a single tube by designing a probe set consisting of probes that hybridize to different target sequences and probes that have different melting temperatures based on the double stranded portion within them. If a target sequence is present, its corresponding probe is consumed. The sequence of the target can then be determined based on a comparison between the melting profiles of the probe sets before and after the reaction. Advantageously, different probes in a probe set can be associated with the same label, allowing monitoring at a single emission wavelength. In one embodiment, each probe in the set of probes is associated with the same label, e.g., a fluorescent energy transfer pair or a contact quenching pair, more particularly, a first label that is a fluorescent group and a second label that is a quencher. Alternatively, multiple probe sets may be associated with different pairs of labels, such that each probe set is distinguishable from the others based on different emission spectra.

In some embodiments of the invention, methods of assaying multiple target nucleic acids can utilize either a mixture of multiple probes associated with different labels having distinguishable emission spectra or a mixture of multiple probes associated with labels having the same or overlapping emission spectra, but distinguishable based on differences in melting temperature of the double-stranded portion within.

In some embodiments of the invention, the first oligonucleotide of the probe comprising a double-stranded portion described above in the above method can be consumed during amplification. Alternatively, both the first and second oligonucleotides of the probe containing double stranded portions can be consumed during the amplification process. Preferably, the first oligonucleotide is designed to be consumed in one reaction, while the second oligonucleotide may remain unchanged.

In some embodiments of the invention, each probe in the above method comprises a detectable label that produces a variable signal, wherein the signal reflects the presence or absence of the double-stranded portion of the probe.

In some embodiments of the invention, at least two probes in the amplification reaction mixture in the above method comprise the same detectable label or a different detectable label whose emission spectra are indistinguishable.

In some embodiments of the invention, two or more probes are used to detect the presence of two or more target nucleic acids in a multiplex reaction. However, this does not necessarily mean that each different probe needs to have a different distinguishable label. Each probe may have a unique melting profile that depends on the characteristics of its internal double stranded portion. Thus, if two or more probes have distinguishable melt characteristics, the same label can be used for these probes. That is, different probes labeled with the same label or with labels whose emission spectra are indistinguishable must have different melting characteristics.

In some embodiments of the invention, the term "melting property" as used herein includes the melting profile of the probe (preferably by measurementThe signal from the label on the probe is measured as a function of temperature) and/or the melting temperature (T _m )。

In some embodiments of the invention, probes having the same label or different labels whose emission spectra are indistinguishable have melting temperatures (T _m ) The melting temperatures of the probes and the like labeled are generally different from each other. In one embodiment, a plurality of probes in a probe set are each labeled with the same label (or with different labels whose emission spectra are indistinguishable), and each probe has a unique melting temperature range. In one multiplex assay, the reaction temperature has the lowest T when it is increased from the hybridization temperature to a denaturation temperature _m The probe duplex of (a) melts first, the probe duplex with the next lowest Tm separates second, and the probe duplex with the highest T _m Finally denatured probe duplex of (a). At the same time, due to the progressive melting of the probe duplex, the fluorescence emission of the label associated with the probe changes in proportion to the progressively increasing reaction temperature, allowing each probe to be distinguished in the combined melting profile. The shape and position of the melting curve is a function of the GC/AT ratio, length and sequence of the double stranded portion of the probe.

In some embodiments of the invention, the Tm of a probe that has the same label or a different label whose emission spectrum is indistinguishable from that of other similarly labeled probes _m There is a difference of at least 2 ℃, preferably at least 3 ℃,4 ℃ or 5 ℃.

The invention provides a probe, which is characterized by comprising: a first oligonucleotide and at least one second oligonucleotide; the region of the first oligonucleotide that is partially complementary to the target nucleic acid is a first region; the region of the first oligonucleotide that is partially complementary to the second oligonucleotide is a second region;

the first region does not completely overlap the second region.

The detection methods provided herein allow for the simultaneous amplification and detection of a large number of different chemically and enzymatically treated target nucleic acid sequences for methylation analysis of genomes.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a graph showing that by adding first and second oligonucleotides of different targets under the same fluorescent channel, performing conventional qPCR amplification and then melting analysis, different melting peaks can be seen to appear, and different target detection corresponds to the different targets, so that the aim of detecting a plurality of targets by one channel is fulfilled;

FIG. 2 shows the results of a blank, with the upper part of the melting curve and the lower part of the amplification curve, and no amplification curve, i.e., no Ct value, because no template was added; the above dissolution peak profile, since the first oligonucleotide is not consumed without amplification in the system, the double strand formed by the second oligonucleotide corresponding to the first oligonucleotide gives one dissolution peak (corresponding to Tm visible) in the dissolution profile procedure, and the two labels have two distinct Tm peaks;

FIG. 3 shows the results of a sample set with a melting curve portion above and an amplification curve portion below, showing that there is an amplification curve with a specific Ct value, but it is not clear from the amplification curve or Ct value above which label of the fluorescent channel is amplified or both labels, by the melting peak curve above, it is seen that the peak corresponding to the first Tm is significantly reduced, meaning that the probe of this label is consumed, i.e., amplified, resulting in a decrease in the double-stranded portion of the first oligonucleotide and the second oligonucleotide, resulting in a decrease in the peak of the melting curve, whereas the peak corresponding to the second Tm is not different, and therefore the first oligonucleotide is not consumed, so that no corresponding amplification, by the judgment of the melting curve, it is possible to obtain a signal that the amplification curve is generated by the amplification of the label corresponding to the first peak;

FIG. 4 is a combination of the results of FIGS. 2 and 3, i.e., by combining the curve results of the blank and sample sets, using the melting curve to determine which marker in the fluorescent channel the corresponding signal generated by the amplification curve was generated;

FIG. 5 shows the effect of combining the markers in a blank with the other sample set of curve results, it is evident that both markers are amplified such that a decrease in melting peak occurs, i.e., both markers are amplified, so that the Ct corresponding to the amplification curve is the total signal that the two markers together produce;

FIG. 6 shows another fluorescent channel, a combination of 3 markers. From the melting curve it can be seen that there are 3 different Tm values for 3 different labels; the peak value of the 2 markers corresponding to the marker 1 and the marker 2 is obviously reduced, and the melting curve peak value of the other marker is unchanged compared with that of the blank control group, so that the Ct of the amplification curve is amplified by the two markers;

FIG. 7 shows the results of another sample and blank for the fluorescent channel marker set, judging that all 3 markers were amplified;

FIG. 8 shows the results of another sample and blank for the fluorescent channel marker set, judging that both marker 1 and marker 3 were amplified.

Detailed Description

The invention discloses a probe, a detection kit and a detection method for methylation of target nucleic acid.

The present invention provides a method for methylation of a test sample for one or more target nucleic acids, the method comprising:

(ii) Two or more probes, wherein each probe comprises:

Wherein the chemical treatment may be a bisulfite treatment. In this method, unmethylated cytosine (C) is converted to uracil (U) after sulfite treatment of DNA, and methylated cytosine is kept unchanged. The treated DNA was PCR-derived by using specific primers to obtain very accurate DNA sequence methylation site information. The methylation of DNA is first performed by methyl conversion, and there are currently two schemes, one by converting unmethylated C to U and the other by converting methylated C to U. The former is represented by bisulfite sequencing (BS-Seq): converting unmethylated C on DN A into U (methylation C is not affected) by utilizing Bisulfite (Bisulfite), thereby identifying methylation sites, wherein the conversion efficiency is up to 99%, but the BS-Seq defect is quite prominent, and the Bisulfite can cause DNA fracture damage; another method is an enzymatic method, represented by TAPS (TET-assisted pyridin e borane sequencing) developed by the university of Oxford, which is a single base resolution DNA methylation analysis method that does not require bisulfite, is less destructive, and is more efficient. This technique uses TET enzyme to oxidize 5mC and 5hmC to 5-carboxycytosine (5 caC), then converts 5caC to U via pyridine borane for PC R amplification.

Wherein the amplification curve and the melting curve are obtained by detecting a signal generated by hybridization of the probe to the amplification product or digested, analyzing the amplification curve to determine the amplification intensity or quantification by Ct value, and analyzing to determine which probe is consumed, thereby obtaining which amplified sequence.

Wherein the at least one detectable label may be a fluorescent label.

Wherein the amplification may be an isothermal amplification or a thermocycling amplification reaction comprising two or more denaturation, annealing and primer extension steps.

Wherein said consumption of a probe may be achieved by hybridization of said first oligonucleotide of said probe to said target sequence, followed by degradation of said first and/or second oligonucleotide of said probe, wherein said reaction mixture comprises double-stranded dependent nuclease activity when said first oligonucleotide of said probe is degraded during said reaction.

Wherein the probe comprises a first label and a second label, wherein the first label is a fluorescent group and the second label is a quencher, or wherein the first label is a quencher and the second label is a fluorescent group.

Wherein the label is on one oligonucleotide of said probe, either said first oligonucleotide or said second oligonucleotide.

Wherein the one or more pairs of forward/reverse oligonucleotide primers may comprise one 5' tail in the same order.

Wherein the reaction system may contain a universal primer which may comprise a 5' tail of the same order as the forward/reverse oligonucleotide primer.

15-150 nucleotides of a first oligonucleotide, and at least one 4-150 nucleotides of a second oligonucleotide;

wherein each probe comprises a detectable label or a combination of detectable labels capable of producing a variable signal indicative of the presence or absence of a double stranded portion between said first and second oligonucleotides of the probe.

In this embodiment, the first oligonucleotide of the probe functions as a primer. In one primer extension reaction, a mixture of probes is added to a reaction mixture containing all of the components for extension under extension conditions. If a specific target nucleic acid is present in the reaction, the oligonucleotide of the corresponding probe hybridizes to the target sequence and is then extended and incorporated into the primer extension product and is therefore consumed. The consumed oligonucleotides can no longer participate in forming the double stranded portion of the probe. In melting profile analysis, the consumed probe appears as a decrease or disappearance of one peak.

The amplification reaction may be any amplification method, such as PCR, SDA, NASBA, LAMP,3SR,ICAN,TMA, helicase dependent isothermal DNA amplification and the like. PC R is a preferred method of amplification.

An amplification primer may be a target-specific primer comprising a 3' initiation portion complementary to a target region of a target nucleic acid. The amplification primer may also be a universal primer having the same or substantially the same sequence as the 5' universal portion of the target-specific primer. The reaction may include a plurality of primers for amplification of a plurality of target sequences. The 5 'universal portion of the plurality of primers may have a substantially identical sequence composition that is identical or substantially identical to the 3' initiation portion of the universal amplification primer. Preferably, the primers are DNA primers, particularly those suitable for PCR amplification.

The amplification reaction mixture includes primer pairs consisting of forward and reverse primers such that if a target nucleic acid is present in the sample, the primer pairs will amplify the target nucleic acid, preferably in an exponential manner.

The amplification reaction mixture contains one probe set composed of two or more probes. The probe comprises:

The first oligonucleotide must be capable of binding to a portion of at least one of the target nucleic acids under suitable hybridization conditions. Preferably, each first oligonucleotide is specific for a portion of only one target nucleic acid. The first oligonucleotide should have a first region with a nucleotide sequence that is complementary or substantially complementary to a nucleotide sequence of a portion of a target nucleic acid. The length of this first complementary region is preferably 6 to 100 nucleotides, more preferably 15 to 30 nucleotides. The total length of the first oligonucleotide is preferably 15 to 150 nucleotides, more preferably 17 to 100 nucleotides, most preferably 20 to 80 nucleotides.

In some embodiments where the reaction includes primer extension or amplification, the portion of the target nucleic acid that is complementary to the first oligonucleotide must belong to or overlap with the sequence to be amplified by the forward and reverse primers. Alternatively, the first oligonucleotide may be one of the amplification primers, for example a forward or reverse primer. In some embodiments, the first and/or second oligonucleotide is not a forward or reverse primer.

The second oligonucleotide comprises a region substantially complementary to a second region of the first oligonucleotide. The length of this second region is preferably 4 to 100 nucleotides, more preferably 15 to 30 nucleotides. The second region of the first oligonucleotide may or may not overlap with the first region of the first oligonucleotide. The total length of the second oligonucleotide is preferably 6 to 150 nucleotides, more preferably 10 to 100 nucleotides, most preferably 12 to 80 nucleotides. The first and second oligonucleotides may comprise 1 to 5 or 1 to 10 or more nucleotides at the 5 'or 3' end that are not complementary to the target nucleic acid or the first oligonucleotide, respectively.

In some embodiments of the invention, the first region of the first oligonucleotide does not overlap or does not overlap sufficiently with the second region of the first oligonucleotide.

In other embodiments of the invention, the first region of the first oligonucleotide substantially overlaps with the second region of the first oligonucleotide or the second region is comprised in the first region. In these embodiments, the first oligonucleotide hybridizes to the target sequence to form a duplex T _m Preferably above T of the duplex formed by hybridization of said first oligonucleotide with said second oligonucleotide _m Thus, if a target nucleic acid is present, the first oligonucleotide forms a stronger hybrid with the target nucleic acid and melts at a higher temperature than the first/second oligonucleotide duplex.

At least one probe of the invention is capable of forming a double stranded portion. Because of this double-stranded portion, the probe has a melting temperature T _m And a characteristic melting profile. In particular, a mixture of probes of the invention also has a characteristic melting profile.

According to the present invention, by designing a probe set composed of probes hybridized with different target sequences and probes having different melting temperatures based on double-stranded portions inside thereof, it is possible to analyze a plurality of target nucleic acid sequences in a single tube. If a target sequence is present, its corresponding probe is consumed. The sequence of the target can then be determined based on a comparison between the melting profiles of the probe sets before and after the reaction. Advantageously, different probes in a probe set can be associated with the same label, allowing monitoring at a single emission wavelength. In one embodiment, each probe in the set of probes is associated with the same label, e.g., a fluorescent energy transfer pair or a contact quenching pair, more particularly, a first label that is a fluorescent group and a second label that is a quencher. Alternatively, multiple probe sets may be associated with different pairs of labels, such that each probe set is distinguishable from the others based on different emission spectra.

According to the present invention, the method of analyzing a plurality of target nucleic acids may utilize a mixture of a plurality of probes associated with different labels having distinguishable emission spectra, or a mixture of a plurality of probes associated with labels having identical or overlapping emission spectra, but distinguishable based on differences in melting temperatures of the double-stranded portions within them.

The first oligonucleotide of the probe containing a double-stranded portion can be consumed during amplification. Alternatively, both the first and second oligonucleotides of the probe containing double stranded portions can be consumed during the amplification process. Preferably, the first oligonucleotide is designed to be consumed in one reaction, while the second oligonucleotide may remain unchanged.

Each probe comprises a detectable label that produces a variable signal that reflects the presence or absence of the double-stranded portion of the probe.

At least two probes in the amplification reaction mixture comprise the same detectable label or a different detectable label whose emission spectra are indistinguishable.

In multiplex reactions, two or more probes are used to detect the presence of two or more target nucleic acids. However, this does not necessarily mean that each different probe needs to have a different distinguishable label. Each probe may have a unique melting profile that depends on the characteristics of its internal double stranded portion. Thus, if two or more probes have distinguishable melt characteristics, the same label can be used for these probes. That is, different probes labeled with the same label or with labels whose emission spectra are indistinguishable must have different melting characteristics.

As used herein, the term "melting characteristics" includes the melting profile of the probe (preferably measured by measuring the signal from a label on the probe as a function of temperature) and/or the melting temperature (T _m )。

The melting temperature (T) of probes having the same label or different labels whose emission spectra are indistinguishable _m ) The melting temperatures of the probes and the like labeled are generally different from each other. In one embodiment, a plurality of probes in a probe set are each labeled with the same label (or with different labels whose emission spectra are indistinguishable), and each probe has a unique melting temperature range. In one multiplex assay, the reaction temperature has the lowest T when it is increased from the hybridization temperature to a denaturation temperature _m The probe duplex of (a) melts first, the probe duplex with the next lowest Tm separates second, and the probe duplex with the highest T _m Finally denatured probe duplex of (a). At the same time, due to the progressive melting of the probe duplex, the fluorescence emission of the label associated with the probe changes in proportion to the progressively increasing reaction temperature, allowing each probe to be distinguished in the combined melting profile. The shape and position of the melting curve is a function of the GC/AT ratio, length and sequence of the double stranded portion of the probe.

Preferably, the Tm of a probe having the same label or a different label whose emission spectrum is indistinguishable from that of other similarly labeled probes _m There is a difference of at least 2 ℃, preferably at least 3 ℃,4 ℃ or 5 ℃.

Sample group system:

control group system:

amplification procedure:

it should be understood that the expression "one or more of … …" individually includes each of the objects recited after the expression and various combinations of two or more of the recited objects unless otherwise understood from the context and usage. The expression "and/or" in combination with three or more recited objects should be understood as having the same meaning unless otherwise understood from the context.

The use of the terms "comprising," "having," or "containing," including grammatical equivalents thereof, should generally be construed as open-ended and non-limiting, e.g., not to exclude other unrecited elements or steps, unless specifically stated otherwise or otherwise understood from the context.

It should be understood that the order of steps or order of performing certain actions is not important so long as the invention remains operable. Furthermore, two or more steps or actions may be performed simultaneously.

The use of any and all examples, or exemplary language, such as "e.g." or "comprising" herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Furthermore, the numerical ranges and parameters setting forth the present invention are approximations that may vary as precisely as possible in the exemplary embodiments. However, any numerical value inherently contains certain standard deviations found in their respective testing measurements. Accordingly, unless explicitly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used in this disclosure are modified by "about". As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.

In example 1 of the present invention, all primers used were synthesized by EUROGENTEC, and all materials and reagents used were commercially available.

The invention is further illustrated by the following examples:

example 1

(1) Amplification primers and probes designed according to the gene order of the human after sulfite treatment were as follows:

Probe 1-Chrysan10Fam: CAACCGAAATTCCCCAACGCCCCCT (SEQ ID NO: 1);

second oligonucleotide 1-Chrysan10Dab: CGTTGGGGAATTTCGGTTG (SEQ ID NO: 2);

probe 2-WING11FAM: CGCCCGCGCTCCGAACGACTC (SEQ ID NO: 3);

second oligonucleotide 2-WING11Dab: GAGTTCGGAGCGCGGGCG (SEQ ID NO: 4);

forward primer 1-Chrysan10F: GGTTTCGTTTTTGTTTACGCGCG (SEQ ID NO: 5);

reverse primer 1-Chrysan10R: CTAAAAAACCCGAACCAAAACGC (SEQ ID NO: 6);

forward primer 2-WING11F: GATTTTTTAGTTTTCGGAGTTTCGCG (SEQ ID NO: 7);

reverse primer 2-WING11R: CCTAACGACGAAAACTTCC (SEQ ID NO: 8).

(2) The probe Chrysan10Fam (first oligonucleotide) is FAM-labeled at its 5' end. The Chrysan10Dab (second oligonucleotide) comprises DABCYL at its 3' end. Chrysan10Fam and Chrysan10Dab are capable of forming double stranded portions as follows:

fam-:5'CAACCGAAATTCCCCAACGCCCCCT 3' (as shown in SEQ ID NO: 1);

DABCYL-:3'GTTGGCTTTAAGGGGTTGC 5' (shown as SEQ ID NO: 9).

Such hybrids are referred to above as probe Chrysan10.

(3) The probe WING11FAM (first oligonucleotide) is FAM-labeled at its 5' end. The WING11Dab (second oligonucleotide) comprises DABCYL at its 3' end. The WING11FAM and the WING11Dab can form a double-stranded portion as follows:

Fam-:5'CGCCCGCGCTCCGAACGACTC 3' (shown as SEQ ID NO: 3);

DABCYL-:3'GCGGGCGCGAGGCTTGAG 5' (shown as SEQ ID NO: 10).

The above hybrid is called probe WING11.

The first oligonucleotide and the second oligonucleotide are combined in various ratios, typically 1:3, to form a partially double-stranded linear DNA probe.

The formation of the first and second oligonucleotide hybrids in the absence of the target nucleic acid draws the quencher and the fluorophore in close proximity, effectively quenching the fluorescent signal. The first oligonucleotide preferentially hybridizes to the target sequence and is incorporated into the amplicon when the target nucleic acid is present. As a result, the quencher is separated from the fluorophore, resulting in an increase in fluorescence emission.

Primer pairs Chrysan10F and Chrysan10R amplify a 86bp product in the presence of a Chrysan10 target sequence. WING11F and WING11R amplify a 108bp product in the presence of a WING11 target sequence.

As shown in FIG. 1, according to the conventional qPCR, a primer group corresponding to the detection genes and first and second oligonucleotides are added, and a plurality of groups of detection genes (different genes, different Tms of the first and second oligonucleotides) can be added in the same channel, and a group of NTC controls without templates are arranged at the same time; performing conventional qCPR detection to obtain an amplification curve of each channel; after the conventional amplification cycle is completed, a melting curve analysis step is added to obtain a melting curve analysis result of the first and second oligonucleotides, and the melting curve analysis result is compared with the NTC to obtain multiple results by combining amplification target information with an amplification curve and a melting curve.

Under the same fluorescent channel condition, the co-detection of two markers is realized, and different probe pairs are utilized to realize Tm distinction of different targets, so that amplification confirmation of all targets on an amplification curve and confirmation of specific targets on a melting curve are realized.

Example 2

TABLE 1

The system in Table 1 illustrates:

(1) A forward primer 1, a reverse primer 1, a probe 1 and a second oligonucleotide 1 are a detection probe combination of a marker;

(2) A forward primer 2, a reverse primer 2, a probe 2 and a second oligonucleotide 2 are detection probe combinations of another marker;

(3) Probe 1 and probe 2 bear the same fluorescent group, such as FAM, but may be other same groups;

(4) Probe 1 forms a double strand with the second oligonucleotide 1, has a specific Tm value = 38.93 ℃, and a fluorescence result is obtained in the melting curve;

(5) Probe 2 forms a double strand with the second oligonucleotide 2, has a specific Tm value = 53.9 ℃, and a fluorescence result is obtained in the melting curve;

(6) The Tm of the two combinations should be separable.

TABLE 2

System description of table 2:

the control group serves to provide a control in which one probe binds to the second oligonucleotide and the probe is not consumed (since no template can be amplified and thus the probe is not consumed).

TABLE 3 Table 3

As shown in FIG. 2, the lower amplification curve portion, which is the result of the control group, has no amplification curve, i.e., no Ct value, because no template was added; in the melting peak curve above, since the probe is not consumed without amplification in the system, the double strand formed by the second oligonucleotide corresponding to the probe gives one melting peak (corresponding to Tm is visible) in the melting curve program, and two markers have two different Tm peaks.

As shown in fig. 3, the experimental results are shown in fig. 3, and the lower amplification curve part has an amplification curve with specific Ct value, but it is unclear which marker is amplified or both markers are amplified; the melting peak curve above shows a sharp decrease in peak corresponding to the first Tm, meaning that the probe of this marker is consumed, i.e., amplified, and the double-stranded portion of the probe and the second oligonucleotide is reduced, resulting in a decrease in melting peak.

As shown in fig. 4, which shows the results of the control group combined with the results of the sample group, it is apparent that the first marker was decreased by the melting peak curve due to amplification, while the second marker remained the same as the control, i.e., was not amplified.

Example 3

As shown in FIG. 5, the sequence was the same as in example 1, the reaction system and conditions were the same as in example 2, and the results of this control group and the other sample group were combined together to form a graphic representation, and it is apparent that the first marker and the second marker were decreased in the melting peak curve due to amplification, that is, both markers were amplified.

Example 4

As shown in FIGS. 6 to 8, the different fluorophores, here 3 markers, were detected together, i.e., 3 pairs of primers (as shown in Table 4) were present in the same reaction system, 3 pairs of first oligonucleotides and second oligonucleotides, each oligonucleotide corresponding to a different melting peak, and 3 control peaks were seen in the melting curve.

Chrysan7HEX: CGCGCACCTCTCGACCGCCTC (SEQ ID NO: 11);

chrysan7Dab: GAGGCGGTCGAGAGGT (SEQ ID NO: 12);

WING3HEX: CTACCGCTCCCGACAACTATCCGC (SEQ ID NO: 13);

WING3Dab: GCGGATAGTTGTCGGGAGCG (SEQ ID NO: 14);

chrysan11HEX: CGCCCGCGCTCCGAACGACTC (SEQ ID NO: 15);

chrysan11Dab: GAGTCGTTCGGAGCGCGGG (SEQ ID NO: 16);

chrysan7F: TTTCGTTTTTTGTATCGGAGTAGCG (SEQ ID NO: 17);

Chrysan7R: TACCCCGCAACCGACTC (as shown in SEQ ID NO: 18);

WING3F: GTTCGTTAGTTTCGTTATAGGATCG (SEQ ID NO: 19);

WING3R: AATACCTACGTCCCCGATC (shown as SEQ ID NO: 20)

Chrysan11F: GATTTTTTAGTTTTCGGAGTTTCGCG (SEQ ID NO: 7);

chrysan11R: CCTAACGACGAAAACTTCC (SEQ ID NO: 8).

TABLE 4 Table 4

TABLE 5

/>

The experimental results are shown in FIG. 6, and examples of the sample group and the control group (the system is shown in Table 5) show that only the marker of the 3 rd peak was not amplified, and that both 1 and 2 were amplified.

The experimental results are shown in FIG. 7, which shows that all 3 markers were amplified.

As shown in FIG. 8, only the marker corresponding to the peak 2 was amplified, and the markers corresponding to the peaks 1 and 3 were not amplified.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. A probe, comprising:

2. The probe of claim 1, further comprising a label; the label includes a fluorescent reporter group and/or a quencher group.

3. A test kit comprising a probe according to claim 1 or 2 and an acceptable adjuvant or carrier.

4. Use of a probe according to claim 1 or 2 or a detection kit according to claim 3 for detecting methylation of a target nucleic acid.

5. The method for detecting methylation of target nucleic acid is characterized in that the pretreated target nucleic acid is mixed with an amplification reactant and amplified to obtain the methylation state of the target nucleic acid;

6. The method of claim 5, wherein the pretreatment is chemical or enzymatic to convert unmethylated cytosine to uracil.

7. The method of claim 5 or 6, wherein the oligonucleotide primer comprises an identical 5' tail.

8. The detection method according to any one of claims 5 to 7, wherein the amplification comprises at least two steps of denaturation, annealing and primer extension.

9. The detection method according to any one of claims 5 to 8, wherein the amplification comprises the steps of: