CN116121165A

CN116121165A - Preparation method of novel inhalable anthrax component vaccine based on bacillus anthracis mutant strain

Info

Publication number: CN116121165A
Application number: CN202310151539.6A
Authority: CN
Inventors: 吕蒙; 胡凌飞; 周冬生; 高波; 邱业峰; 杨文慧; 翟丽娜; 王岩
Original assignee: Academy of Military Medical Sciences AMMS of PLA
Current assignee: Academy of Military Medical Sciences AMMS of PLA
Priority date: 2023-02-10
Filing date: 2023-02-10
Publication date: 2023-05-16

Abstract

The invention discloses a preparation method of a novel inhalable anthrax component vaccine based on a bacillus anthracis mutant strain, and relates to the technical field of immunology. The invention provides a mutant strain of bacillus anthracis and a mutant strain A16R-5.1 with deletion of 6 extracellular protease activity related genes. The invention utilizes the anthrax culture supernatant prepared by the mutant strain A16R-5.1 to extract vaccine, can induce strong humoral, cellular and mucosal immune response after immunization, can resist the invasion of anthrax spores, and in-vitro experiments show that anthrax toxin can be neutralized.

Description

Preparation method of novel inhalable anthrax component vaccine based on bacillus anthracis mutant strain

Technical Field

The invention belongs to the technical field of immunology, and particularly relates to a preparation method of a novel inhalable anthrax component vaccine based on a bacillus anthracis mutant strain.

Background

Bacillus anthracis is the causative agent of the acute infectious disease, anthrax, which is a zoonotic disease, and has two forms, namely a propagule and a spore. Anthrax has extremely strong resistance to conditions such as drying, chemical disinfectants and the like, and is easy to prepare. Human anthrax is clinically classified into skin anthrax, gastrointestinal anthrax, inhalational anthrax, and injectable anthrax according to different infection pathways of bacillus anthracis, wherein inhalational anthrax is the most serious clinical type, and the treatment mortality rate is not nearly 100%. Inhalation anthrax can be transmitted not only through natural pathways, but also by the attack of artificially produced anthrax biological weapons, and therefore, it is important to develop a safe and efficient anthrax vaccine.

There are two approved human anthrax vaccines. Firstly, live attenuated anthrax vaccines consist of nontoxic spores of the Russian STI-1 strain and the Chinese A16R strain, respectively, but their use is limited due to the risk of infection and adverse reactions of injection. Secondly, cell-free culture supernatant vaccines with protective antigens as the main component, including Anthrax Vaccine Adsorbents (AVA) in the united states and Anthrax Vaccine Precipitants (AVP) in the united kingdom, but repeated subcutaneous injections throughout the year and yearly booster injections produce local and even systemic side effects. Most importantly, no study except AVA could demonstrate that the three anthrax vaccines described above provide complete protection against fatal lung anthrax. And needleless vaccination is becoming increasingly popular and appreciated in the vaccination format. Nevertheless, there is no commercial lung vaccine against inhalation anthrax, and therefore it is essential to develop a vaccine that can be used for inhalation anthrax prevention and treatment.

Disclosure of Invention

The invention aims to provide a preparation method of a novel inhalable anthrax component vaccine based on a bacillus anthracis mutant strain, which has good safety and immune protection effect on fatal pulmonary anthrax and can be used for preparing various different types of vaccines, in particular inhalable vaccines.

The invention provides a mutant strain of bacillus anthracis (Bacillus anthracis), which comprises a strain obtained by knocking out a plurality of extracellular protease activity related genes in bacillus anthracis A16R.

Preferably, the gene related to extracellular protease activity includes at least one of the following: nprR, mmzp, inhA1, tasA, gbaa_2860 and lef.

The invention provides a mutant strain A16R-5.1 of bacillus anthracis (Bacillus anthracis), and the preservation number of the mutant strain A16R-5.1 is CGMCC NO.26476.

The invention also provides a construction method of the mutant strain A16R-5.1, which comprises the following steps: taking bacillus anthracis A16R as a basic strain, and sequentially knocking out nprR, mmzp, inhA1, tasA and GBAA_2860 in bacillus anthracis A16R to obtain a mutant strain A16R-5;

the mutant strain A16R-5.1 is obtained by taking the mutant strain A16R-5 as a basic strain and knocking out the lef gene encoding the lethal factor.

Preferably, the knockout includes knockout of the upstream homology arms at positions 1 to 726 of the sequence shown in SEQ ID NO.1 and the downstream homology arms at positions 1 to 778 of the sequence shown in SEQ ID NO.2 in nprR;

knocking out an upstream homology arm of 1 st to 795 th sites of a sequence shown as SEQ ID NO.3 and a downstream homology arm of 1 st to 791 st sites of a sequence shown as SEQ ID NO.4 in mmzp;

knocking out an upstream homology arm of 1 st to 781 st positions of a sequence shown in SEQ ID NO.5 and a downstream homology arm of 1 st to 760 rd positions of a sequence shown in SEQ ID NO.6 in inhA 1;

knocking out an upstream homology arm at 1 st to 807 th positions of a sequence shown in SEQ ID NO.7 and a downstream homology arm at 1 st to 799 th positions of a sequence shown in SEQ ID NO.8 in tasA;

knocking out an upstream homology arm of 1 st to 794 th sites of a sequence shown as SEQ ID NO.9 and a downstream homology arm of 1 st to 789 th sites of a sequence shown as SEQ ID NO.10 in GBAA_2860;

knocking out the upstream homology arms of SEQ ID NO.11 and SEQ ID NO.12 at positions 1-764 in the lef.

The invention also provides application of the mutant strain or the mutant strain A16R-5.1 in preparing products for preventing and/or treating diseases caused by bacillus anthracis.

Preferably, the product for preventing and/or treating bacillus anthracis-induced disease comprises an anthrax culture supernatant extract vaccine.

The invention also provides a preparation method of the anthrax culture supernatant extraction vaccine, which comprises the following steps: inoculating the mutant strain A16R-5.1 into RM culture medium for culturing, collecting supernatant of the culture, and concentrating to obtain supernatant concentrated sample.

The invention also provides an anthrax culture supernatant extraction vaccine prepared by the preparation method.

Preferably, the dosage form of the anthrax culture supernatant extraction vaccine comprises a liquid or dry powder inhalant.

The beneficial effects are that: the invention provides a mutant strain of bacillus anthracis, which is obtained by taking bacillus anthracis attenuated strain A16R as a basic strain and knocking out a plurality of extracellular protease activity related genes, and simultaneously provides a mutant strain A16R-5.1 which is sequentially knocked out nprR, mmzp, inhA, tasA, GBAA_2860 and lef, and the embodiment proves that the toxicity of the mutant strain A16R-5.1 is greatly reduced compared with that of the existing vaccine strain A16R, no antibiotic resistance mark exists, the protective antigen can be stably expressed, the strain can be used for preparing an anthrax culture supernatant extraction vaccine with good safety and immunogenicity, is suitable for direct administration in lung, can induce organisms to produce humoral, cellular and mucosal immunity, can effectively resist the killing effect of anthrax toxin, and can resist the infection and progress of bacillus anthracis.

Biological preservation information

Bacillus anthracis (Bacillus anthracis) with the strain number of A16R-5.1 is preserved in China general microbiological culture Collection center (CGMCC) for 1 month 13 of 2023, and the preservation address is China national academy of sciences of China, no.1 and No.3 of the Korean region of Beijing, china, and the preservation number is CGMCC No.26476.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the drawings that are needed in the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a graph showing the results of PCR identification of mutants of Bacillus anthracis having low proteolytic activity;

FIG. 2 is a graph showing the result of Westernblot analysis of supernatants of culture of a plurality of Bacillus anthracis low proteolytic activity mutants using mouse anti-PA polyclonal antibody, using SDS-PAGE as loading control;

FIG. 3 is a graph showing the result of Westernblot analysis of supernatants of A16R-5 and A16R-5.1 strain cultures using mouse anti-PA polyclonal antibodies, using SDS-PAGE as a loading control;

FIG. 4 is a graph showing the survival rate results of intratracheal aerosolized vaccinated A16R-5 and A16R-5.1 immunized mice;

FIG. 5 is a graph showing the results of Western blot analysis of a solution obtained by re-dissolving an anthracnose culture supernatant extract vaccine dry powder inhalant and an anthracnose culture supernatant extract vaccine liquid inhalant using a mouse anti-CSE polyclonal antibody, using SDS-PAGE as a loading control;

FIG. 6 is a graph showing the results of ELISA analysis of the immunogenicity of a solution of an anthrax culture supernatant extraction vaccine dry powder inhalant reconstituted and an anthrax culture supernatant extraction vaccine liquid inhalant using a mouse anti-CSE polyclonal antibody;

FIG. 7 is a scanning electron microscope image of an anthrax culture supernatant extracted vaccine dry powder;

FIG. 8 shows the immunity B10.D2-Hc ⁰ A survival condition result graph of mice after toxin attack;

FIG. 9 shows the immunity B10.D2-Hc ⁰ Results of mouse serum IgG antibody titer;

FIG. 10 shows the immunity B10.D2-Hc ⁰ Results of mouse serum IgG1 antibody titer;

FIG. 11 shows the immunity B10.D2-Hc ⁰ Results of mouse serum IgG2a antibody titer;

FIG. 12 shows the immunity B10.D2-Hc ⁰ Results of mouse serum IgG2a/IgG1 antibody titer plots;

FIG. 13 shows the immunity B10.D2-Hc ⁰ Mouse lung homogenate IgG antibody titer results plot;

FIG. 14 shows the immunity B10.D2-Hc ⁰ Results of IgA antibody titers in mouse lung homogenates.

Detailed Description

The gene related to extracellular protease activity of the present invention preferably includes at least one of the following: nprR, mmzp, inhA1, tasA, gbaa_2860 and lef. The method of knocking out the gene related to the extracellular protease activity is not particularly limited, and preferably includes gene knockout by using a CRISPR/Cas9 system.

The mutant strain A16R-5.1 is a strain based on bacillus anthracis A16R, and after nprR, mmzp, inhA, tasA and GBAA_2860 genes are knocked out in sequence, the lef gene encoding a lethal factor is knocked out, so that the mutant strain A16R-5.1 is obtained.

In the invention, on the basis of bacillus anthracis A16R, the nprR, mmzp, inhA1, tasA and GBAA_2860 genes are knocked out in sequence, namely, on the basis of A16R, the nprR is knocked out to obtain a mutant strain named A16R-1; knocking out mmzp on the basis of A16R-1 to obtain A16R-2; knocking out inhA1 on the basis of A16R-2 to obtain A16R-3; knockout of tasA based on a16R-3 to yield a16R-4; on the basis of A16R-4, GBAA_2860 is knocked out to obtain A16R-5; taking the safety of the strain into consideration, the lef gene encoding the lethal factor is knocked out on the basis of A16R-5 to obtain A16R-5.1. The knockout according to the invention preferably comprises: knocking out the upstream homology arms of the 1 st to 726 th positions of the sequence shown in SEQ ID NO.1 and the downstream homology arms of the 1 st to 778 th positions of the sequence shown in SEQ ID NO.2 in nprR;

knocking out the upstream homology arms of the 1 st to 815 th sites of the sequence shown in SEQ ID NO.11 and the downstream homology arms of the 1 st to 764 th sites of the sequence shown in SEQ ID NO.12 in lef;

the invention preferably uses a CRISPR/Cas9 system to perform gene knockout, and the gene knockout methods at all stages are the same, and the method for knocking out the extracellular protease activity related genes in the carbon cellulitis bacillus A16R preferably comprises the following steps:

the vector was constructed using anthrax A16R genomic DNA as a template and the fragments were inserted into the SalI and XbaI sites of pJOE 8999. The plasmid is digested by BsaI, the digested plasmid with large fragment is connected with small double-stranded DNA, competent DH5 alpha is transformed, plasmid is extracted after overnight culture, and the correct plasmid is obtained by sequencing and identification; connecting the upstream homology arm and the downstream homology arm fragments expressing a certain protease coding gene with a plasmid with gRNA, transforming competent DH5 alpha, and culturing overnight; performing enzyme digestion identification on the recombinant plasmid, converting E.coli SCS110, and introducing bacillus anthracis A16R through electroporation after sequencing identification to obtain intermediate bacteria A; intermediate bacterium A transformants were selected on BHIG medium containing kanamycin (25. Mu.g/ml) at 30 ℃. Single colonies were inoculated into liquid medium supplemented with 25. Mu.g/ml kanamycin, shake-cultured at 37℃for 3h, and then mannose was added at a final concentration of 0.4% to induce expression of Cas9 protein. After further culturing for 3 hours, the cultures were serially diluted and inoculated on LB agar containing 25. Mu.g/ml kanamycin and 0.4% mannose, and incubated overnight at 37 ℃. And (3) subculturing the intermediate bacterium A to ensure that the plasmid pJOE8999 is lost, so as to obtain the recombinant bacterium A for knocking out the related genes of the specific protease codes. And (3) sequentially knocking out the related genes coded by the next specific protease in the recombinant bacterium A according to the method to obtain the recombinant bacterium B. This was followed until mutant strain A16R-5.1 was obtained.

The product for preventing and/or treating the diseases caused by bacillus anthracis preferably comprises an anthrax culture supernatant extraction vaccine. Compared with the existing vaccine strain A16R, the toxicity of the A16R-5.1 strain is greatly reduced, no antibiotic resistance mark exists, and the protective antigen can be stably expressed. The low protease deletion mutant strain constructed by the invention lays a foundation for the research of novel anthrax vaccines.

The culture method also preferably comprises four processes of strain activation, preculture, drip plate transfer and formal culture of the A16R-5.1, wherein the strain activation preferably comprises the following steps: resuscitates A16R-5.1 glycerol strain using LB solid medium plate streaking, and places the strain in a constant temperature incubator at 37℃overnight. The preculture according to the present invention preferably comprises picking single colonies from LB solid medium A16R-5.1, inoculating them into BHI liquid medium containing 5mL, shaking culture at 37℃for 9h (mid-log phase) at 220rpm. The invention carries out drip plate transfer after the preculture, and specifically comprises the steps of respectively inoculating 10 mu L of preculture bacteria liquid onto LB solid medium containing 1% skimmed milk powder, and placing the solid medium in a constant temperature incubator at 37 ℃ for overnight culture. The invention carries out formal culture after the drip plate is switched, and concretely comprises the steps of scraping all bacterial colonies on the A16R-5.1 strain drip plate, transferring the bacterial colonies into a centrifuge tube containing 20mL RM culture medium, shaking and uniformly mixing, taking 50 mu L of bacterial liquid for 10-time dilution, and then measuring OD ₆₀₀ Value, OD ₆₀₀ When =0.45, the inoculum size was fixed at 0.5mL, and transferred to an Erlenmeyer flask containing 500mL RM medium, shake-cultured at 37℃for 12 hours at a rotation speed of 110rpm. The RM medium of the present invention preferably comprises a solute comprising the following mass percent: glucose 5g/L, KH ₂ PO ₄ 0.46 g/L、NaHCO ₃ 8g/L、NaCl 2.92g/L、Tris 9.06g/L、KCl 3.7g/L、L-tryptophan 35mg/L、L-glycine65mg/L、L-cysteine 25mg/L、L-tyrosine 144mg/L、L-valine 173mg/L、L-leucine230mg/L、L-isoleucine 170mg/L、L-threonine 120mg/L、L-methionine 73mg/L、L-aspartic acid 184mg/L、L-sodium glutamate 612mg/L、L-proline 43mg/L、L-serine 235mg/L、L-phenylalanine 125mg/L、L-lysine 230mg/L、L-histidine hydrochloride 55mg/L、L-arginine hydrochloride 125mg/L、CaC1 ₂ ·2H ₂ 07.4 mg/L、MgSO ₄ ·H ₂ 09.9 mg/L、MnSO ₄ ·H ₂ O0.9 mg/L, uracil 1.4.1.4 mg/L, adenine sulfate 2.1mg/L and thiamine-hydrochloride 1.0mg/L. Dissolution of RM Medium according to the inventionThe agent is preferably ultrapure water.

After the main culture, collecting the supernatant of all the obtained cultures containing thalli, centrifuging, filtering and sterilizing to obtain the anthrax culture supernatant without thalli and fragments. The centrifugation according to the invention preferably comprises transferring all the bacterial liquids of A16R-5.1 into 500mL centrifuge bottles, centrifuging to collect the supernatant at 8000rpm for 15min. The filtering and sterilizing process preferably comprises the steps of filtering and sterilizing the supernatant by using a vacuum pump through a filtering device, removing residual thalli and fragments, and storing in a refrigerator at the temperature of 4 ℃. In the invention, the whole process of collecting and sterilizing the supernatant of the A16R-5.1 needs an ice bath to prevent protein degradation.

The invention concentrates the collected and sterilized supernatant, wherein the concentration process of the supernatant needs whole ice bath to prevent protein degradation, and the concentration preferably comprises the following steps:

(1) Film package assembling and cleaning: assembling a membrane package, namely filling 500mL of deionized water into a sample bottle, opening a constant flow pump to pump liquid through the system, wherein the pump speed is 200-400mL/min so as to remove any air bag, and checking whether a pipeline connecting point has leakage;

(2) After the step (1) is completed, placing a supernatant sample into an ice bath, pumping the sample into a VIVAFLOW 200 tangential flow ultrafiltration membrane bag by a constant flow pump for ultrafiltration concentration, intercepting Mr 10000 by the membrane bag, placing the filtered supernatant into a sample bottle, fixedly connecting a sample outlet pipe to a lower outlet of the side wall of the membrane bag by the constant flow pump, modulating the flow rate by 290rpm, connecting one end of an upper outlet with a pressure meter, connecting the other end with a sample inlet pipe, connecting a filtrate to a pipeline of the upper wall of the membrane bag, opening a switch of the constant flow pump, and concentrating at 4 ℃ to obtain concentrated supernatant;

(3) After the step (2) is completed, concentrating the supernatant to about 20mL, adding 500mL of physiological saline with the temperature of 4 ℃ into a sample bottle, ultrafiltering again, and removing redundant culture medium components in the concentrated supernatant;

(4) After the step (3) is completed, the supernatant is concentrated to about 30mL and then is transferred to a 10KD ultrafiltration concentration centrifuge tube, the rotating speed is 6500rpm, and the time is 10min;

(5) After the step (4) is completed, uniformly mixing concentrated samples of the same strain, and storing the concentrated samples in a refrigerator at the temperature of-80 ℃ for standby.

In the invention, the anthrax culture supernatant extraction vaccine is preferably prepared by uniformly controlling the quality of concentrated samples of different batches through a multi-batch preparation process, and mixing the samples with the most stable content of the screened protective antigen.

The dosage form of the anthrax culture supernatant extraction vaccine comprises a liquid agent or a dry powder inhalant, wherein the liquid agent vaccine is a lung delivery vaccine; the bacillus anthracis vaccine dry powder inhalant is prepared by a spray freeze drying technology through extracting a vaccine liquid preparation from bacillus anthracis culture supernatant, and the dry powder inhalant vaccine is a lung delivery vaccine.

For further explanation of the present invention, the preparation of the novel inhalable anthrax component vaccine based on a bacillus anthracis mutant strain according to the present invention will be described in detail with reference to the accompanying drawings and examples, which should not be construed as limiting the scope of the present invention.

The experimental methods in the embodiment of the invention are conventional methods unless otherwise specified. The test materials used in the examples of the present invention, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.

Anthrax rPA protein: list Biological laboratories inc company, cat No.: 171E.

Anthrax lethal toxin lethal factor LF: list Biological laboratories inc company, cat No.: 169L.

CpG, which is called Class B CpG oligonucleotide (B class CpG oligonucleotide), has immune activation function, is an immunostimulant for human or mouse TLR9, and is a typical mucosal immunoadjuvant. The CpG used in the examples is the product of Invivogen company under the product catalog number tlr1-2006-5 with the website chain: https:// www.invivogen.com/odn2006.

Anthrax Pasteur II strain: reference is made to: liang X, zhang H, zhang E, et al identification of the pXO1 plasmid in attenuated Bacillus anthracis vaccine strains [ J ]. Virulence,2016,7:578-586.Mikesell P,Ivins BE,Ristroph JD,Dreier TM.Evidence for Plasmid-Mediated Toxin Production in Bacillus Anthracis. Infect Immun (1983) 39 (1): 371-6. Public are available from the national institute of civil release military science, the medical institute of military.

Tangential flow film package: vivaflow 200, sartorius, germany.

Example 1

1. Construction and characterization of anthrax Low protease mutant strains

TABLE 1 plasmids used in the construction of mutant strains according to the invention

/>

Multiple extracellular protease activity-related genes in bacillus anthracis a16R, including nprR, mmzp, inhA, tasA, gbaa_2860 and lef, were deleted successively using the CRISPR (Cas) 9 system, and a first gene editing plasmid was constructed and introduced by electroporation of bacillus anthracis a 16R.

1) Sequence information of the relevant gene, including the coding region and the region of about 1kb upstream and downstream, was obtained from the genomic sequence of Genbank.

2) The target sequence of the sgRNA was designed using an in-line tool (https:// sg. Idtdna. Com/site/order/design/index/CRISPR_CUSTOM) and the relevant ssDNA annealed to form a double strand.

nprR-F(SEQ ID NO.13)：tacgACACAAGAAGAATTATGTCA

nprR-R(SEQ ID NO.14)：aaacTGACATAATTCTTCTTGTGT

inhA1-F(SEQ ID NO.15)：tacgAAGTTAACACGAATCATACC

inhA1-R(SEQ ID NO.16)：aaacGGTATGATTCGTGTTAACTT

tasA-F(SEQ ID NO.17)：tacgTCTTTTTCAACTGTATCACC

tasA-R(SEQ ID NO.18)：aaacGGTGATACAGTTGAAAAAGA

mmzp-F(SEQ ID NO.19)：tacgATAGGAATAGGTCACAACAG

mmzp-R(SEQ ID NO.20)：aaacCTGTTGTGACCTATTCCTAT

GBAA_2860-F(SEQ ID NO.21)：tacgCAAGTTGAAGGTATGTCTTG

GBAA_2860-R(SEQ ID NO.22)：aaacCAAGACATACCTTCAACTTG

lef-F(SEQ ID NO.23)：tacgATTGTACAAGGTACTTCCAA

lef-R(SEQ ID NO.24)：aaacTTGGAAGTACCTTGTACAAT

3) The vector was constructed using anthrax A16R genomic DNA as a template and the fragments were inserted into the corresponding SalI and XbaI sites of pJOE 8999. The plasmid is digested by BsaI, the large fragment digested plasmid is connected with small double-stranded DNA, competent DH5 alpha is transformed, the plasmid is extracted after overnight culture, and the correct plasmid is obtained through sequencing and identification.

4) The upstream homology arm and downstream homology arm fragments expressing a certain protease coding gene are connected with a plasmid with gRNA, and competent DH5 alpha is transformed and cultured overnight.

5) And (3) carrying out enzyme digestion identification on the recombinant plasmid, converting E.coli SCS110, and introducing bacillus anthracis A16R through electroporation after sequencing identification to obtain intermediate bacteria A.

6) Intermediate A transformants were selected on BHIG medium containing kanamycin (25. Mu.g/mL) at 30 ℃. Single colonies were inoculated into liquid medium supplemented with 25. Mu.g/mL kanamycin, shake-cultured at 37℃for 3h, and then mannose was added at a final concentration of 0.4% to induce expression of Cas9 protein. After further culturing for 3 hours, the cultures were serially diluted and inoculated on LB agar containing 25. Mu.g/mL kanamycin and 0.4% mannose, and incubated overnight at 37 ℃.

7) And (3) subculturing the intermediate bacterium A to ensure that the plasmid pJOE8999 is lost, so as to obtain the recombinant bacterium A for knocking out the related genes of the specific protease codes.

And (3) sequentially knocking out the related genes coded by the next specific protease in the recombinant bacterium A according to the method to obtain the recombinant bacterium B. And the like until seven anthrax low protease activity mutant strains are obtained.

Genome editing was induced with 0.4% mannose according to standard protocols. The mutation sites were identified by PCR analysis using gene specific primers and the edited plasmid-free mutant was used as the initial strain for the next round of genome editing.

In the above steps, primers for identifying mutants were synthesized by Tianyihui, inc., and desalted and purified.

The primers for identifying the mutants were:

nprR-F(SEQ ID NO.25)：CAGCGCGTGTGCCCCAAAGGG

nprR-R(SEQ ID NO.26)：TTGACCAACAATATCAGGTTTACTG

inhA1-F(SEQ ID NO.27)：TTTGGAGACACCAGAGTTCATTG

inhA1-R(SEQ ID NO.28)：GTTCTAACGTAAGCGGCGTCAGCTG

tasA-F(SEQ ID NO.29)：TAGTGCTACGCCGAAATACAAAAG

tasA-R(SEQ ID NO.30)：GCAAGACACGAAAAGAAGGTGAGTG

mmzp-F(SEQ ID NO.31)：TTATCTTTGATGGTTGAATCTATG

mmzp-R(SEQ ID NO.32)：AGTGGGGTAGGTTAAGTTGATTTTG

GBAA_2860-F(SEQ ID NO.33)：GTTCCGAAGAACCGATAGATTGAATGGBAA_2860-R(SEQ ID NO.34)：GGTAACTGTTGAAGGAACTTCAGTAGlef-F(SEQ ID NO.35)：GAAATGGTCAGCACCGCCAGAAG

lef-R(SEQ ID NO.36)：TGTGTCTAATGTAGCAGATACATCTAG

the PCR amplification results are shown in FIG. 1, and the base pair number between each mutant strain and the previous mutant strain is consistent with the size of the knocked out target gene fragment, which indicates that the target gene has been knocked out successfully. Culture supernatants of each mutant strain were subjected to SDS-PAGE and WesternBlot analysis using anti-PA monoclonal antibodies. SDS-PAGE and WesternBlot results of mutant strain culture supernatants are shown in FIG. 2, and the expression level of PA (about 83 kDa) was gradually increased from the A16R-3 mutant strain from which three protease activity-related genes were knocked out. Among them, the A16R-5 mutant had the highest PA expression level. The A16R-5 culture supernatant was passed through a hand-held liquid aerosol pulmonary delivery device to immunize mice and observed for survival.

The survival of mice immunized with culture supernatant A16R-5 is shown in FIG. 3, and mice with different doses of administration die after immunization, which indicates that the strain A16R-5 has poor safety and is not suitable as a vaccine strain.

Taking the safety of the strain into consideration, the lef gene was knocked out on the basis of the A16R-5 strain by the same method as above to obtain the A16R-5.1 (referred to as A16R-5. DELTA. Lef) strain. Culture supernatants of the A16R-5 and A16R-5.1 strains were subjected to SDS-PAGE and WesternBlot analysis using anti-PA monoclonal antibodies. SDS-PAGE and Western Blot results of culture supernatants of A16R-5 and A16R-5.1 strains are shown in FIG. 3, and the PA expression level of A16R-5.1 is similar compared to A16R-5. The culture supernatant of A16R-5.1 was passed through a hand-held liquid aerosol pulmonary delivery device to immunize mice and observed for survival. The survival condition of mice immunized by A16R-5.1 culture supernatant is shown in figure 4, and the mice with different doses are not dead after immunization, which shows that A16R-5.1 strain has good safety and is suitable for being used as vaccine strain.

2. Anthrax low protease mutant strains and culture conditions

The genome editing plasmid was prepared using E.coli Top 10 cells and SCS 110. Kanamycin was added to the medium at the appropriate final concentration (50. Mu.g/mL for E.coli and 30. Mu.g/mL for B.anthracis).

All bacillus anthracis low protease mutant strains were prepared according to the above procedure and stored in LB medium containing 30% glycerol at-80 ℃.

1. Strain activation: resuscitates A16R-5.1 glycerol strain by using LB solid medium plate streaking method, and places the strain in a constant temperature incubator at 37 ℃ for overnight;

2. pre-culturing: picking single colony from LB solid medium of A16R-5.1, inoculating into BHI liquid medium containing 5mL, shake culturing at 37deg.C for 9h (mid-log phase), and rotating at 220rpm;

3. drop plate transfer: respectively inoculating 10 μl of pre-cultured fungus liquid onto LB solid medium containing 1% skimmed milk powder, and culturing overnight in a 37 ℃ constant temperature incubator;

4. performing formal culture: all colonies on the A16R-5.1 strain drop plates were scraped down and transferred toIn a centrifuge tube containing 20ml RM culture medium, shaking and mixing, taking 50 μl of bacterial liquid, diluting 10 times, and measuring OD ₆₀₀ Value, OD ₆₀₀ When =0.45, the inoculum size was fixed at 0.5mL, and transferred to an Erlenmeyer flask containing 500mL RM medium, shake-cultured at 37℃for 12 hours at a rotation speed of 110rpm.

EXAMPLE 2 preparation and evaluation of anthrax culture supernatant extraction vaccine

1. Preparation of liquid inhalant for extracting vaccine from anthrax culture supernatant

1. A16R-5.1 culture supernatant was prepared as in example 1.

2. Centrifuging the supernatant of the anthrax low protease mutant A16R-5.1 of the formula 1 to obtain a supernatant: transferring all bacterial solutions of A16R-5.1 into a 500mL centrifugal bottle, centrifuging and collecting supernatant, wherein the rotating speed is 8000rpm, and the time is 15min;

3. and (3) filtering and sterilizing: filtering and sterilizing the supernatant by using a vacuum pump, removing residual thalli and fragments, and storing in a refrigerator at 4 ℃;

4. the concentration of A16R-5.1 supernatant can be performed as follows:

(a1) Film package assembling and cleaning: assembling a membrane package, namely filling 500mL of deionized water into a sample bottle, opening a constant flow pump to pump liquid through the system, wherein the pump speed is 200-400mL/min so as to remove any air bag, and checking whether a pipeline connecting point has leakage;

(a2) After the step (a 1) is completed, placing a supernatant sample into an ice bath, pumping the sample into a VIVAFLOW 200 tangential flow ultrafiltration membrane bag by a constant flow pump for ultrafiltration concentration, intercepting Mr 10000 by the membrane bag, placing the filtered supernatant into a sample bottle, fixedly connecting a sample outlet pipe to a lower outlet of the side wall of the membrane bag by the constant flow pump, modulating the flow rate by 290rpm, connecting one end of an upper outlet with a pressure gauge, connecting the other end with a sample inlet pipe, connecting a filtrate to a pipeline of the upper wall of the membrane bag, opening a switch of the constant flow pump, and concentrating at 4 ℃ to obtain concentrated supernatant;

(a3) After the step (a 2) is completed, concentrating the supernatant to about 20mL, adding 500mL of physiological saline with the temperature of 4 ℃ into a sample bottle, ultrafiltering again, and removing redundant culture medium components in the concentrated supernatant;

(a4) After the step (a 3) is completed, the supernatant is concentrated to about 30mL and then is transferred to a 10KD ultrafiltration concentration centrifuge tube, the rotating speed is 6500rpm, and the time is 10min;

(a5) After the step (a 4) is completed, uniformly mixing concentrated samples of the same strain, and storing the concentrated samples in a refrigerator at the temperature of-80 ℃ for standby.

The concentration process of the supernatant fluid needs whole ice bath to prevent protein degradation, and an anthrax culture supernatant fluid extraction vaccine, hereinafter called as anthrax CSE (culture supernatant extract) vaccine, is obtained.

The anthrax CSE vaccine is a liquid inhalant.

2. Preparation of anthrax culture supernatant extracted vaccine dry powder inhalant

The dry powder inhalant is prepared according to the original excipient formula and flow in the laboratory.

1. The pre-spray samples were ice-bathed at 4℃for 2h. Adding the liquid inhalant of the anthrax CSE vaccine into a spray-dried solution, wherein the solution contains the following solutes in percentage by mass: d-mannitol 1%, inositol 1%, L-leucine 0.5% and poloxamer 1880.05%, CSE vaccine 0.1% and CpG0.1% as mucosal adjuvant.

2. The pH was adjusted to 7.2 with NaOH solution. The solution was placed in ice for at least 2h. A syringe connected to a two-fluid pneumatic nozzle (TSE, diameter 2 mm) was then injected into the container containing liquid nitrogen, using a fixed pressure of 1.5bar and a feed rate of 5 mL/min. At 10 cm below the nozzle, droplets were collected using a stainless steel container filled with liquid nitrogen, and the sprayed atomized droplets were flash frozen under liquid nitrogen to ice crystals. Ice crystals and a small amount of residual liquid nitrogen were transferred to stainless steel cups and freeze-dried in a vacuum freeze-drying system for 48h, and the dry powder was removed and stored in a4 ℃ environment.

3. The obtained dry powder is placed at 20 ℃ for sealing storage.

3. Evaluation of anthrax culture supernatant extraction vaccine

1. Biological Activity assay

And (3) taking the liquid inhalant and the dry powder inhalant of the anthrax CSE vaccine prepared in the previous step, and detecting target proteins in the vaccine by adopting SDS-PAGE and Western Blot.

As shown in FIG. 5, SDS-PAGE and Western Blot detection are performed after the dry powder is redissolved in PBS, and the result shows that the protein content is consistent before and after the anthrax CSE vaccine liquid inhalant is prepared into the dry powder, and the protein component of the anthrax CSE vaccine is not degraded.

2. ELISA method is adopted, ELISA auxiliary kit (product number: 1030011) of Shenzhen Daidae biological engineering Co., ltd is used for operation, anthrax CSE vaccine (liquid) and anthrax CSE vaccine dry powder complex solution (PBS solution) are respectively adopted for coating, the antibody titer is measured, and the dry powder titer is verified. Anthrax CSE vaccine liquid inhalant was used as a positive control.

The results are shown in figure 6, where the immunogenicity of anthrax CSE vaccine after dry powder formulation was hardly affected.

3. Observing the morphology of the dry powder particles

The dry powder particles were observed by a scanning electron microscope, and the morphology of the particles was observed by taking a plurality of fields of view.

The results are shown in FIG. 7 (2500X scanning electron microscope on the left and 110X scanning electron microscope on the right). The particle size of the anthrax CSE vaccine dry powder inhalant is relatively uniform and approximately spherical.

EXAMPLE 3 immunogenicity and immunoprotection evaluation of anthrax culture supernatant extraction vaccine

1. Animal immunization experiment

Experimental animals B10.D2-Hc ⁰ H2 ^d H2-T18 ^c AnoSnJ (abbreviated as B10.D2-Hc ⁰ ) Mice, 6-8 weeks old, racing laboratory animal Co.

The experimental animals were divided into six groups (50 per group) as follows;

anthrax CSE vaccine liquid inhalant group: mice were vaccinated with 20 μg liquid inhalant/mouse using a hand-held liquid aerosol lung delivery device. The fluid was delivered through the lungs completely into the lungs of the mice without nonspecific death. The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

The anthrax CSE vaccine dry powder inhalant group is that mice are inoculated by a hand-held dry powder aerosol lung delivery device, 0.5mg of anthrax culture supernatant is extracted into the vaccine dry powder inhalant/animal, and the impact gas quantity is 0.3mL (using a 1mL syringe) and the continuous impact is carried out for 2 times. The dry powder was delivered through the lungs completely into the lungs of mice without nonspecific death. The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

PBS resuspension group of anthrax CSE vaccine dry powder inhalants: 50 μl/dose (prepared by dissolving 0.5mg of anthrax CSE vaccine dry powder in 50ul PBS) was delivered using a hand-held liquid aerosol pulmonary delivery device. The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

PBS resuspension subcutaneous injection of anthrax CSE vaccine dry powder inhalant/group: mice were inoculated subcutaneously using a 1mL syringe at 20 μg/dose (prepared by dissolving 0.5mg anthrax CSE vaccine dry powder in 100 μlpbs). The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

Anthrax CSE vaccine liquid subcutaneous injection group: mice were inoculated subcutaneously with 20 μg anthrax CSE vaccine liquid inhalant/mouse using a 1mL syringe. The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

Anthrax CSE vaccine liquid plus aluminum adjuvant subcutaneous injection group: mice were inoculated subcutaneously with 20 μg anthrax CSE vaccine liquid inhalant/mouse using a 1mL syringe. The treatment was performed at week 0 (first-day), week 3 (second-day) and week 6 (third-day), respectively.

2. Animal toxicity test

At week 9, bacillus anthracis B.anthracis Pasteur II strain is suspended in 0.05% (mass percent) poloxamer aqueous solution and delivered by liquid aerosol tracheal insertion into the lung, live spore attacking agent B10.D2-Hc ⁰ Mice were 5X 10 ⁵ CFU/alone (pulmonary delivery route about 200 XLD) ₅₀ )。

Observations were recorded for 14 days after challenge, and the experiment was terminated at week 11.

1. Mouse survival curve

After challenge, 10 mice were randomly drawn from each group, and at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, … days, etc. after challenge, the mice were recorded and a survival curve was drawn.

The results are shown in fig. 8, and the survival rate of mice immunized by lung delivery of the anthrax CSE vaccine dry powder inhalant complex solution and the anthrax CSE vaccine liquid inhalant is significantly higher than that of mice immunized by lung delivery of the anthrax CSE vaccine dry powder inhalant, subcutaneous route immunization, and all CpG control groups. The CSE vaccine dry powder inhalant is proved to be capable of being used for immunizing mice through pulmonary delivery after reconstitution, has the same protective effect as a liquid inhalant and can resist infection of anthrax spores.

2. Antibody titer detection

At week 0 (day 2 before first immunization), week 3 (day 2 before second immunization), week 6 (day 2 before third immunization), week 9 (day 2 before challenge), 4 surviving mice were selected for each group, and specific antibody titers in serum and lung homogenates were detected (IgG: abcan, cat# ab6789; igG1: abcan, cat# ab97240; igG2a: abcan, cat# ab97245; igA: abcan, cat# ab 97235).

Immunization with B10.D2-Hc ⁰ Mouse serum IgG antibody titers are shown in figure 9. Immunization with B10.D2-Hc ⁰ The mouse serum IgG1 antibody titers are shown in figure 10. Immunization with B10.D2-Hc ⁰ Mouse serum IgG2a antibody titers are shown in figure 11. Immunization with B10.D2-Hc ⁰ The mouse serum IgG2a/IgG1 antibody titers are shown in FIG. 12. Immunization with B10.D2-Hc ⁰ Mouse lung homogenate IgG antibody titers are shown in figure 13. Immunization with B10.D2-Hc ⁰ Mouse lung homogenate IgG antibody titers are shown in figure 14. The results indicate that at 63dppi, the serum specific IgG levels of mice of the CSE vaccine lung delivery immunized group were significantly higher than those of mice of the aluminum adjuvant subcutaneous injection immunized group (fig. 9). There was no significant difference in serum specific IgG1 levels from the different vaccine formulations (fig. 10). All CpG adjuvant immunized groups had significantly higher serum specific IgG2a levels than the aluminum adjuvant group subcutaneously immunized groups, with a trend similar to the IgG2a/IgG1 ratio, indicating a Th1/Th2 response balance (fig. 11 and 12). The three vaccine formulations did not differ significantly in inducing humoral immune responses, cpG adjuvants were able to generate Th1/Th2 mixed immune responses, whereas aluminum adjuvants induced predominantly Th2 immune responses.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. A mutant strain of bacillus anthracis (Bacillus anthracis), wherein the mutant strain comprises a strain obtained by knocking out a plurality of genes related to extracellular protease activity in bacillus anthracis a 16R.

2. The mutant strain of claim 1, wherein the gene associated with extracellular protease activity comprises at least one of: nprR, mmzp, inhA1, tasA, gbaa_2860 and lef.

3. A mutant strain A16R-5.1 of bacillus anthracis (Bacillus anthracis), which is characterized in that the preservation number of the mutant strain A16R-5.1 is CGMCC NO.26476.

4. The method for constructing a mutant strain A16R-5.1 according to claim 3, comprising the steps of: taking bacillus anthracis A16R as a basic strain, and sequentially knocking out nprR, mmzp, inhA1, tasA and GBAA_2860 in bacillus anthracis A16R to obtain a mutant strain A16R-5;

5. The method of construction according to claim 4, wherein the knocking out comprises knocking out an upstream homology arm at positions 1 to 726 of the sequence shown in SEQ ID NO.1 and a downstream homology arm at positions 1 to 778 of the sequence shown in SEQ ID NO.2 in nprR;

6. Use of a mutant strain according to claim 1 or 2 or a mutant strain a16R-5.1 according to claim 3 for the preparation of a product for the prevention and/or treatment of a disease caused by bacillus anthracis.

7. The use according to claim 6, wherein the product for preventing and/or treating bacillus anthracis-induced diseases comprises an anthrax culture supernatant extract vaccine.

8. The preparation method of the anthrax culture supernatant extraction vaccine is characterized by comprising the following steps: inoculating the mutant strain A16R-5.1 of claim 3 into RM medium for culturing, collecting supernatant of the culture, and concentrating to obtain supernatant concentrated sample.

9. An anthrax culture supernatant prepared by the method of claim 8 is used to extract a vaccine.

10. The anthrax culture supernatant extraction vaccine of claim 9, wherein the dosage form of the anthrax culture supernatant extraction vaccine comprises a liquid or dry powder inhalant.