CN116120401A - Anti-melanoma active polypeptide KW13, medicine and application - Google Patents

Abstract

The invention belongs to the technical field of biomedicine, and relates to an anti-melanoma active polypeptide KW13, a medicament and application. The invention provides an anti-melanoma active polypeptide KW13, which comprises the active polypeptide as described in any one of (1) to (3): (1) an active polypeptide with an amino acid sequence shown as SEQ ID NO. 1; (2) An active polypeptide derived from (1) which is chemically modified by substitution, deletion or addition of one or more amino acids or one or more amino acid residues in the amino acid sequence of the active polypeptide defined in (1) and has anti-melanoma activity; (3) A salt form of the active polypeptide of item (1) and/or item (2). The active polypeptide provided by the invention has good in-vivo anti-tumor activity, does not have adverse reaction, and provides good prospect for anti-melanoma treatment.

Description

Anti-melanoma active polypeptide KW13, medicine and application

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a small-molecule active polypeptide KW13 and application thereof in anti-melanoma treatment, and a medicament containing the active polypeptide.

Background

Melanoma, commonly referred to as malignant melanoma, is a highly malignant tumor derived from melanocytes, which is extremely aggressive and frequently occurs in the skin, and is also found in the viscera, mucous membranes, uvea, etc. Melanoma is induced by various factors, exposure to natural or artificial ultraviolet rays is the most important environmental risk factor, and individual factors include genetic susceptibility, multiple melanin nevi, lighter complexion and the like. Worldwide, the incidence of melanoma has shown a rising trend year by year. Melanoma, the most deadly skin cancer, is an important challenge facing global public health and cancer control. The research on drugs for preventing and treating melanoma has great social demands and important social significance.

Surgical excision is an effective treatment for patients with early stages of melanoma, but has limited effectiveness in surgical excision for patients with advanced stages, particularly those with metastasis, and requires additional treatment. In recent years, immunotherapy and targeted therapy have been increasingly applied to clinic in addition to conventional chemotherapy and radiotherapy. According to the' melanoma diagnosis and treatment guide (2022 edition) issued by the national Wei Jian Committee, the clinical common melanoma system chemotherapeutics, namely traditional cytotoxicity medicaments, comprise dacarbazine, temozolomide, fotemustine, taxol, albumin taxol, cisplatin, carboplatin and the like, and the single medicament or the traditional combined medicament in the melanoma has the effective rate of 10-15 percent; the melanoma targeting drugs currently marketed in China mainly comprise: BRAF inhibitors (vitamin Mo Feini, dabrafenib), MEK inhibitors (trametinib), KIT inhibitors (imatinib, nilotinib); the domestic melanoma immunotherapeutic drugs mainly comprise PD-1 monoclonal antibodies (palbociclizumab, terep Li Shan antibodies). However, in clinical treatment, the existing medicines often have large toxic and side effects, especially an immune response of an organism possibly caused, which can cause heavy burden on the body of a patient. Therefore, the drug treatment of melanoma still faces a great challenge, and the development of drugs with better curative effects and less toxic and side effects is urgently needed.

Disclosure of Invention

The invention aims to provide an anti-melanoma active polypeptide KW13, a medicament and application. The active polypeptide provided by the invention has good in-vivo anti-tumor activity, does not have adverse reaction, and provides good prospect for anti-melanoma treatment.

The invention provides an anti-melanoma active polypeptide KW13, which comprises the active polypeptide as described in any one of (1) to (3):

(1) An active polypeptide with an amino acid sequence shown as SEQ ID NO. 1;

(2) An active polypeptide derived from (1) which is chemically modified by substitution, deletion or addition of one or more amino acids or one or more amino acid residues in the amino acid sequence of the active polypeptide defined in (1) and has anti-melanoma activity;

(3) A salt form of the active polypeptide of item (1) and/or item (2).

The invention also provides a nucleic acid molecule for encoding the anti-melanoma active polypeptide KW13 in the technical scheme, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2 or SEQ ID NO. 3.

The invention also provides application of the anti-melanoma active polypeptide KW13 in the technical scheme or the nucleic acid molecule in preparation of anti-melanoma medicines.

The invention also provides application of the anti-melanoma active polypeptide KW13 in the technical scheme or the nucleic acid molecule in preparation of medicines for inhibiting melanoma proliferation.

The invention also provides an anti-melanoma medicine, and the active ingredients of the anti-melanoma medicine comprise the anti-melanoma active polypeptide KW13 in the technical scheme.

In the invention, the anti-melanoma medicine also comprises pharmaceutically acceptable auxiliary materials.

Preferably, the auxiliary materials comprise one or more than two of solubilizer, cosolvent, suspending agent, emulsifier, bacteriostat, antioxidant, osmotic pressure regulator, pH regulator and filler.

The invention also provides a pharmaceutical composition, which comprises a preparation capable of killing tumor cells and/or a drug carrier capable of dispersing and transferring drugs into a body to exert biological functions and the anti-melanoma active polypeptide KW13 according to the technical scheme.

In the present invention, the agent capable of killing tumor cells includes a chemical agent and/or a biological agent capable of killing tumor cells; the biological medicine comprises a targeting medicine or a nano medicine; the chemical drug comprises a radioactive drug, a photodynamic therapy drug or a nano-drug.

In the invention, the drug carrier for dispersing and transferring the drug into the body to exert biological functions comprises any one of nano materials, liposome, polyethylene glycol modified compound or oily compound, or a mixture of a plurality of oily compounds.

The invention provides an anti-melanoma active polypeptide KW13. The anti-melanoma active polypeptide KW13 has small cytotoxicity and no adverse reaction in an animal model; has very good safety. The anti-melanoma active polypeptide can be independently used as an anti-melanoma biological therapeutic drug, and is also expected to be combined with other therapeutic modes to inhibit melanoma.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is an HPLC chart of an active polypeptide KW13 provided by the invention;

FIG. 2 is a MS spectrum of an active polypeptide KW13 provided by the invention;

FIG. 3 is a graph showing the results of cell viability measured after treatment of human immortalized epidermal cells Hacat for 48h with active polypeptide KW13 at different concentrations according to the present invention;

FIG. 4 is a graph of HE staining results of main organ sections of 14 days (sub) acute toxicity test (single administration of maximum dose) of mice provided by the invention, with a scale of 200 μm;

FIG. 5 is a graph of HE staining results of main organ sections of 14 days (sub) acute toxicity test (multiple administrations) of mice provided by the invention by intraperitoneal injection, with a scale of 200 μm;

FIG. 6 is a graph showing the anti-melanoma activity of KW13 in mice at different concentrations; wherein A is a representative luminescence picture of the living body imaging of each group of mice; b is a living body imaging luminous intensity graph of each group of mice; c is a graph of melanoma inhibitory rate results for KW13 active polypeptide treatment for each dose group.

Detailed Description

The invention provides an anti-melanoma active polypeptide KW13, which comprises the active polypeptide as described in any one of (1) to (3):

(1) An active polypeptide with an amino acid sequence shown as SEQ ID NO.1 (KKPVTQIVSAEAW);

(2) An active polypeptide derived from (1) which is chemically modified by substitution, deletion or addition of one or more amino acids or one or more amino acid residues in the amino acid sequence of the active polypeptide defined in (1) and has anti-melanoma activity;

(3) A salt form of the active polypeptide of item (1) and/or item (2).

In the present invention, the molecular weight of the active polypeptide with the amino acid sequence shown as SEQ ID NO.1 is 1456.68 daltons. The method for preparing the active polypeptide is not particularly limited, and the method for preparing the active polypeptide is well known in the art. In the examples of the present invention, the active polypeptide KW13 is preferably prepared by a chemical synthesis method. The chemical synthesis method of the invention preferably synthesizes the complete sequence by an automatic active polypeptide synthesizer, desalts and purifies by HPLC reverse column chromatography, and determines the purity to be more than 98 percent.

In the present invention, the site of the chemical modification is preferably a side chain group, an α -carbon atom, a terminal amino group or a carboxyl group of an amino acid residue. The types of chemical modifications described in the present invention preferably include covalent attachment of one or several modifications. In the present invention, the modification preferably comprises human serum albumin, fatty acid, glycosyl, cognate IgG, polyethylene glycol or a fluorescent labeling group. The method of chemical modification is not particularly limited in the present invention, and chemical modification methods well known in the art may be employed.

In the present invention, the salt form of the active polypeptide preferably includes hydrochloride, phosphate or acetate. The method for preparing the salt form of the active polypeptide is not particularly limited, and the method for preparing the salt form of the active polypeptide known in the art may be used.

The invention also provides a nucleic acid molecule for encoding the anti-melanoma activity polypeptide KW13 in the technical scheme, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2 (AAGAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGG) or SEQ ID NO. 3 (AAAAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGG).

The method of encoding the polypeptide of the nucleic acid molecule is not particularly limited, and may be carried out by methods known in the art, such as recombinant expression. In the present invention, the method of recombinant expression preferably comprises: constructing the nucleic acid molecule sequence on a vector by a gene recombination method to form a recombinant DNA expression vector, and then carrying out expression, extraction and purification of polypeptide molecules in prokaryotic or eukaryotic cells.

The invention also provides application of the anti-melanoma active polypeptide KW13 in the technical scheme or the nucleic acid molecule in preparation of anti-melanoma medicines. In the present invention, the dosage form of the drug is preferably an injection.

The invention also provides application of the anti-melanoma active polypeptide KW13 in the technical scheme or the nucleic acid molecule in preparation of medicines for inhibiting melanoma proliferation. The mouse melanoma model is taken as an experimental object, and the proliferation of the melanoma in the mouse can be inhibited by administering the active polypeptide KW13. Therefore, the active polypeptide KW13 has the effect of inhibiting melanoma proliferation, and provides a new idea for preparing anti-melanoma medicaments.

The invention also provides an anti-melanoma medicine, and the active ingredients of the anti-melanoma medicine comprise the anti-melanoma active polypeptide KW13 in the technical scheme.

In the invention, the anti-melanoma medicine preferably further comprises pharmaceutically acceptable auxiliary materials. In the present invention, the auxiliary materials preferably include one or more of a solubilizer, a cosolvent, a suspending agent, an emulsifier, a bacteriostatic agent, an antioxidant, an osmotic pressure regulator, a pH regulator and a filler.

The invention also provides a pharmaceutical composition, which comprises a preparation capable of killing tumor cells and/or a drug carrier capable of dispersing and transferring drugs into a body to exert biological functions and the anti-melanoma active polypeptide KW13 according to the technical scheme.

In the present invention, the agent capable of killing tumor cells includes a chemical agent and/or a biological agent capable of killing tumor cells; the biological medicine comprises a targeting medicine or a nano medicine; the chemical drug comprises a radioactive drug, a photodynamic therapy drug or a nano-drug. In the present invention, the preparation more preferably comprises any one of antimetabolites, antiangiogenic drugs, alkylating agents, antitumor natural drugs, antitumor antibiotics, targeted drugs such as vitamin Mo Feini, monoclonal antibody drugs such as palbociclib, and hormonal drugs.

In the present invention, the drug carrier for dispersing and transferring the drug into the body to exert biological functions preferably includes any one of nanomaterial, liposome, polyethylene glycol modified compound or oily compound, or a mixture of a plurality of oily compounds.

For further explanation of the present invention, the following descriptions will be given in detail of an anti-melanoma active polypeptide KW13, a drug and an application thereof with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Synthesis method of active polypeptide KW13

A solid phase synthesis method is used for synthesizing an anti-melanoma active polypeptide KW13, and the sequence of the polypeptide KW13 is shown as SEQ ID NO. 1. The method comprises the following specific steps:

1. swelling of resin

To the reaction column was poured 5g Fmoc-Trp (Boc) -Wang Resin, and 50mL DCM was added to swell and soak for 5min.

2. Deprotection of

The DCM in the reaction column was drained, fmoc was removed by adding uncapped solution (20% by volume of piperidine in DMF) and nitrogen sparge for 30min, drained, washed 5 times with DMF and drained.

3. Condensation reaction

The condensation was performed using a TBTU/DIEA activator combination, the weighed TBTU and the Fmoc-Ala-oh linker amino acid were calculated as 3-fold charges, dissolved in 50mL DMF, added to the reaction column, DIEA (1.55 mL) was added, and nitrogen sparged, and reacted for 30min.

4. Detection and washing

A little resin is taken out of the reaction column by a sampling tube, poured into a small test tube, washed once by DMF, poured off of DMF, respectively added with 3 drops of A, B, C liquid (A liquid: ninhydrin alcohol solution, B liquid: 20% alcohol 80% phenol mixed solution, C liquid: redistilled pyridine), and heated in a heater at 120 ℃ for 3min. Taking out the solution and resin for observing the color, if the solution is yellow, the resin is colorless or light yellow, the condensation reaction is complete, stopping the reaction in the reaction column, pumping, and washing with DMF for 3 times.

5. Re-casting

If the color of the resin is detected to be other colors, such as green, the reaction is not complete, the resin is pumped and washed for 3 times, and the same amount of the current reaction is weighed and put into a reaction column for re-reaction until the detection reaction is complete.

6. Continuing condensation

Repeating the steps 2-5 to connect the subsequent amino acids, glu, ala … … to Lys. The subsequent amino acid amounts were weighed according to the algorithm described above and the activator TBTU/DIEA amounts remained unchanged.

7. Shrinkage of

After the last amino acid linkage was completed, the 2 steps were repeated, then washed 3 times with DCM, 3 times with methanol, drained, the resin was poured out, and the baking lamp was baked and filled into a 500mL beaker.

8. Cutting

Adding 100mL of cutting fluid (TFA/phenylsulfide/phenol/EDT/water=86:5:4:3:2, volume ratio) into a beaker, placing the beaker on a magnetic stirrer, placing a magnet into the beaker, stirring and reacting for 2 hours, filtering by a sand core funnel, moistening resin in the sand core with TFA for 2 times, pouring the cutting fluid into 600mL of methyl ether, separating out polypeptide to form polypeptide methyl ether suspension, repeating the centrifugation-supernatant pouring-methyl ether washing process, repeating for 3 times, baking by a baking lamp, and removing methyl ether residues to obtain solid, namely the target polypeptide crude product.

9. Purification and preparation

Taking a trace of polypeptide crude product by using a capillary, adding 0.2mL of solution (acetonitrile: pure water=1:2, volume ratio) into the solution for ultrasonic full dissolution, analyzing the solution on an analytical high-pressure liquid chromatograph instrument, obtaining the retention time of a sample in an analysis column and recording the retention time. Based on the measured retention time, a suitable purification gradient is set and a gradient equilibrium is performed on the preparative high pressure liquid chromatography instrument. Fully dissolving about 6g of crude polypeptide, filtering, pumping the sample solution into a preparative high-pressure liquid chromatographic column by a pump for gradient elution, and collecting polypeptide pure liquid according to the retention time. Concentrating the polypeptide pure liquid, and freeze-drying to obtain polypeptide freeze-dried powder.

The purity of the synthesized small molecule active polypeptide KW13 reaches more than 98 percent (figure 1) through High Performance Liquid Chromatography (HPLC) analysis, and the structure is identified through MS (figure 2).

Example 2

Cytotoxic effect of active polypeptide KW13 on human immortalized epidermal cell Hacat

Collecting human immortalized epidermal cell Hacat suspension in logarithmic growth phase, and regulating cell density to 2×10 ⁵ Per mL, seeding 96-well plates at a volume of 2 mL/well, cells at 37℃and 5% CO ₂ Is adhered to the wall overnight. After the cells had adhered, the control group was not normally cultured without treatment with the administration, KW 13-administered group was cultured with DMEM medium containing KW13 at various concentrations (100. Mu.M, 200. Mu.M and 400. Mu.M), and taxol (PTX) -administered group was cultured with DMEM medium containing 30nM taxol. After 48h of cell culture, the cells were cultured using a kit (Progema,

luminescent Cell Viability Assay) the number of living cells is determined by: (1)/>

The buffer solution and the substrate in the kit are balanced to room temperature, and are uniformly mixed according to a proportion to prepare the +.>

A reagent; (2) The cells were digested and collected in a centrifuge tube, centrifuged at 350 Xg for 10min, and the supernatant was discarded and the DMEM medium was resuspended to 2X 10 ⁵ /mL; (3) Taking a 96-well plate with opaque walls, adding 100 mu L of cell suspension into each well, setting 3 compound wells for each sample, and preparing a control well containing only culture medium and no cells to determine a background luminescence value; (4) After equilibration of the plate to room temperature, 100. Mu.L +.>

A reagent; (5) The plate is oscillated on an orbital shaker for 2min to mix the contents, incubated at room temperature for 10min to stabilize the optical signal value, and the enzyme-labeled instrument detects the luminescence value. Cell viability (%) = (well luminescence value of certain concentration-background luminescence value)/(control well luminescence value-background luminescence value) ×100%.

The results of this example are shown in FIG. 3. Cell viability was 38.4% in the paclitaxel (30 nM) dosed groups and 89.9%, 81.9% and 70.2% in the 100. Mu.M, 200. Mu.M and 400. Mu.M polypeptide KW13 dosed groups, respectively. At 400 mu M concentration, the proliferation inhibition rate of the active polypeptide KW13 on the human immortalized epidermal cell Hacat is not more than 30%. Active polypeptide KW13 is less toxic to normal cells than Paclitaxel (PTX).

Example 3

Mice were given 14 days (sub) acute toxicity test by intraperitoneal injection-maximum dose single administration

Healthy C57BL/6 mice (male and female halves, 5-6 weeks) were selected and divided into a solvent control group and a KW13 administration group, each group having 10 animals. And preparing 5mg/mL KW13 solution by taking sterile physiological saline as a solvent. KW13 administration group was given 375mg/kg of active polypeptide KW13 solution in a single intraperitoneal injection at the maximum administration volume (1.5 mL) and the highest concentration (5 mg/mL); solvent control group was given a single intraperitoneal injection of physiological saline at the maximum dosing volume (1.5 mL). After the end of the administration, the mice were continuously observed for 14 days. Specific observation indexes include general indexes (appearance, behavior, response to stimulus, secretion, excretion and the like of a mouse), death conditions (death time, moribund response and the like) of the mouse, weight changes (multiple weighing before administration and during observation) of the mouse and the like; all deaths, symptoms present, and the time of onset, severity, duration, etc. of the symptoms are recorded in detail. At the same time, surviving mice were weighed and sacrificed for blood removal and dissection. Wherein the blood sample is used in a plasma re-calcilytic assay. Immediately after blood collection, the mice were dissected, and when any tissue or organ changed in volume, color, texture, etc., were recorded in detail and examined for histopathology.

The plasma decalcification test is a method for determining the defect of an endogenous coagulation system, and comprises the following specific steps: the blood sample was anticoagulated with sodium citrate and centrifuged at 3500rpm for 15min at4℃and the plasma (supernatant) was removed for use. mu.L of mouse plasma was thoroughly mixed with 20. Mu.L of HEPES buffer (10mM Hepes,150mM NaCl,pH 7.4), incubated at 37℃for 10min, and 40. Mu.L of CaCl pre-heated at 37℃was added ₂ Solutions (prepared by HEPES buffer solution) are immediately mixed, and the OD is detected by an enzyme-labeled instrument ₆₅₀ Dynamics are performed.

The (sub) acute toxicity experiment is an important link of toxicology research, and can primarily evaluate the safety of the medicine. The results of this example are shown in Table 1 and FIG. 4. During the 14-day observation period, the mice did not die, the activities and diet were normal, and no abnormality was seen in weight gain. Plasma dicalcium test results (table 1) show: compared with the mice in the control group, the plasma calcium recovery time of the mice in the administration group has no significant difference (P > 0.05), which suggests that the active polypeptide KW13 has no significant influence on the endogenous blood coagulation function. After the surviving mice are generally dissected, the abnormal internal organs such as heart, liver, spleen, lung, kidney, stomach, intestine, thymus and the like are not seen with naked eyes; after the section HE staining, the pathological changes of internal organs such as heart, liver, spleen, lung, kidney, stomach, intestines and thymus are not seen in the microscopic examination (FIG. 4). The results show that the active polypeptide KW13 has no toxic effect on mice under the maximum administration dosage, which proves that the KW13 has good safety.

Table 1 plasma recalcification time schedule for mice intraperitoneal injection acute toxicity test

Paclitaxel is a common tumor chemotherapeutic in clinic. According to the related data, the half-Lethal Dose (LD) of paclitaxel in a 24-hour single intraperitoneal administration acute toxicity test in mice ₅₀ ) 128mg/kg. In the 14-day (sub-) acute toxicity test of the mice of this example, the single intraperitoneal injection of polypeptide KW13 at a maximum dose of 375mg/Kg did not cause death of the mice. In contrast, active polypeptide KW13 has less acute toxicity than paclitaxel.

Example 4

Mice were given 14 days (sub) acute toxicity experiments by intraperitoneal injection-multiple doses

Healthy C57BL/6 mice (females, 5-6 weeks) were selected and divided into a solvent control group and a KW13 dosing group, each group having 10 animals. Preparing 5mg/mL active polypeptide KW13 solution by using sterile physiological saline as a solvent. KW13 administration group was intraperitoneally injected with a solution of active polypeptide KW13 at a dose of 100 mg/kg; the solvent control group was intraperitoneally injected with an equal volume of physiological saline. The administration was 1 time daily for 14 days, and mice were continuously observed during the administration period. Specific observation indexes include general indexes (appearance, behavior, response to stimulus, secretion, excretion and the like of a mouse), death conditions (death time, moribund response and the like) of the mouse, weight changes (multiple weighing before administration and during observation) of the mouse and the like; all deaths, symptoms present, and the time of onset, severity, duration, etc. of the symptoms are recorded in detail. At the same time, surviving mice were weighed and sacrificed for blood removal and dissection. Wherein the blood sample is used in a plasma re-calcilytic assay. Immediately after blood collection, the mice were dissected, and when any tissue or organ changed in volume, color, texture, etc., were recorded in detail and examined for histopathology.

The results of this example are shown in Table 2 and FIG. 5. During the 14-day dosing period, the mice did not die, were active, were normal in diet, and did not see abnormalities in weight gain. Plasma dicalcium test results (table 2) show: compared with the mice in the control group, the plasma calcium recovery time of the mice in the administration group has no significant difference (P > 0.05), which suggests that the active polypeptide KW13 has no significant influence on the endogenous blood coagulation function. After the surviving mice are generally dissected, the abnormal internal organs such as heart, liver, spleen, lung, kidney, stomach, intestine, thymus and the like are not seen with naked eyes; after the section HE staining, the pathological changes of internal organs such as heart, liver, spleen, lung, kidney, stomach, intestines and thymus are not seen in the microscopic examination (FIG. 5). The results show that the active polypeptide KW13 is not toxic to mice after being continuously administered for 14 days at the dosage level of 100mg/kg/day, which proves that the active polypeptide KW13 has better safety.

Table 2 plasma recalcification time schedule for in vivo anti-melanoma active dose toxicity assay in mice

Example 5

Anti-melanoma Activity assay in mice

Healthy C57BL/6 mice (females, 5-6 weeks) are selected and divided into a normal control group, a melanoma model, a positive drug control group and an active polypeptide KW13 treatment group (25 mg/kg, 50mg/kg, 100 mg/kg), and 10 mice in each group. The B16F10#2 cells (the basic construction flow is that a luciferase gene (luc) is constructed on a plasmid by a conventional molecular cloning mode, B16F10 cells are transfected by slow viruses, then stable transgenic cells are screened out by resistance screening, and in-vitro bioluminescence detection is carried out on the cells) are genetically modified mouse melanoma cells, and the luciferase gene is carried. Groups of mice were intraperitoneally injected with 1X 10 except for normal controls ⁶ B16f10#2 cells to construct a mouse melanoma model. The positive drug control group was given 30mg/kg paclitaxel by intraperitoneal injection, once every 2 days. Active polypeptide KW13 mice in the treatment group were intraperitoneally administered with polypeptide KW13 1 time a day. After 14 days of administration, the mice are fully anesthetized, D-sodium fluorescein salt solution (15 mg/mL) is injected into the abdominal cavity at the dosage of 150mg/kg, and after 10-15 minutes, living body imaging is carried out after the luminous signals are stable, and the melanoma growth condition of each group of mice is detected. ROI button pairing by softwareThe light area was automatically quantified, the luminous intensity of melanoma was counted for each mouse, and the melanoma inhibitory rate was calculated. The calculation formula is as follows: tumor inhibition (%) = (average luminous intensity of 1-treated mice/average luminous intensity of melanoma model group mice) ×100%.

The results of this example are shown in FIG. 6.

According to the dose setting and drug toxicity data in the relevant literature, the dose of paclitaxel administered in this example was set to 30mg/kg, administered once every 2 days. Paclitaxel has remarkable anti-melanoma activity under the administration dosage, and compared with the model group, the melanoma inhibition rate is 32.7%, which proves that the melanoma model in the embodiment is successfully constructed. Active polypeptide KW13 has significant anti-melanoma activity (p < 0.05) at administration doses of 25mg/kg/day, 50mg/kg/day and 100mg/kg/day, and the melanoma inhibition rates are 18.9%, 56.8% and 72.2%, respectively.

Paclitaxel is used as a traditional chemotherapy drug, and is easy to produce toxic and side effects such as bone marrow suppression, alopecia, neurotoxicity, gastrointestinal tract reaction and the like at clinical treatment doses. A few patients also have allergic reactions and cardiotoxic effects such as heart rate increase, myocardial ischemia and atrioventricular block, etc. when using paclitaxel, which can be seriously life threatening. The results of example 4 show that no toxic effect was detected in mice after 14 days of continuous administration of active polypeptide KW13 at a dose level of 100mg/kg/day, indicating that at this dose, i.e. the therapeutically active dose in this example, polypeptide KW13 was less toxic to mice and safer.

In conclusion, the polypeptide KW13 has good anti-melanoma activity, and meanwhile, the acute toxicity is smaller than that of taxol, and the safety of the polypeptide KW13 under the treatment dose is higher than that of taxol.

In all the above examples, the data processing uses software GraphpadPrism 8, data mean ± SD, and the statistical analysis method is t-test (p <0.05; p <0.01; p < 0.001).

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (10)

1. An anti-melanoma active polypeptide KW13 comprising the active polypeptide of any one of (1) to (3):

(1) An active polypeptide with an amino acid sequence shown as SEQ ID NO. 1;

(2) An active polypeptide derived from (1) which is chemically modified by substitution, deletion or addition of one or more amino acids or one or more amino acid residues in the amino acid sequence of the active polypeptide defined in (1) and has anti-melanoma activity;

(3) A salt form of the active polypeptide of item (1) and/or item (2).

2. A nucleic acid molecule encoding the anti-melanoma activity polypeptide KW13 of claim 1, wherein the nucleotide sequence of said nucleic acid molecule is shown in SEQ ID No. 2 or SEQ ID No. 3.

3. Use of an anti-melanoma active polypeptide KW13 of claim 1 or of a nucleic acid molecule of claim 2 for the manufacture of an anti-melanoma medicament.

4. Use of an anti-melanoma active polypeptide KW13 of claim 1 or a nucleic acid molecule of claim 2 for the manufacture of a medicament for inhibiting melanoma proliferation.

5. An anti-melanoma drug, characterized in that the active ingredient of the anti-melanoma drug comprises the anti-melanoma active polypeptide KW13 of claim 1.

6. The anti-melanoma drug according to claim 5, further comprising pharmaceutically acceptable excipients.

7. The drug according to claim 6, wherein the auxiliary materials comprise one or more of solubilizers, co-solvents, suspending agents, emulsifiers, bacteriostats, antioxidants, osmotic pressure regulators, pH regulators and fillers.

8. A pharmaceutical composition comprising a preparation capable of killing tumor cells and/or a drug carrier for dispersing and transferring the drug into the body to exert biological functions and the anti-melanoma active polypeptide KW13 of claim 1.

9. The pharmaceutical composition of claim 8, wherein the agent capable of killing tumor cells comprises a chemical and/or biological agent capable of killing tumor cells; the biological medicine comprises a targeting medicine or a nano medicine; the chemical drug comprises a radioactive drug, a photodynamic therapy drug or a nano-drug.

10. The pharmaceutical composition of claim 8, wherein the drug carrier for dispersing and transferring the drug into the body for biological function comprises any one of nanomaterial, liposome, polyethylene glycol modified compound or oily compound, or a mixture of a plurality of oily compounds.

Images