CN116102657A - Preparation and application of chimeric antigen receptor immune cells constructed based on polypeptide Pep42 - Google Patents

Abstract

The invention provides preparation and application of chimeric antigen receptor immune cells constructed based on a small molecule cyclic peptide Pep 42. Specifically, the invention provides a Chimeric Antigen Receptor (CAR) based on Pep42 engineering, which comprises an extracellular binding domain, wherein the extracellular binding domain can specifically target receptors such as glucose regulatory protein 78 (cell surface glucose-regulated protein 78, csGRP 78) on the surface of a cell membrane. The CAR immune cell has stronger specificity and target affinity, so the killing capacity to the target cell is stronger and the safety is high.

Description

Preparation and application of chimeric antigen receptor immune cells constructed based on polypeptide Pep42

Technical Field

The invention belongs to the field of immune cell therapy, and particularly relates to preparation and application of chimeric antigen receptor immune cells constructed based on polypeptide Pep 42.

Background

Biological immunity treatment is an emerging tumor treatment method with obvious curative effect, is a fourth tumor treatment means after surgery, radiotherapy and chemotherapy, and achieves the aim of treating tumors by specifically identifying tumor cells and then eliminating the tumor cells in tissues on the premise of not damaging the immune system function of the organism. Immune cell therapy is an important type of biological immunotherapy, with adoptive immune cell therapy developing most rapidly. Chimeric antigen receptor T cell (Chimeric Antigen Receptor-Tcell, CAR-T) therapy is a common adoptive immune cell therapy, and the method directly combines gene fragments (including nanobodies, single-chain antibodies, cytokines, ligands and the like) capable of recognizing tumor antigens with signal molecules (including costimulatory molecules such as CD3 zeta chains, CD28, 4-1BB and the like) required by T cell activation to construct Chimeric Antigen Receptor (CAR), and introduces and modifies the T cells in a gene transduction mode to endow the T cells with the capability of recognizing tumor antigens and rapidly activating and killing tumor cells, thereby effectively avoiding the restriction of MHC. At present, the CAR-T therapy has been greatly successful in the aspect of treating hematological malignant tumors, and has the problems of difficult CAR-T homing, tumor microenvironment resistance, lack of tumor specificity or related antigens and the like, so that the problems need to be solved.

Endoplasmic reticulum stress is a response form of cells to accumulation of endoplasmic reticulum proteins, and can induce Unfolded Protein Response (UPR), namely, the cells relieve endoplasmic reticulum pressure by reducing protein synthesis, promoting protein degradation, increasing endoplasmic reticulum chaperone expression and the like, and the endoplasmic reticulum stress is excessively long or strong in duration and exceeds the regulation capacity of the cell self unfolded protein response, so that metabolic disorder, apoptosis and the like of the cells can be caused. In the tumor microenvironment, the endoplasmic reticulum stress response is often caused by the existence of adverse factors such as hypoxia, glucose starvation, acidosis and the like, and tumor cells adapt to the adverse conditions by activating unfolded protein response, so that death is avoided. Glucose regulatory protein 78 (GRP 78), also known as Bip protein, is encoded by the HSPA5 gene and is a key molecule for the response of the unfolded protein of the endoplasmic reticulum. GRP78 can be expressed in large quantity under endoplasmic reticulum stress, promotes correct folding of protein, relieves endoplasmic reticulum pressure, and has extremely strong anti-apoptosis capability. A large number of documents prove that GRP78 is up-regulated in the expression of various solid tumor cells such as lung cancer, liver cancer, colorectal cancer and the like, and is partially transferred to the surface of a cell membrane to participate in the activation regulation of signal paths such as PI3K/AKT, JAK2/STAT3 and the like. The nature of GRP78 cell membrane transfer is rare in normal cells, suggesting that csGRP78 can be used as an antigen for CAT-T treatment of solid tumors, and theoretically has good specificity and safety.

Thus, targeting csGRP78 constructs to work effectively with CAR-T would be of great value for the treatment of solid tumors or other diseases associated with aberrant csGRP78 expression.

Disclosure of Invention

The invention aims to provide chimeric antigen receptor immune cells constructed based on cyclic peptide PEP42 and preparation and application methods thereof.

In a first aspect of the invention there is provided a Chimeric Antigen Receptor (CAR), wherein said CAR comprises an extracellular binding domain, said extracellular binding domain being capable of specifically binding to Pep42 receptor, and said extracellular binding domain having a cyclic peptide structure.

In another preferred embodiment, the cyclic peptide structure is based on the cyclic peptide structure of the small molecule cyclic peptide Pep42 and specifically binds to the Pep42 receptor.

In another preferred embodiment, the extracellular binding domain of the CAR comprises a second extracellular domain for an additional target in addition to the first extracellular domain with a cyclopeptide structure for the Pep42 receptor.

In another preferred embodiment, the additional target is a tumor specific target.

In another preferred embodiment, the cyclic peptide structure is located at the end (i.e., N-terminus) or in the middle of the extracellular binding domain.

In another preferred embodiment, the cyclic peptide structure is 12-15 amino acids in length; preferably 13-15 amino acids.

In another preferred embodiment, the cyclic peptide structure (or Pep42 peptide fragment) has the amino acid sequence shown in SEQ ID NO. 1, or its amino acid sequence has an identity of greater than or equal to 85%, preferably greater than or equal to 90%, more preferably greater than or equal to 93%, or a difference of 1, 2 or 3 amino acids compared to SEQ ID NO. 1.

In another preferred embodiment, the Pep42 receptor is selected from the group consisting of: cell membrane surface Grp78 (csGrp 78).

In another preferred embodiment, the extracellular binding domain comprises a Pep42 peptide fragment, said Pep42 peptide fragment having the amino acid sequence shown in SEQ ID No. 1.

In another preferred embodiment, the extracellular binding domain has the amino acid sequence shown in SEQ ID NO. 1.

In another preferred embodiment, the Pep42 peptide fragment specifically binds to the glucose regulatory protein 78 (GRP 78) receptor.

In another preferred embodiment, the GRP78 is GRP78 protein (csGRP 78) located on the surface of the cell membrane (or membrane-bound).

In another preferred embodiment, the GRP78 protein is derived from a human or non-human mammal.

In another preferred embodiment, the non-human mammal comprises: rodents (e.g., rats, mice), primates (e.g., monkeys); preferably a primate.

In another preferred embodiment, the GRP78 protein is of human or monkey origin.

In another preferred embodiment, the GRP78 protein is of human origin.

In another preferred embodiment, pep42 has the amino acid sequence shown in SEQ ID NO. 1.

In another preferred embodiment, the CAR has the structure shown in formula I below:

L-EB-H-TM-C-CD3ζ-RP (I)

in the method, in the process of the invention,

each "-" is independently a connecting peptide or peptide bond;

l is an absent or signal peptide sequence;

EB is an extracellular binding domain;

h is a no or hinge region;

TM is a transmembrane domain;

c is an absent or co-stimulatory signaling molecule;

cd3ζ is a cytoplasmic signaling sequence derived from cd3ζ;

RP is absent or reporter.

In another preferred embodiment, the reporter protein RP further comprises a self-cleaving recognition site, preferably a T2A sequence, at its N-terminus.

In another preferred embodiment, the reporter protein RP is a fluorescent protein.

In another preferred embodiment, the reporter protein RP is mKate2 red fluorescent protein.

In another preferred example, the amino acid sequence of the mKate2 red fluorescent protein is shown as SEQ ID NO. 2.

In another preferred embodiment, L is a signal peptide of a protein selected from the group consisting of: CD8, CD28, GM-CSF, CD4, CD137, or a combination thereof.

In another preferred embodiment, L is a CD8 derived signal peptide.

In another preferred embodiment, the amino acid sequence of L is shown in SEQ ID NO. 3.

In another preferred embodiment, said H is a hinge region of a protein selected from the group consisting of: CD8, CD28, CD137, or a combination thereof.

In another preferred embodiment, the H is a CD8 derived hinge region.

In another preferred embodiment, the amino acid sequence of H is shown in SEQ ID NO. 4.

In another preferred embodiment, the TM is a transmembrane region of a protein selected from the group consisting of: CD28, CD3epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or a combination thereof.

In another preferred embodiment, the TM is a CD 8-derived transmembrane region.

In another preferred embodiment, the amino acid sequence of said TM is shown in SEQ ID NO. 5.

In another preferred embodiment, said C is a costimulatory signaling molecule of a protein selected from the group consisting of: OX40, CD2, CD7, CD27, CD28, CD30, CD40, CD70, CD134, 4-1BB (CD 137), PD1, dap10, CDS, ICAM-1, LFA-1 (CD 11a/CD 18), ICOS (CD 278), NKG2D, GITR, TLR2, or combinations thereof.

In another preferred embodiment, said C is a costimulatory signaling molecule of 4-1BB origin.

In another preferred embodiment, the amino acid sequence of C is shown in SEQ ID NO. 6.

In another preferred embodiment, the amino acid sequence of the cytoplasmic signaling sequence derived from CD3 zeta is shown in SEQ ID NO. 7.

In another preferred embodiment, the amino acid sequence of the chimeric antigen receptor CAR is shown in SEQ ID NO. 8.

In a second aspect of the invention there is provided a nucleic acid molecule encoding a chimeric antigen receptor according to the first aspect of the invention.

In a third aspect of the invention there is provided a vector comprising a nucleic acid molecule according to the second aspect of the invention.

In another preferred embodiment, the carrier is selected from the group consisting of: DNA, RNA, plasmids, lentiviral vectors, adenoviral vectors, retroviral vectors, transposons, or combinations thereof.

In another preferred embodiment, the vector is a lentiviral vector.

In another preferred embodiment, the carrier is selected from the group consisting of: pTomo lentiviral vector, plenti, pLVTH, pLJM, pHCMV, pLBS.CAG, pHR, pLV, etc.

In another preferred embodiment, the vector is a pTomo lentiviral vector.

In another preferred embodiment, the carrier further comprises a member selected from the group consisting of: promoters, transcription enhancing elements WPRE, long terminal repeat LTR, and the like.

In another preferred embodiment, the vector comprises the nucleotide sequence shown as SEQ ID NO. 9.

In a fourth aspect of the invention there is provided a host cell comprising a vector or chromosome according to the third aspect of the invention incorporating an exogenous nucleic acid molecule according to the second aspect of the invention or expressing a CAR according to the first aspect of the invention.

In a fifth aspect of the invention there is provided an engineered immune cell comprising a vector or chromosome according to the third aspect of the invention incorporating an exogenous nucleic acid molecule according to the second aspect of the invention or expressing a CAR according to the first aspect of the invention.

In another preferred embodiment, the engineered immune cell is selected from the group consisting of: t cells, NK cells, NKT cells, or macrophages.

In another preferred embodiment, the engineered immune cell is a chimeric antigen receptor T cell (CAR-T cell) or a chimeric antigen receptor NK cell (CAR-NK cell).

In another preferred embodiment, the engineered immune cell is a CAR-T cell.

In a sixth aspect of the invention there is provided a method of preparing an engineered immune cell according to the fifth aspect of the invention comprising the steps of: transduction of a nucleic acid molecule according to the second aspect of the invention or a vector according to the third aspect of the invention into an immune cell, thereby obtaining said engineered immune cell.

In another preferred embodiment, the method further comprises the step of performing functional and validity assays on the obtained engineered immune cells.

In a seventh aspect of the invention there is provided a pharmaceutical composition comprising a CAR according to the first aspect of the invention, a nucleic acid molecule according to the second aspect of the invention, a vector according to the third aspect of the invention, a host cell according to the fourth aspect of the invention, and/or an engineered immune cell according to the fifth aspect of the invention, and a pharmaceutically acceptable carrier, diluent or excipient.

In another preferred embodiment, the formulation is a liquid formulation.

In another preferred embodiment, the formulation is in the form of an injection.

In another preferred embodiment, the concentration of the engineered immune cells in the formulation is 1X 10 ³ -1×10 ⁸ Individual cells/ml, preferably 1X 10 ⁴ -1×10 ⁷ Individual cells/ml.

In an eighth aspect of the invention there is provided the use of a CAR according to the first aspect of the invention, a nucleic acid molecule according to the second aspect of the invention, a vector according to the third aspect of the invention, or a host cell according to the fourth aspect of the invention, and/or an engineered immune cell according to the fifth aspect of the invention, for the preparation of a medicament or formulation for the prevention and/or treatment of a tumour.

In another preferred embodiment, the medicament or formulation is also useful for preventing and/or treating other diseases associated with abnormal expression of Pep42 receptor.

In another preferred embodiment, the Pep42 receptor includes, but is not limited to, csGRP78, and the like.

In another preferred embodiment, the other diseases associated with abnormal expression of Pep42 receptor include, but are not limited to, tumors, aging, obesity, cardiovascular diseases, diabetes, neurodegenerative diseases, infectious diseases, etc.

In another preferred embodiment, the disease associated with aberrant expression of other Pep42 receptors includes: diseases associated with aberrant expression of csGRP 78.

In another preferred embodiment, said abnormal expression of Pep42 receptor means that said Pep42 receptor is overexpressed.

In another preferred embodiment, the Pep42 receptor is expressed in an amount greater than or equal to 1.5 times, preferably greater than or equal to 2 times, and more preferably greater than or equal to 2.5 times the amount expressed in normal physiological conditions.

In another preferred embodiment, the disease associated with abnormal expression of csGRP78 comprises: tumors, aging, cardiovascular diseases, obesity, etc.

In another preferred embodiment, the disease is a malignancy in which csGRP78 is highly expressed (i.e., csGRP78 positive).

In another preferred embodiment, the tumor includes a hematological tumor and a solid tumor.

In another preferred embodiment, the hematological neoplasm is selected from the group consisting of: acute Myelogenous Leukemia (AML), multiple Myeloma (MM), chronic Lymphocytic Leukemia (CLL), acute Lymphoblastic Leukemia (ALL), diffuse large B-cell lymphoma (DLBCL), and the like, or combinations thereof.

In another preferred embodiment, the solid tumor is selected from the group consisting of: breast cancer, gastric cancer, hepatobiliary cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, ovarian cancer and esophageal cancer, glioma, lung cancer, pancreatic cancer, prostate cancer, and the like, or combinations thereof.

In a ninth aspect of the invention there is provided the use of an engineered immune cell as described in the fifth aspect of the invention, or a pharmaceutical composition as described in the seventh aspect of the invention, for the prevention and/or treatment of cancer or tumour.

In a tenth aspect of the invention there is provided a method of treating a disease comprising administering to a subject in need of treatment an effective amount of an engineered immune cell according to the fifth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention.

In another preferred embodiment, the disease is a disease associated with abnormal expression of Pep42 receptor.

In another preferred embodiment, the disease is cancer or tumor.

In another preferred embodiment, the CAR immune cells contained in the engineered immune cells or pharmaceutical composition are cells derived from the subject (autologous cells).

In another preferred embodiment, the CAR immune cells contained in the engineered immune cells or pharmaceutical composition are cells derived from a healthy individual (allogeneic cells).

In another preferred embodiment, the methods described can be used in combination with other therapeutic methods.

In another preferred embodiment, the other treatment methods include chemotherapy, radiotherapy, targeted therapy, and the like.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows a schematic diagram of Pep42-CAR vector construction.

Wherein A is Pep42 nucleotide and amino acid sequence information; b is a schematic diagram of the structure of plasmids CD19-CAR and Pep42-CAR in a control group, wherein the signal peptide, the hinge region and the transmembrane region are all derived from human CD8 molecules, 4-1BB is derived from human CD137, CD3 zeta is derived from human CD3, and mKate2 is a fluorescent label and is used for detecting CAR expression.

Figure 2 shows CAR infection efficiency detection results.

Wherein A is the result of cell fluorescence expression after T cells are infected by CD19-CAR and Pep42-CAR for 72 hours, NTD is untreated, BF is bright field, mKate2 is CAR fluorescence expression; b is the result of flow detection fluorescence expression.

Figure 3 shows the results of CAR proliferation efficiency assays.

FIG. 4 shows the results of csGRP78 expression assays for different tumor cell lines.

FIG. 5 shows the results of in vitro detection of Pep42-CAR-T killing of different tumor cell lines.

Wherein SMMC7721, hepG2 and MHCC97H are liver cancer cell lines; BXPC3 and ASPC1 are pancreatic cancer cell lines. Luc is known as Luciferase, luciferase.

Fig. 6 shows ifnγ release detection results.

FIG. 7 shows the results of the detection of the killing and IFNγ release of Pep42-CAR-T on GRP 78T overexpressing cells.

FIG. 8 shows the results of a cell line killing assay for Pep42-CAR-T on csGRP78 under expression, where PANC1 is pancreatic cancer cells and HEK293T is a human embryonic kidney epithelial cell line.

FIG. 9 shows the results of safety evaluation of Pep42-CAR-T in macaques.

Detailed Description

The present inventors have made extensive and intensive studies and, as a result of extensive screening, developed for the first time a Chimeric Antigen Receptor (CAR) having an extracellular binding domain of a specific cyclopeptide structure. Specifically, the invention provides preparation and application of chimeric antigen receptor immune cells constructed based on small molecule cyclic peptide Pep 42. Experimental results show that the CAR-T cell provided by the invention can unexpectedly form and maintain the CAR with the cyclopeptide structure on the cell surface, and can target the csGRP78 receptor efficiently and specifically, so that the CAR-T cell has a remarkable killing effect on target cells and shows a broad-spectrum anti-tumor effect on tumor cells. The present invention has been completed on the basis of this finding.

Terminology

In order that the invention may be more readily understood, certain technical and scientific terms are defined below. Unless defined otherwise herein, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Before describing the present invention, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "optional" or "optionally" means that the subsequently described event or circumstance may, but need not, occur.

As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …" or "consisting of …".

"transduction," "transfection," "transformation," or the terms used herein refer to the process of transferring an exogenous polynucleotide into a host cell, and transcription and translation to produce a polypeptide product, including the use of plasmid molecules to introduce the exogenous polynucleotide into the host cell (e.g., E.coli).

"Gene expression" or "expression" refers to the process by which a gene is transcribed, translated, and post-translationally modified to produce an RNA or protein product of the gene.

"Polynucleotide" refers to polymeric forms of nucleotides of any length, including Deoxynucleotides (DNA), ribonucleotides (RNA), hybrid sequences and the like. Polynucleotides may include modified nucleotides, such as methylated or capped nucleotides or nucleotide analogs. The term polynucleotide as used herein refers to single-and double-stranded molecules that are interchangeable. Unless otherwise indicated, polynucleotides in any of the embodiments described herein include a double stranded form and two complementary single strands that are known or predicted to constitute the double stranded form.

The meaning of all parameters, dimensions, materials and configurations described herein will be readily understood by those skilled in the art. The actual parameters, dimensions, materials, and/or configurations may depend upon the specific application for which the invention is used. It will be appreciated by those skilled in the art that the examples or claims are given by way of example only and that the scope of the invention which can be covered by the embodiments of the invention is not limited to the specifically described and claimed scope within the scope of the equivalents or claims.

All definitions and uses herein should be understood to exceed dictionary definitions or definitions in documents incorporated by reference.

All references, patents and patent applications of the present invention are incorporated by reference with respect to the subject matter to which they refer, and in some cases may encompass the entire document.

It should be understood that for any method described herein that includes more than one step, the order of the steps is not necessarily limited to the order described in these embodiments.

In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meanings given below, unless expressly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" may refer to a value or composition that is within an acceptable error of a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or measured.

The term "administering" refers to physically introducing a product of the invention into a subject using any of a variety of methods and delivery systems known to those of skill in the art, including intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration, e.g., by injection or infusion.

GRP78 and endoplasmic reticulum stress response

Solid tumors have unique tumor microenvironments, often in hypoxic and glucose starvation conditions due to poor vasculature, producing large amounts of lactic acid via the glycolytic pathway. The solid tumor cells can induce endoplasmic reticulum stress for coping with pressure stimulus in tumor microenvironment, induce unfolded protein self-protection reaction, reduce secretion and accumulation of misfolded protein, maintain endoplasmic reticulum steady state, and create survival opportunity for tumor cells. GRP78 acts as a key regulatory protein for the unfolded protein response, with significant upregulation of expression levels in tumor cells. Normally, GRP78 binds to the endoplasmic reticulum lumen domain of IRE1, PERK and ATF6 proteins, inhibiting their function, and when endoplasmic reticulum is stressed, GRP78 separates from three proteins and binds to unfolded or misfolded proteins, transporting the misfolded proteins back to the cytoplasm, on the one hand, through 26S ubiquitin enzymatic degradation, and on the other hand, accelerating folding of the proteins by the energy of ATP hydrolysis, allowing the correctly folded proteins to be transported to the golgi apparatus, thus promoting correct folding of nascent proteins and preventing accumulation of misfolded, unfolded proteins. The dissociated IRE1, PERK and ATF6 then each induce a downstream unfolded protein response via a different signal pathway.

The GRP78 which is up-regulated in the expression of the tumor cells can partially escape to the surface of tumor cell membranes and participate in the processes of proliferation, invasion, migration, drug resistance and the like of the tumor cells. Further studies have found that csGRP78 expression abundance correlates with malignancy of tumor cells. Although the mechanism of GRP78 membrane metastasis is not fully understood at present, and different metastasis mechanisms may exist for different cells, this does not affect its value in solid tumor CAR-T treatment. In addition, csGRP78 was also detectable in blood tumor cells, such as Sup-B15 and NS-1. Therefore, csGRP 78-targeted CAR-T of the invention is of great value for the treatment of solid tumors, hematological tumors, or other diseases associated with abnormal csGRP78 expression.

Pep42 cyclic peptide

The cyclic peptide Pep42 can specifically bind to csGRP78 receptor. In 2006 Kim et al screened for csGRP 78-specific small molecule cyclopeptide ligand Pep42 by using phage cyclopeptide library technology. Pep42 cyclic peptide consists of 13 amino acids and has the sequence CTVALPGGYVRVC. Pep42 forms a disulfide bond loop between two cysteines at two ends, and mutation experiments further prove that the Pep42 annular structure is a molecular basis for specifically recognizing csGRP 78. The cyclic peptide is an important active peptide existing in plants, animals and human bodies, has long half-life, has definite fixed conformation and can be well combined with a receptor. In human body, linear peptide cyclization is frequently generated between two cysteines, and the cyclization efficiency is high, which provides important conditions for the application of cyclic peptide medicines. At present, a large number of cyclopeptide ligands are obtained based on gene coding technology of artificial design and in vitro evolution, and Pep42 is one of the cyclopeptide ligands.

Pep42 and csGRP78 can be internalized into cells after being specifically combined, and the cell-free effect is achieved, so that a powerful tool is provided for the drug design for targeting csGRP78 to treat tumors, and the drug can be effectively delivered, and the toxic effect of the chemotherapeutic drug on normal cells is reduced.

Pep42 is a ligand for GRP 78. The CAR constructed based on Pep42 is a receptor/ligand-based CAR molecule, and has the advantages of moderate affinity, higher clinical reference value in animal safety evaluation results and the like compared with the CAR designed based on a single-chain antibody scFv sequence.

Chimeric Antigen Receptor (CAR) of the invention

Chimeric immune antigen receptor (Chimeric antigen receptor, CAR) consists of extracellular antigen recognition region, transmembrane region and intracellular co-stimulatory signaling region.

The design of the CAR goes through the following process: the first generation of CARs had only one intracellular signaling component, cd3ζ or fcγri molecule, which, due to the presence of only one activation domain within the cell, only caused transient T cell proliferation and less cytokine secretion, and did not provide long-term T cell proliferation signaling and sustained in vivo anti-tumor effects, and therefore did not achieve good clinical efficacy. The second generation CAR introduces a co-stimulatory molecule such as CD28, 4-1BB, OX40 and ICOS based on the original structure, and has greatly improved function compared with the first generation CAR, and further enhances the persistence of CAR-T cells and the killing ability to tumor cells. Some new immune co-stimulatory molecules such as CD27, CD134 are concatenated on the basis of the second generation CARs, developing into third and fourth generation CARs.

The extracellular segment of the CAR recognizes a specific antigen, and then transduces the signal through the intracellular domain, causing activated proliferation of the cell, cytolytic toxicity, and secretion of cytokines, thereby clearing the target cell. Patient autologous cells (or heterologous donors) are first isolated, CAR-producing immune cells are activated and genetically engineered, and then injected into the same patient. This way the probability of graft versus host disease is very low and the antigen is recognized by immune cells in a non-MHC restricted manner.

CAR-immune cell therapy has achieved a very high clinical response rate in hematological malignancy therapy, which is not achieved by any conventional therapeutic means, and has triggered a hot tide of clinical research worldwide.

In particular, the Chimeric Antigen Receptor (CAR) of the invention includes an extracellular domain, a transmembrane domain, and an intracellular domain.

The extracellular domain includes a target-specific binding member. The extracellular domain may be ScFv of an antibody based on specific binding of an antigen-antibody, or may be a native sequence or a derivative thereof based on specific binding of a ligand-receptor. In the present invention, the extracellular binding domain Pep42 of the chimeric antigen receptor can specifically bind to csGRP78 protein.

The intracellular domain includes a costimulatory signaling region and a zeta chain moiety. A costimulatory signaling region refers to a portion of an intracellular domain that comprises a costimulatory molecule. Costimulatory molecules are cell surface molecules that are required for the efficient response of lymphocytes to antigens, rather than antigen receptors or their ligands.

The linker can be incorporated between the extracellular domain and the transmembrane domain of the CAR, or between the cytoplasmic domain and the transmembrane domain of the CAR. As used herein, the term "linker" generally refers to any oligopeptide or polypeptide that functions to connect a transmembrane domain to the extracellular domain or cytoplasmic domain of a polypeptide chain. The linker may comprise 0-300 amino acids, preferably 2 to 100 amino acids and most preferably 3 to 50 amino acids.

The CARs of the invention, when expressed in T cells, are capable of antigen recognition based on antigen binding specificity. When it binds to its cognate antigen, affects tumor cells, causes tumor cells to not grow, to be caused to die or to be otherwise affected, and causes the patient's tumor burden to shrink or eliminate. The antigen binding domain is preferably fused to an intracellular domain from one or more of the costimulatory molecule and zeta chain. Preferably, the antigen binding domain is fused to the intracellular domain of the combination of the CD8 hinge region, CD8 transmembrane region, 4-1BB costimulatory domain, and CD3 zeta signaling domain.

For hinge and transmembrane regions (transmembrane domains), the CAR may be designed to include a transmembrane domain fused to the extracellular domain of the CAR. In one embodiment, a transmembrane domain is used that naturally associates with one of the domains in the CAR. In some examples, the transmembrane domain may be selected, or modified by amino acid substitutions, to avoid binding such domain to the transmembrane domain of the same or a different surface membrane protein, thereby minimizing interactions with other members of the receptor complex.

The intracellular domains in the CARs of the invention include a 4-1BB costimulatory domain and a signaling domain of cd3ζ.

In one embodiment of the invention, the CAR is a CAR that can specifically target csGRP 78.

Chimeric antigen receptor immune cells (CAR-immune cells)

In the present invention, a chimeric antigen receptor immune cell is provided comprising a chimeric antigen receptor of the present invention having a specific targeting Pep42 receptor (preferably csGRP 78).

The chimeric antigen receptor immune cells of the invention can be CAR-T cells, also can be CAR-NK cells and CAR-macrophages. Preferably, the chimeric antigen receptor immune cells of the invention are CAR-T cells.

As used herein, the terms "CAR-T cell", "CAR-T cell of the invention" all refer to CAR-T cells according to the fifth aspect of the invention.

CAR-T cells have the following advantages over other T cell-based therapies: (1) the course of action of CAR-T cells is not restricted by MHC; (2) In view of the fact that many tumor cells express the same tumor markers, CAR gene construction for a certain tumor marker can be widely utilized once completed; (3) The CAR can utilize not only tumor protein markers but also glycolipid non-protein markers, so that the target range of the tumor markers is enlarged; (4) The use of autologous patient cells reduces the risk of rejection; (5) The CAR-T cells have an immunological memory function and can survive in vivo for a long time.

As used herein, the terms "CAR-NK cells", "CAR-NK cells of the invention" all refer to CAR-NK cells of the fifth aspect of the invention. The CAR-NK cells of the invention can be used for tumors that are highly expressed by the Pep42 receptor, preferably csGRP 78.

Natural Killer (NK) cells are a major class of immune effector cells that protect the body from viral infection and tumor cell invasion by non-antigen specific pathways. New functions may be obtained by engineered (genetically modified) NK cells, including the ability to specifically recognize tumor antigens and enhanced anti-tumor cytotoxicity.

CAR-NK cells also have advantages over CAR-T cells, such as: (1) The perforin and the granzyme are released to directly kill tumor cells, and the perforin and granzyme have no killing effect on normal cells of the organism; (2) They release very small amounts of cytokines and thus reduce the risk of cytokine storms; (3) Is easy to expand and develop into a ready-made product in vitro. In addition, similar to CAR-T cell therapy.

Carrier body

Nucleic acid sequences encoding a desired molecule can be obtained using recombinant methods known in the art, such as, for example, by screening libraries from cells expressing the gene, by obtaining the gene from vectors known to include the gene, or by direct isolation from cells and tissues containing the gene using standard techniques. Alternatively, the gene of interest may be produced synthetically.

The invention also provides vectors comprising the nucleic acid molecules of the invention. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer, as they allow long-term, stable integration of transgenes and their proliferation in daughter cells. Lentiviral vectors have advantages over vectors derived from oncogenic retroviruses such as murine leukemia viruses because they transduce non-proliferating cells, such as hepatocytes. They also have the advantage of low immunogenicity.

In brief summary, the expression cassette or nucleic acid sequence of the invention is typically operably linked to a promoter and incorporated into an expression vector. The vector is suitable for replication and integration of eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters useful for regulating expression of the desired nucleic acid sequence.

The expression constructs of the invention may also be used in nucleic acid immunization and gene therapy using standard gene delivery protocols. Methods of gene delivery are known in the art. See, for example, U.S. Pat. nos. 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the invention provides a gene therapy vector.

The nucleic acid may be cloned into many types of vectors. For example, the nucleic acid may be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses and cosmids. Specific vectors of interest include expression vectors, replication vectors, probe-generating vectors, and sequencing vectors.

Further, the expression vector may be provided to the cell in the form of a viral vector. Viral vector techniques are well known in the art and are described, for example, in Sambrook et al (2001,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York) and other virology and molecular biology manuals. Viruses that may be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In general, suitable vectors include an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO01/96584; WO01/29058; and U.S. Pat. No. 6,326,193).

Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged into retroviral particles using techniques known in the art. The recombinant virus may then be isolated and delivered to a subject cell in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenovirus vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Additional promoter elements, such as enhancers, may regulate the frequency of transcription initiation. Typically, these are located in the 30-110bp region upstream of the start site, although many promoters have recently been shown to also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible so as to maintain promoter function when the elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased by 50bp before the activity begins to decrease. Depending on the promoter, it appears that individual elements may act cooperatively or independently to initiate transcription.

One example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is extended growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV 40) early promoter, the mouse mammary carcinoma virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the ebustan-balr (Epstein-Barr) virus immediate early promoter, the ruses sarcoma virus promoter, and human gene promoters such as but not limited to the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present invention. The use of an inducible promoter provides a molecular switch that is capable of switching on expression of a polynucleotide sequence operably linked to the inducible promoter when such expression is desired, or switching off expression when expression is undesired. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

To assess expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cell may also comprise either or both a selectable marker gene or a reporter gene to facilitate identification and selection of the expressing cell from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a single piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

The reporter gene is used to identify potentially transfected cells and to evaluate the functionality of the regulatory sequences. Typically, the reporter gene is the following gene: which is not present in or expressed by the recipient organism or tissue and which encodes a polypeptide whose expression is clearly indicated by some readily detectable property, such as enzymatic activity. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at the appropriate time. Suitable reporter genes may include genes encoding luciferases, beta-galactosidases, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or green fluorescent protein (e.g., ui-Tei et al 2000FEBS Letters479:79-82). In one embodiment of the invention, the reporter gene is a gene encoding a mKate2 red fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or commercially available. Typically, constructs with a minimum of 5 flanking regions that show the highest level of reporter gene expression are identified as promoters. Such promoter regions can be linked to reporter genes and used to evaluate agents for their ability to regulate promoter-driven transcription.

Methods for introducing genes into cells and expressing genes into cells are known in the art. In the context of expression vectors, the vector may be readily introduced into a host cell, e.g., a mammalian, bacterial, yeast or insect cell, by any method known in the art. For example, the expression vector may be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well known in the art. See, for example, sambrook et al (2001,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York). A preferred method of introducing the polynucleotide into a host cell is calcium phosphate transfection.

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method of inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. See, for example, U.S. patent nos. 5,350,674 and 5,585,362.

Chemical means for introducing the polynucleotide into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as an in vitro and in vivo delivery tool is a liposome (e.g., an artificial membrane vesicle).

In the case of non-viral delivery systems, an exemplary delivery means is a liposome. Lipid formulations are contemplated for introducing nucleic acids into host cells (in vitro, ex vivo, or in vivo). In another aspect, the nucleic acid can be associated with a lipid. The nucleic acid associated with the lipid may be encapsulated into the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution comprising the lipid, mixed with the lipid, associated with the lipid, contained in the lipid as a suspension, contained in or complexed with the micelle, or otherwise associated with the lipid. The lipid, lipid/DNA or lipid/expression vector associated with the composition is not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles or have a "collapsed" structure. They may also simply be dispersed in solution, possibly forming aggregates of non-uniform size or shape. Lipids are fatty substances, which may be naturally occurring or synthetic lipids. For example, lipids include fat droplets, which naturally occur in the cytoplasm as well as in such compounds comprising long chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

In a preferred embodiment of the invention, the vector is a lentiviral vector.

Formulations

The invention provides an engineered immune cell comprising a chimeric antigen receptor CAR according to the first aspect of the invention, a nucleic acid molecule according to the second aspect of the invention, a vector according to the third aspect of the invention, or a host cell according to the fourth aspect of the invention, or a fifth aspect of the invention, and a pharmaceutically acceptable carrier, diluent or excipient. In one embodiment, the formulation is a liquid formulation. Preferably, the formulation is an injection. Preferably, the concentration of said CAR-T cells in said formulation is 1 x 10 ³ -1×10 ⁸ Individual cells/ml, more preferably 1X 10 ⁴ -1×10 ⁷ Individual cells/ml.

In one embodiment, the formulation may include a buffer such as neutral buffered saline, sulfate buffered saline, or the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative. The formulations of the present invention are preferably formulated for intravenous administration.

Therapeutic applications

The invention includes therapeutic applications with cells (e.g., T cells) transduced with Lentiviral Vectors (LV) encoding the expression cassettes of the invention. The transduced T cells can target a marker (preferably csGRP 78) of tumor cells, and synergistically activate the T cells to cause immune cell immune response, thereby remarkably improving the killing efficiency of the transduced T cells on the tumor cells.

Accordingly, the present invention also provides a method of stimulating a T cell-mediated immune response to a target cell population or tissue of a mammal comprising the steps of: administering the CAR-cells of the invention to a mammal.

In one embodiment, the invention includes a class of cell therapies in which autologous T cells (or heterologous donors) from a patient are isolated, activated and genetically engineered to produce CAR-T cells, and subsequently injected into the same patient. This way the probability of graft versus host disease is very low and the antigen is recognized by T cells in a non-MHC restricted manner. Furthermore, a CAR-T can treat all cancers that express this antigen. Unlike antibody therapies, CAR-T cells are able to replicate in vivo, producing long-term persistence that can lead to persistent tumor control.

In one embodiment, the CAR-T cells of the invention can undergo robust in vivo T cell expansion and can last for an extended amount of time. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step in which the CAR-modified T cells induce an immune response specific for an antigen binding domain in the CAR. For example, CAR-T cells against csGRP78 elicit a specific immune response from csGRP78 positive cells.

Although the data disclosed herein specifically provide lentiviral vectors comprising Pep42 peptide segments, hinge and transmembrane regions, and 4-1BB and CD3 zeta signaling domains, the invention should be construed to include any number of variations to each of the construct components.

Treatable cancers include tumors that are not vascularized or have not been substantially vascularized, as well as vascularized tumors. Cancers may include non-solid tumors (such as hematological tumors, e.g., leukemia and lymphoma) or may include solid tumors. Types of cancers treated with the CARs of the invention include, but are not limited to, carcinomas, blastomas and sarcomas, and certain leukemia or lymphoid malignancies, benign and malignant tumors, such as sarcomas, carcinomas and melanomas. Adult tumors/cancers and pediatric tumors/cancers are also included.

Hematological cancers are cancers of the blood or bone marrow. Examples of hematologic (or hematogenic) cancers include leukemias, including acute leukemias (such as acute lymphoblastic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, granulo-monocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelogenous (myelogenous) leukemia, chronic myelogenous leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphomas, hodgkin's disease, non-hodgkin's lymphomas (indolent and high grade forms), multiple myelomas, waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia and myelodysplasia.

Solid tumors are abnormal masses of tissue that do not normally contain cysts or fluid areas. Solid tumors may be benign or malignant. Different types of solid tumors are named for the cell type that they are formed of (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors such as sarcomas and carcinomas include fibrosarcoma, myxosarcoma, liposarcoma mesothelioma, lymphoid malignancy, pancreatic cancer, ovarian cancer, breast cancer, gastric cancer, hepatobiliary cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, ovarian cancer and esophageal cancer, glioblastoma, lung cancer.

The CAR-modified T cells of the invention can also be used as a vaccine type for ex vivo immunization and/or in vivo therapy of mammals. Preferably, the mammal is a human.

For ex vivo immunization, at least one of the following occurs in vitro prior to administration of the cells into a mammal: i) Expanding the cells, ii) introducing nucleic acid encoding the CAR into the cells, and/or iii) cryopreserving the cells.

Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, cells are isolated from a mammal (preferably a human) and genetically modified (i.e., transduced or transfected in vitro) with vectors expressing the CARs disclosed herein. The CAR-modified cells can be administered to a mammalian recipient to provide a therapeutic benefit. The mammalian recipient can be a human, and the CAR-modified cells can be autologous with respect to the recipient. Alternatively, the cell may be allogeneic, syngeneic (syngeneic) or xenogeneic with respect to the recipient.

In addition to the use of cell-based vaccines for ex vivo immunization, the present invention also provides compositions and methods for in vivo immunization to elicit an immune response against an antigen in a patient.

The invention provides a method of treating a tumor comprising administering to a subject in need thereof a therapeutically effective amount of a CAR-modified T cell of the invention.

The CAR modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as IL-2, IL-17 or other cytokines or cell populations. Briefly, the pharmaceutical compositions of the invention may comprise a target cell population as described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative. The compositions of the present invention are preferably formulated for intravenous administration.

The pharmaceutical composition of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The number and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease-although the appropriate dosage may be determined by clinical trials.

When referring to "effective amount", "immunologically effective amount", "antineoplastic effective amount", "tumor-inhibiting effective amount" or "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, degree of infection or metastasis and individual differences of the condition of the patient (subject). It can be generally stated that: pharmaceutical compositions comprising T cells described herein may be administered at 10 ⁴ To 10 ⁹ A dose of individual cells/kg body weight, preferably 10 ⁵ To 10 ⁶ Individual cells/kg body weight doses (including all integer values within those ranges) are administered. T cell compositions may also be administered multiple times at these doses. Cells can be administered by using injection techniques well known in immunotherapy (see, e.g., rosenberg et al, new Eng. J. Of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by one skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject compositions may be performed in any convenient manner, including by spraying, injection, swallowing, infusion, implantation, or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intradesmally, intraspinal, intramuscularly, by intravenous (i.v.) injection or intraperitoneally. In one embodiment, the T cell compositions of the invention are administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by i.v. injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In certain embodiments of the invention, cells activated and expanded using the methods described herein or other methods known in the art for expanding T cells to therapeutic levels are administered to a patient in combination (e.g., before, simultaneously with, or after) any number of relevant therapeutic modalities, including, but not limited to, treatment with: such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or natalizumab therapy for MS patients or ertapelizumab therapy for psoriasis patients or other therapies for specific tumor patients. In a further embodiment, the T cells of the invention may be used in combination with: chemotherapy, radiation, immunosuppressives such as cyclosporine, azathioprine, methotrexate, mycophenolate and FK506, antibodies or other immunotherapeutic agents. In further embodiments, the cell compositions of the invention are administered to a patient in combination (e.g., before, simultaneously or after) with bone marrow transplantation, using a chemotherapeutic agent such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide. For example, in one embodiment, the subject may undergo standard treatment with high dose chemotherapy followed by peripheral blood stem cell transplantation. In some embodiments, the subject receives injection of expanded immune cells of the invention after transplantation. In an additional embodiment, the expanded cells are administered pre-operatively or post-operatively.

The dose of the above treatments administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. The dosage ratio administered to humans may be carried out according to accepted practices in the art. Typically, 1X 10 will be administered per treatment or per course of treatment ⁶ Up to 1X 10 ¹⁰ The CAR-T cells of the invention are administered to a patient by, for example, intravenous infusion.

The main advantages of the invention include:

1) Target specificity: taking csGRP78 as an example, csGRP78 is not basically expressed on the cell membrane of normal cells, but can be translocated to the cell membrane under the condition of endoplasmic reticulum stress (such as tumor), so that the CAR can specifically kill malignant cells with high expression of csGRP78, and basically has no killing effect on the normal cells.

2) The present invention utilizes the mode of action of ligand binding to receptor, rather than scFv in the traditional sense. The target csGRP78 has high conservation, and the safety test in animals, particularly primates, can better reflect the safety of the target csGRP78 in human bodies.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

Table a summary of amino acid sequences to which the invention relates

/>

Example 1: preparation of Pep42-CAR vector and CD19-CAR control vector

Construction of pTomo-CAR empty plasmid: the NCBI website database searches the gene sequence information of the human CD8 alpha hinge region, the human CD8 transmembrane region, the human 4-1BB intracellular region and the human CD3 zeta intracellular region, combines the gene sequence information with mKate2 to form a fusion gene, synthesizes a target fragment through Huada genes, and inserts the fragment into the pTomo lentiviral expression vector through AgeI (Thermo) and SalI (Thermo) double digestion to construct an empty plasmid. There is an NheI cleavage site between the extracellular binding domain and the transmembrane domain for subsequent cloning of the fragment of interest.

Fragment of interest (extracellular comprising antigen recognition domain portion) design, synthesis and cloning: the Pep42 sequence was translated into a DNA sequence, then CD8 signal peptide was added at the 5 'end, CD8 a hinge was added at the 3' end, and the fusion gene was assembled, and the Agel and Nhel cleavage sites were added at both ends, respectively. The DNA sequence information is as follows: ###TGCACAGTGGCTCTGCCTGGCGGCTATGTGAGAGT GTGCACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCTAGC (SEQ ID NO: 10), wherein the underlined base is the Pep42 gene coding sequence. The designed sequence is sent to Hua big gene synthesis, the target fragment is inserted into pTomo-CAR empty plasmid through AgeI (Thermo) and NheI (Thermo) double enzyme cutting connection, and pTomo-Pep42-CAR recombinant expression plasmid is constructed. The recombinant plasmid was sequenced and the sequencing results were aligned to confirm whether the plasmid was correct.

The CD19-CAR control plasmid construction was identical to the Pep42-CAR plasmid construction, except that the antigen recognition region was replaced with anti-CD19 scFv (Fmc 63).

All plasmids were extracted with QIAGEN endotoxinfree megapump kit and the purified plasmids were lentivirally packaged by transfecting HEK293T cells with Biyundian lipo8000 transfection reagent.

Example 2: virus package

Packaging in 15cm dish with HEK293T cells less than 20 passages, and preparing 2ml Opti-MEM when HEK293T cells are transfected with confluence of 80% -90% ^TM Plasmid mixture (core plasmid 20ug, pCMV Δr8.9ug, pmd 2.g4ug) dissolved in medium; in another centrifuge tube 2ml Opti-MEM ^TM Culture medium and 68ul lipo8000 transfection reagent. After standing at room temperature for 5min, the plasmid complex was added to the liposome complex, and standing at room temperature for 20min. The above mixture was added dropwise to HEK293T cell culture dishes and the medium was removed after incubation at 37 ℃ for 6 hours. The preheated complete medium was re-added. The virus supernatant was collected for 48 hours and 72 hours, centrifuged at 3000rpm at 4℃for 15 minutes, and then filtered with a 0.45um filter membrane and centrifuged at 25000rpm at 4℃for 2.5 hours for virus concentration. Concentrated virus is dissolved by 30ul virus dissolving solution overnight and then packaged and frozen for storage Viral titers were detected by qPCR at-80℃in a refrigerator.

Example 3: CAR-T cell preparation

Mononuclear cells are separated from human peripheral blood by Ficoll separating liquid, and CD3+ T cells are obtained by separating and purifying by RosetteSep Human T Cell Enrichment Cocktail (Stemcell technologies) kit, and are sub-packaged and frozen in liquid nitrogen. The CAR-T cells were resuscitated prior to preparation, activated with CD3/CD28 magnetic beads (Life technology), and 200U/ml IL2 (PeproTech) was added to stimulate culture for 48 hours before virus infection. Lentiviruses infected T cells in the presence of lentiboost to prepare CAR-T cells at moi=20. The medium was changed one day after infection.

Example 4: detection of positive rate of infected CAR-T cells by flow cytometry

CAR-T cells and NTD cells (control) after 72 hours of virus infection were collected separately by centrifugation, the supernatant was washed once with PBS, the cells were resuspended in PBS containing 2% fbs, and the positive rate was detected by flow.

The results of transfection efficiency are shown in FIG. 2. The results show that after the CAR-T2A-mKate2 fusion protein expressed by the CAR-T cells is cut, the formed mKate2 protein shows red fluorescence in cells. Red fluorescence detection by flow cytometry shows that the positive expression rate of CD19-CAR-T is about 78.9%, the positive expression rate of Pep42-CAR-T is about 81%, and the positive rates of the two are equivalent.

Example 5: CAR-T cell proliferation assay

Lentiviral infection 1 x 10 ⁵ After culturing for 72h, T cells were collected, 1mlT cell culture medium resuspension count was taken, designated day3, and 4 x 10 ⁵ The cells were further cultured and counted after 72 hours, designated day6, and the cycle was continued for a total of 12 days. CAR-T cell proliferation curves were plotted against total number of cells at each time point and evaluation was made for proliferation of Pep42-CAR-T cells. The total number of cells at each time point is equal to the time point cell count multiplied by the previous time point magnification.

As shown in fig. 3, there was no significant inhibition of Pep42-CAR-T cell proliferation compared to NTD and CD19-CAR-T groups.

Example 6: detection of csGRP78 expression in target cells

For adherent cells, a cell climbing sheet with the diameter of 14mm is firstly put into a 24-hole plate, and then 2 x 10 is used ⁵ The amount of wells/target cells were seeded and stained after 24 hours. For suspension growth cells, 2.5×10 was taken directly ⁵ Individual cells were stained. Cells were first washed 1 time with PBS, then incubated with GRP78 primary antibody (1:200, P1-014A, thermof iotaber) diluted with PBS containing 2% FBS at room temperature for 1h, washed 1 time with PBS, 5min, fixed 15min at room temperature with 4% PFA, washed 1 time with PBS, 5min, blocked with PBS blocking solution containing 2.5% BSA, 10% goat serum and 0.1% Tween-20 for 1h, and Cy3 secondary antibody diluted with blocking solution (1:1000, A10520, thermof iotaber) incubated at room temperature for 1h, washed 1 time with PBS, 5min, DAPI stained nuclei, and finally confocal microscopy imaged.

As shown in FIG. 4, the result of the csGRP78 immune cell fluorescence detection shows that SMMC7721, hepG2 and MHCC97H liver cancer cells, bxpc-3 pancreatic cancer cells, KG-1a acute myelogenous leukemia cells and HL-60 human acute promyelocytic leukemia cells have higher expression levels of csGRP 78.

Example 7: construction of target cells carrying luciferases

The luciferase fragment was PCR amplified from pGL3-luciferase plasmid, and then ligated into pTomo vector by XbaI and BamHI to construct pTomo-luciferase plasmid. IRES and puromycin fragments were amplified from pTomo and PLkO.1 plasmids, respectively. The pTomo-luciferase-IRES-Puro plasmid was constructed successfully by three fragment ligation. Lentiviral packaging and titre assay as described above, HEK293T-luciferas, hepG-luciferase, MHCC97H-luciferase, SMMC7721-luciferase, bxPc 3-luciferases and PANC 1-luciferases cells were obtained by infecting human embryonic kidney HEK293T cells, human liver cancer cell lines HepG2, MHCC97H and SMMC7721, pancreatic cancer cell lines BxPC3 and PANC1, respectively, with puromycin (1 ug/ml) for 1 week after 48 hours.

Example 8: killing tumor cells by CAR-T cells

Adherent cells: the cell density was adjusted to 2X 10 after digestion and counting of target cells labeled with luciferases ⁴ 100ul of the cells were plated into 96-well plates per ml. CAR-T/NTD cells were adjusted to a cell density of 1X 10 ⁵ Each ml was inoculated into a black 96-well microplate at E: T of 0.5:1, 1:1, 2:1, 4:1 or 8:1, 100ul per well. Mixing the target cells and the T cells uniformly, and then placing the mixture in an incubator for incubation for 24 hours. Cell supernatants were collected and frozen at-80℃for detection of IFNγ release. Cell killing was detected using a fluorescence detection kit (Promega product), cells were first treated with 35ul of 1 XPLB lysate for 20 minutes, and immediately after 30ul of substrate was added to each well, detected using a BioTek microplate reader.

Suspension cells: collecting target cells, re-suspending the basal medium, and adjusting the cell density to 1×10 ⁶ -1×10 ⁷ In the range of individual/ml, 1. Mu.l of CFSE was added to dye in a dark place, and after termination of the staining, the cells were counted and the cell concentration was adjusted to 3X 10 ⁵ 100ul of the cells were plated into 96-well plates per ml. Cell densities were adjusted to 1.5X10 by adjusting CAR-T/NTD cells, respectively ⁶ Per ml, 0.75X10) ⁶ Per ml, 0.3X10) ⁵ Individual/ml and 0.15X10 ⁶ Each ml was plated into transparent 96-well cell culture plates at E: T of 0.5:1, 1:1, 2.5:1 or 5:1, 100ul each. Mixing the target cells and the T cells uniformly, and then placing the mixture in an incubator for incubation for 24 hours. Cell supernatants were collected and frozen at-80℃for detection of IFNγ release. Cell killing was detected by flow cytometry using PI staining.

Cytotoxic killer cell% = (1-target cell fluorescence value at effector cell-containing/target cell fluorescence value at effector cell-null) ×100%

As shown in FIG. 5, the killing conditions of Pep42-CAR-T on target cells are shown, and compared with NTD group and CD19-CAR-T group, pep42-CAR-T has strong killing effect on csGRP78 positive SMMC7721, hepG2 and MHCC97H three liver cancer cells, bxpc3 pancreatic cancer cells, KG-1a acute myelogenous leukemia cells and HL-60 human acute promyelocytic leukemia cells. The figures (p < 0.05) or (p < 0.01) represent statistically significant differences in Pep42-CAR-T groups compared to CD19-CAR-T groups at each target ratio.

Example 9: IFNgamma cytokine release

After thawing the cell supernatant collected in example 8 at-80 ℃, ifnγ was detected according to IFN gamma Human ELISA Kit (life technology).

The standard was dissolved with Standard Dilution Buffer and diluted in a gradient to 1000pg/ml, 500pg/ml, 250pg/ml, 125pg/ml, 62.5pg/ml, 31.2pg/ml, 15.6pg/ml, 0 pg/ml.

50ul Incubation buffer, 50ul of detection sample and 50ul of IFN gamma biotin conjugated solution are added into each hole, and the mixture is stirred uniformly and then kept stand for 90 minutes at room temperature.

Then sequentially operating according to the following steps:

(1) Wells were washed 4 times with 1 XWash Buffer, each for 1 min.

(2) 100ul 1*Streptavidin-HRP solution was added to each well and allowed to stand at room temperature for 45 minutes.

(3) Wells were washed 4 times with 1 XWash Buffer, each for 1 min.

(4) 100ul Stabilized chromogen was added thereto and allowed to stand at room temperature for 30 minutes.

(5) 100ul of Stop solution was added to each well and mixed well.

(6) Absorbance was measured at 450 nm.

The detection of ifnγ release is shown in fig. 6, where the amount of ifnγ released was significantly up-regulated in the Pep42-CAR-T group cell co-culture supernatants compared to the NTD group and CD19-CAR-T group. The graph shows that Pep42-CAR-T group showed very significant differences in statistics compared to either NTD group or CD19-CAR-T group (p < 0.01).

Example 10: effect on Pep42-CAR-T killing after csGRP78 overexpression

NCBI obtains human GRP78 coding sequence (CCDS 6863.1), synthesizes primer, adds XbaI and BamHI restriction sites into upstream primer and downstream primer respectively, obtains GRP78 coding region by in vitro PCR amplification, connects to pTomo empty plasmid by double restriction enzyme, and constructs pTomo-CMV-GRP78-IRES2-EGFP lentiviral expression plasmid.

Although it has been demonstrated that membrane metastasis of GRP78 occurs spontaneously in tumor cells, there are different cases of tumor cells and no csGRP78 expression in tumor cells, which makes it difficult to achieve up-regulation of csGRP78 by simply overexpressing exogenous GRP78 in csGRP 78-negative tumor cells. The multi-strain cell test shows that the human CD3+ T cells are special and can be used for specific verification of Pep42-CAR targeting csGRP 78.

EGFP and GRP78 are co-expressed in T cells, and the PI staining condition of EGFP positive CD3+ T cells is detected by using a flow cytometry, so that the cell killing condition is observed. Meanwhile, release of ifnγ in the supernatant of co-cultured cells was detected using ifnγ Human ELISA Kit (life technology), and the procedure was as described in example 8 and example 9.

The detection of Pep42-CAR-T killing of cd3+ T cells after overexpression of GRP78 is shown in fig. 7 (left), with GRP78 overexpression in cd3+ T cells causing significant killing of Pep 42-CAR-T. Ifnγ release as shown in fig. 7 (right), pep42-CAR-T released ifnγ in large amounts, killing cd3+ T cells that overexpressed GRP 78. In fig. 7 (p < 0.01) represents that GRP78 overexpressing cd3+ T cells and Pep42-CAR-T co-cultured groups were statistically significantly different compared to any other group.

Example 11: killing effect of Pep42-CAR-T in normal cells and csGRP78 low expression tumor cells

HEK293T cells are a human normal embryo kidney source cell line, PANC1 cells are human pancreatic cancer cells with low csGRP78 expression, pep42-CAR-T cells are respectively incubated with HEK293T and PANC1 cells according to an effective target ratio (E: T=5:1), and the killing of the Pep42-CAR-T cells on the two strains of cells is detected through fluorescence value change.

As shown in FIG. 8, the csGRP78 staining shows that the csGRP78 has a small expression level in PANC1 cells, and the Pep42-CAR-T has no obvious killing effect on HEK293T and PANC1 cells. The result proves that the Pep42-CAR-T has no killing effect on normal cells and tumor cells with low expression of csGRP78, and has high specificity.

Example 12: pep42-CAR-T non-human primate in vivo safety assessment

Mononuclear cells are separated from peripheral blood of macaque by Ficoll separating liquid, and CD3+ T cells are obtained by separating and purifying by a RosetteSep Human T Cell Enrichment Cocktail (Stemcell technologies) kit. T cells were activated with CD3/CD28 magnetic beads (Life technology), 200U/ml IL2 (PeproTech) was added, and after 48 hours of stimulated culture, pep42-CAR lentiviral infection was performed. Lentiviruses infected monkey T cells in the presence of lentiboost to prepare CAR-T cells at moi=200. CAR-T cells 4 days after virus infectionAccording to 5 x 10 ⁶ The amount of individual/kg body weight was returned intravenously to the macaque and the body temperature, body weight, blood pressure and heart rate of the macaque were monitored periodically.

As shown in fig. 9, pep42-CAR-T was infused back into healthy macaque for a period of time (42 days), and the body temperature, body weight, blood pressure and heart rate of the macaque were not changed abnormally, compared with those before infusion, and showed better safety.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> Huaxi Hospital at university of Sichuan

<120> preparation and application of chimeric antigen receptor immune cell constructed based on polypeptide Pep42

<130> P2021-1801

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 13

<212> PRT

<213> Homo sapiens (Homo sapiens)

<400> 1

Cys Thr Val Ala Leu Pro Gly Gly Tyr Val Arg Val Cys

1 5 10

<210> 2

<211> 233

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Ser Glu Leu Ile Lys Glu Asn Met His Met Lys Leu Tyr Met Glu

1 5 10 15

Gly Thr Val Asn Asn His His Phe Lys Cys Thr Ser Glu Gly Glu Gly

20 25 30

Lys Pro Tyr Glu Gly Thr Gln Thr Met Arg Ile Lys Ala Val Glu Gly

35 40 45

Gly Pro Leu Pro Phe Ala Phe Asp Ile Leu Ala Thr Ser Phe Met Tyr

50 55 60

Gly Ser Lys Thr Phe Ile Asn His Thr Gln Gly Ile Pro Asp Phe Phe

65 70 75 80

Lys Gln Ser Phe Pro Glu Gly Phe Thr Trp Glu Arg Val Thr Thr Tyr

85 90 95

Glu Asp Gly Gly Val Leu Thr Ala Thr Gln Asp Thr Ser Leu Gln Asp

100 105 110

Gly Cys Leu Ile Tyr Asn Val Lys Ile Arg Gly Val Asn Phe Pro Ser

115 120 125

Asn Gly Pro Val Met Gln Lys Lys Thr Leu Gly Trp Glu Ala Ser Thr

130 135 140

Glu Thr Leu Tyr Pro Ala Asp Gly Gly Leu Glu Gly Arg Ala Asp Met

145 150 155 160

Ala Leu Lys Leu Val Gly Gly Gly His Leu Ile Cys Asn Leu Lys Thr

165 170 175

Thr Tyr Arg Ser Lys Lys Pro Ala Lys Asn Leu Lys Met Pro Gly Val

180 185 190

Tyr Tyr Val Asp Arg Arg Leu Glu Arg Ile Lys Glu Ala Asp Lys Glu

195 200 205

Thr Tyr Val Glu Gln His Glu Val Ala Val Ala Arg Tyr Cys Asp Leu

210 215 220

Pro Ser Lys Leu Gly His Lys Leu Asn

225 230

<210> 3

<211> 21

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro

20

<210> 4

<211> 45

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

35 40 45

<210> 5

<211> 24

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

1 5 10 15

Ser Leu Val Ile Thr Leu Tyr Cys

20

<210> 6

<211> 43

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met

1 5 10 15

Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe

20 25 30

Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg

35 40

<210> 7

<211> 111

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 7

Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln

1 5 10 15

Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp

20 25 30

Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro

35 40 45

Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp

50 55 60

Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg

65 70 75 80

Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr

85 90 95

Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

100 105 110

<210> 8

<211> 257

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 8

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Cys Thr Val Ala Leu Pro Gly Gly Tyr Val Arg

20 25 30

Val Cys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

35 40 45

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

50 55 60

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile

65 70 75 80

Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser

85 90 95

Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr

100 105 110

Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu

115 120 125

Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu

130 135 140

Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln

145 150 155 160

Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu

165 170 175

Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly

180 185 190

Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln

195 200 205

Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu

210 215 220

Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr

225 230 235 240

Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro

245 250 255

Arg

<210> 9

<211> 771

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atggccctgc ccgtcaccgc tctgctgctg ccccttgctc tgcttcttca tgcagcaagg 60

ccgtgcacag tggctctgcc tggcggctat gtgagagtgt gcaccacgac gccagcgccg 120

cgaccaccaa caccggcgcc caccatcgct agccagcccc tgtccctgcg cccagaggcg 180

tgccggccag cggcgggggg cgcagtgcac acgagggggc tggacttcgc ctgtgatatc 240

tacatctggg cgcccttggc cgggacttgt ggggtccttc tcctgtcact ggttatcacc 300

ctttactgca aacggggcag aaagaaactc ctgtatatat tcaaacaacc atttatgaga 360

ccagtacaaa ctactcaaga ggaagatggc tgtagctgcc gatttccaga agaagaagaa 420

ggaggatgtg aactgagagt gaagttcagc aggagcgcag acgcccccgc gtacaagcag 480

ggccagaacc agctctataa cgagctcaat ctaggacgaa gagaggagta cgatgttttg 540

gacaagagac gtggccggga ccctgagatg gggggaaagc cgagaaggaa gaaccctcag 600

gaaggcctgt acaatgaact gcagaaagat aagatggcgg aggcctacag tgagattggg 660

atgaaaggcg agcgccggag gggcaagggg cacgatggcc tttaccaggg tctcagtaca 720

gccaccaagg acacctacga cgcccttcac atgcaggccc tgccccctcg c 771

<210> 10

<211> 170

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

accggtgcgc tgccaccatg gccctgcccg tcaccgctct gctgctgccc cttgctctgc 60

ttcttcatgc agcaaggccg tgcacagtgg ctctgcctgg cggctatgtg agagtgtgca 120

ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgctagc 170

Claims (10)

1. A Chimeric Antigen Receptor (CAR), wherein the CAR comprises an extracellular binding domain, the extracellular binding domain is capable of specifically binding to a Pep42 receptor, and the extracellular binding domain has a cyclic peptide structure.

2. The chimeric antigen receptor according to claim 1, wherein the extracellular binding domain comprises a Pep42 peptide fragment, and wherein the Pep42 peptide fragment has the amino acid sequence shown in SEQ ID No. 1.

3. The chimeric antigen receptor of claim 1 or 2, wherein the CAR has the structure of formula I:

L-EB-H-TM-C-CD3ζ-RP (I)

in the method, in the process of the invention,

each "-" is independently a connecting peptide or peptide bond;

l is an absent or signal peptide sequence;

EB is an extracellular binding domain;

h is a no or hinge region;

TM is a transmembrane domain;

c is an absent or co-stimulatory signaling molecule;

cd3ζ is a cytoplasmic signaling sequence derived from cd3ζ;

RP is absent or reporter.

4. A nucleic acid molecule encoding the chimeric antigen receptor of claim 1.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A host cell comprising the vector or chromosome of claim 5 integrated with an exogenous nucleic acid molecule of claim 4 or expressing the CAR of claim 1.

7. An engineered immune cell comprising the vector of claim 5 or the nucleic acid molecule of claim 4 or the CAR of claim 1 integrated into a chromosome.

8. A method of preparing the engineered immune cell of claim 7, comprising the steps of: transduction of the nucleic acid molecule according to claim 4 or the vector according to claim 5 into an immune cell, thereby obtaining said engineered immune cell.

9. A pharmaceutical composition comprising the CAR of claim 1, the nucleic acid molecule of claim 4, the vector of claim 5, the host cell of claim 6, and/or the engineered immune cell of claim 7, and a pharmaceutically acceptable carrier, diluent or excipient.

10. Use of a CAR according to claim 1, a nucleic acid molecule according to claim 4, a vector according to claim 5, or a host cell according to claim 6, and/or an engineered immune cell according to claim 7, for the preparation of a medicament or formulation for the prevention and/or treatment of a tumor.

Images