CN116102650A - Neutralizing Fn14 monoclonal antibody and application thereof in preparation of psoriasis prevention and treatment drugs - Google Patents

Abstract

The invention discloses a neutralizing Fn14 monoclonal antibody and application thereof in preparation of a medicament for preventing and treating psoriasis, and belongs to the technical field of antibody medicament preparation. Adopting immune enhancement factor cpG-ODN to improve the expression of B cell surface antigen presentation related molecules; coupling Fn14 polypeptide antigen and virus vector to obtain antibody with higher titer. The antibody can competitively bind to Fn14 protein, block the binding of TWEAK and receptor Fn14, and inhibit the expression of pro-inflammatory factors and chemokines in downstream reactions. Experiments show that the neutralizing Fn14 monoclonal antibody can thin the epidermis of a mouse, has excessive keratinization, slight keratinization, increased particle layers, improved symptoms such as tissue cell infiltration, lymphocyte infiltration, superficial dermal telangiectasia, congestion and the like, has no influence on blood routine and liver and kidney functions, has good safety, and can be applied to the preparation of medicaments for preventing and treating psoriasis.

Description

Neutralizing Fn14 monoclonal antibody and application thereof in preparation of psoriasis prevention and treatment drugs

Technical Field

The invention belongs to the technical field of antibody medicine preparation, and particularly relates to a neutralizing Fn14 monoclonal antibody and application thereof in preparation of a medicine for preventing and treating psoriasis.

Background

Psoriasis is a chronic inflammatory immune skin disease caused by genetic factors and environmental factors, and is mainly characterized by epidermal hyperplasia and dermal inflammatory cell infiltration caused by abnormal proliferation of keratinocytes. Typically manifesting as well-defined erythema, silvery white scales on the surface, and pathological manifestations of hyperkeratosis or hypokeratosis often involve the scalp and the extending sides of the extremities, but also the palms, soles, nails, genitals, etc. The incidence rate of the psoriasis in European and American countries is about 2% -3%, and the incidence rate of the psoriasis in China is about 0.46%. Psoriasis has a complex pathogenesis and relates to a plurality of links such as vascular proliferation migration, natural T cell differentiation, inflammatory cell infiltration, keratinocyte differentiation abnormality and the like. The main mechanism is that dendritic cells are stimulated to produce cytokines such as Tumor Necrosis Factor (TNF) -alpha, interleukin (IL) -23 and the like, IL-23 stimulates Th17 cells to produce IL-17 and IL-22, and the cytokines and TNF-alpha act on epidermal keratinocytes together through Janus kinase/signal transduction and transcription activator pathway (JAK-STAT 3) to cause various manifestations of psoriasis.

The current common medicines for clinically treating psoriasis comprise glucocorticoid, vitamin D3 derivative, tretinoin, calcineurin inhibitor, dithranol, tar preparation, combined treatment and other modes. However, long-term use of corticosteroids causes skin atrophy and loss of efficacy, and vitamin D drugs have the disadvantage of having photosensitivity and being liable to cause hypercalcemia, although they have small side effects, thus limiting clinical use of these drugs. Biological agents are also the current research hot spot for psoriasis treatment, and the current common biological agents are mainly drugs targeting TNF-alpha, IL-23/Th17 axis and CD molecules, so that the treatment effect is superior to the traditional drugs, but the clinical results show that part of antibodies have poor safety. Therefore, a medicament which has good safety and can effectively improve psoriasis is urgently needed.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention aims to provide the neutralizing Fn14 monoclonal antibody and the application thereof in preparing the medicament for preventing and treating the psoriasis, and the neutralizing Fn14 monoclonal antibody is used as the medicament with better safety and capable of effectively improving the psoriasis.

In order to achieve the above purpose, the invention is realized by adopting the following technical scheme:

the invention discloses a neutralizing anti-Fn14 monoclonal antibody, which is prepared by taking Fn14 antigen and a viral vector as immunogens to immunize animals, taking spleen cells of the animals to carry out cell fusion with SP2/0, and carrying out subcloning screening, cell construction and in-vivo ascites induction; wherein the amino acid sequence of the Fn14 antigen is shown as SEQ.ID.1.

Preferably, the viral vector is keyhole limpet hemocyanin.

Preferably, the animal is a BALB/c mouse.

Further preferably, the Fn14 polypeptide antigen is conjugated to keyhole limpet hemocyanin via SMCC.

Preferably, the immunogen is further added with a CpG ODN, and the nucleotide sequence of the CpG ODN is shown as SEQ.ID.2.

Further preferably, the immunogen comprises a prime antigen, a di-immune antigen, a tri-immune antigen, a tetra-immune antigen and a penta-immune antigen; the primary antigen is obtained by uniformly mixing and emulsifying the coupled Fn14 antigen and Freund's complete adjuvant added with CpG ODN in an equal volume, the secondary antigen, the tertiary antigen and the quaternary antigen are obtained by uniformly mixing and emulsifying the coupled Fn14 antigen and Freund's incomplete adjuvant added with CpG ODN in an equal volume, and the penta-antigen is obtained by mixing the coupled Fn14 antigen and normal saline in an equal volume.

The invention also discloses application of the neutralizing anti-Fn14 monoclonal antibody in preparation of a medicament for preventing and treating psoriasis.

Preferably, the drug targets Fn14 at the gene level/protein level.

Preferably, the amount of the neutralizing anti-Fn14 monoclonal antibody administered to the animal is 1 to 10mg/kg.

The invention also discloses a pharmaceutical composition for preventing and treating psoriasis, which comprises an effective amount of the neutralizing anti-Fn14 monoclonal antibody.

Compared with the prior art, the invention has the following beneficial effects:

the neutralizing anti-Fn14 monoclonal antibody provided by the invention is characterized in that Fn14 polypeptide antigen and a viral vector are coupled, the coupled vector contains virus-like protein, the coupled vector has a strong stimulation effect on immune response of an organism, and the obtained antibody has higher titer. The antibody can competitively bind Fn14 protein, block the binding of TWEAK and receptor Fn14, inhibit the expression of pro-inflammatory factors and chemotactic factors in downstream reaction, and is expected to provide a new idea for targeted treatment of psoriasis. In experiments, the neutralizing anti-Fn14 monoclonal antibody with proper concentration is used for treating the psoriasis mouse model induced by imiquimod, so that the erythema, the scales and the thickness of the skin lesions can be improved, and the infiltration degree of inflammatory cells can be reduced. Experiments prove that the mouse with imiquimod group has thicker spiny layer, obviously reduced particle layer and upward extension of dermal emulsion, has tissue cell and lymphocyte infiltration, and has the functions of dilating and engorging capillary vessel in the shallow dermis. The neutralizing anti-Fn14 monoclonal antibody can thin the epidermis of a mouse after treatment, has the advantages of excessive keratinization, slight keratinization, increased granular layers, and improved symptoms such as histiocyte infiltration, lymphocyte infiltration, superficial dermal telangiectasia, congestion and the like. Meanwhile, the traditional Chinese medicine composition has no influence on blood routine and liver and kidney functions, has good safety, and can effectively relieve development of psoriasis models. Therefore, neutralizing anti-Fn14 mab is expected to be an effective means of treating psoriasis.

Furthermore, the antigen sequence of the anti-Fn14 monoclonal antibody is shorter, and the immune enhancement factors cpG-ODN and cpG-ODN are adopted in the preparation process of the antibody, so that the expression of the B cell surface antigen presentation related molecules can be improved.

Drawings

FIG. 1 is a graph showing the change in appearance of skin lesions on the back of mice in a blank control group, a negative control group, an imiquimod group and a neutralizing anti-Fn14 mab-treated group;

FIG. 2 is a graph of PASI score results for mice administered by different injection methods; wherein, each graph is respectively a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug) from left to right, A is subcutaneous injection, and B is intraperitoneal injection;

FIG. 3 is a graph showing the results of changes in various indices of liver and kidney function in mice after administration by different injection methods; wherein each graph is from left to right a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug), A is glutamic oxaloacetic transaminase data after subcutaneous injection, and B is albumin data after subcutaneous injection; c is glutamic oxaloacetic transaminase data after intraperitoneal injection, D is albumin data after intraperitoneal injection, E is blood creatinine data after subcutaneous injection, F is urea nitrogen data after subcutaneous injection, G is blood creatinine data after intraperitoneal injection, and H is urea nitrogen data after intraperitoneal injection;

FIG. 4 is a graph showing the conventional change level of blood of mice after administration by different injection methods; wherein, each graph is from left to right a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug), A is monocyte data after subcutaneous injection, and B is lymphocyte data after subcutaneous injection; c is eosinophil data after subcutaneous injection, D is monocyte data after intraperitoneal injection, E is lymphocyte data after intraperitoneal injection, and F is eosinophil data after intraperitoneal injection;

FIG. 5 is a graph showing the HE staining results of the back skin of each group of mice after subcutaneous injection; wherein bar=100 μm, from left to right, from top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 6 is a graph showing the results of HE staining of the back skin of each group of mice after intraperitoneal administration; wherein bar=100 μm, from left to right, from top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 7 is a graph showing the results of pathology scoring in mice after administration by different injection methods; wherein, each graph is respectively a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug) from left to right, A is subcutaneous injection, and B is intraperitoneal injection;

FIG. 8 is a graph showing the results of immunohistochemical detection of CD3 in skin lesion tissue on the back of mice after administration by subcutaneous injection; wherein bar=50 μm, from left to right, top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 9 is a graph showing the results of immunohistochemical detection of CD3 in the back skin lesion tissue of mice after administration by intraperitoneal injection; wherein bar=50 μm, from left to right, top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 10 shows semi-quantitative statistics of CD3 on back skin lesions of mice after different injections; wherein, each graph is respectively a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug) from left to right, A is subcutaneous injection, and B is intraperitoneal injection;

FIG. 11 is a graph showing immunohistochemical staining results of F4/80 on back skin lesion tissue of mice after subcutaneous injection; wherein bar=50 μm, from left to right, top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 12 is a graph showing immunohistochemical staining results of F4/80 on the back skin lesion tissue of mice after intraperitoneal administration; wherein bar=50 μm, from left to right, top to bottom, is a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 mab treatment group (1 μg), a neutralizing anti-Fn14 mab treatment group (5 μg), a neutralizing anti-Fn14 mab treatment group (10 μg), respectively;

FIG. 13 is a semi-quantitative statistical result of the back skin lesion F4/80 of the mice after administration by different injection methods; wherein, each graph is respectively a blank control group, a negative control group, an imiquimod group, a neutralizing anti-Fn14 monoclonal antibody treatment group (1 mug), a neutralizing anti-Fn14 monoclonal antibody treatment group (5 mug) and a neutralizing anti-Fn14 monoclonal antibody treatment group (10 mug) from left to right, A is subcutaneous injection, and B is intraperitoneal injection.

Detailed Description

In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, shall fall within the scope of the present invention.

It should be noted that the terms "first," "second," and the like in the description and the claims of the present invention and the above figures are used for distinguishing between similar objects and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The invention is described in further detail below with reference to the attached drawing figures:

the neutralizing anti-Fn14 monoclonal antibody for treating psoriasis provided by the invention takes Fn14 (anti-fibroblast growth factor 14) as a drug target, and successfully injects antigen polypeptide of Fn14 into an immunized mouse body to construct a stable monoclonal cell strain. The antigen can stimulate the organism to generate high-potency anti-Fn14 neutralizing antibodies. The mice immunized by the antibody have obviously reduced psoriasis symptoms after being induced by imiquimod. T cell and macrophage infiltration is an important feature of skin inflammation, and experiments show that the neutralizing anti-Fn14 monoclonal antibody with proper concentration can reduce T lymphocyte and macrophage infiltration and improve erythema, scales and skin lesion thickness. The effect of neutralizing Fn14 monoclonal antibody in the disease treatment process is clarified by discussing the prevention and treatment effect of neutralizing Fn14 monoclonal antibody in psoriasis, and by detecting the expression condition and pathological change of inflammatory cells in skin tissues of mice and whether abnormal blood circulation and liver and kidney function conditions exist.

Preparation of 1Anti-Fn14 monoclonal antibody

Fn14 is synthesized into polypeptide and coupled, BALB/c mice are immunized to generate antibodies aiming at antigens, and fusion screening is carried out to obtain stable monoclonal cell strains. The monoclonal cell strain is cultured and then injected into the abdominal cavity of a mouse to prepare ascites. Antibodies were collected from ascites by purification and were subjected to enzyme-linked immunosorbent assay (ELISA) titers.

1) Materials, reagents and instruments

The main materials and reagents used in the experiments are shown in Table 1:

TABLE 1 materials and reagents

The main instruments used in the experiments are shown in Table 2:

table 2 instrument

Name of the name	Suppliers (suppliers)	Production area
			Super clean bench	BHC	China
Enzyme label instrument	thermo	USA
			Micro-spectrophotometer	thermo	USA
-80 ℃ ultralow temperature refrigerator	Sea Er	China

2) Experimental procedure

Antigen treatment: fn14 polypeptide (the amino acid sequence is shown as SEQ.ID.1 in Table 3) is connected to a carrier KLH (namely keyhole limpet hemocyanin) through a coupling agent SMCC (4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester) to obtain Fn14 antigen polypeptide after coupling; cpG ODN enhancing factors (nucleotide sequences shown as SEQ. ID.2 in Table 3) were added to Freund's complete adjuvant and Freund's incomplete adjuvant, respectively, to promote immune response;

the priming antigen is Fn14 antigen polypeptide after coupling and Freund's complete adjuvant added with CpG ODN enhancement factors in equal volume are uniformly mixed and emulsified; the second, third and fourth immune antigens are Fn14 antigen polypeptide after coupling and Freund incomplete adjuvant added with CpG ODN enhancement factors in equal volume are uniformly mixed and emulsified; the fifth free impact is that Fn14 antigen polypeptide is mixed with an equal volume of normal saline after coupling, and the mixture is subjected to impact immunization.

Table 3 sequence listing

Name of the name	Sequence(s)	Sequence number
			Fn14 antigen	EQAPGTSPC	SEQ.ID.1
CpG ODN	tccatgacgttcctgacgtt	SEQ.ID.2

Animal immunization: healthy BALB/c mice are selected and used for 6-8 weeks old. Priming at day 1, the dose of priming antigen injected was 200 μg/dose; on day 14, the dose of the second-level antigen is 100 mug/dose; on day 28, the dose of the three-way antigen is 100 mug/dose; on day 42, the dosage of the four-way antigen is 100 mug/mouse, blood is collected on day 49 after four-way, 10 mug of mouse tail vein is collected, and ELISA detection of antiserum titer is carried out; penta-immune on day 56, the dose of penta-immune antigen was injected at 100 μg/dose.

Cell fusion: five days after the five-shot impact, the spleens of the mice were taken, ground, subjected to cell fusion with SP2/0, and plated.

Subcloning screening: cells were observed with a microscopic microscope 14-16 days after fusion, and the supernatant ELISA was taken for detection. Positive well cells were transferred and limited diluted and entered into the first round of subcloning screening. After 6-7 days, the cells were observed by microscopic examination, and the supernatant ELISA was taken for detection. The positive well cells were then transferred and limiting diluted and entered into a second round of subcloning screening. After 5-6 days, the cells were observed again by microscopic examination, and the supernatant ELISA was taken for detection. Finally, positive well cells were transferred to wells and subjected to limiting dilution and a third round of subcloning screening.

Cell establishment: after the third subcloning screening, ELISA was used to detect positive cell lines, and after expansion culture, 90% of the cells were plated, a small amount of cells were taken out into T25 flasks, and the remaining cells were collected and frozen.

Preparing ascites: healthy BALB/c mice were injected with mineral oil one week in advance. Cells were cultured in T25 flasks until 90% confluence, and cells were collected and injected into the abdominal cavity of mice. The abdominal cavity of the mice is observed within 8-20 days, and the mice bulge to the limit of movement. And collecting ascites.

Purifying ascites: the collected ascites were centrifuged and filtered, diluted with equal volume PBS, protein A/G purified, and antibody was collected.

Antibody ELISA detection:

a) Coating antigen: fn14 antigen was diluted to 3. Mu.g/mL with 1.05mol/L carbonate (pH=9.6),

100. Mu.L/well, incubated overnight at 4 ℃.

b) Washing the plate: the samples were removed and washed three times for 3 minutes with 0.05% Tween-20 (PBST).

c) Closing: mu.L of 5% skim milk Powder (PBST) was added to each well and the wells were blocked at 37℃for 120 minutes. d) Washing the plate: the samples were removed and washed three times for 3 minutes with 0.05% Tween-20 (PBST).

e) Adding an antibody: the collected antibodies were diluted 1:1000 in PBS buffer, and then diluted in a double ratio to 1:512K and incubated at 37℃for 1 hour.

f) Washing the plate: the samples were removed and washed three times for 3 minutes with 0.05% Tween-20 (PBST).

g) Adding a secondary antibody: goat anti-rabbit IgG (H+L) labeled with horseradish enzyme was diluted 1:8000 and incubated at 37℃for 45 min. h) Washing the plate: the samples were removed and washed three times for 3 minutes with 0.05% Tween-20 (PBST).

i) Color development: adding 100 mu L/well of substrate solution (TMB) and reacting for 5-10 min, and finally adding 100 mu L

The reaction was terminated with 12mol/L sulfuric acid.

J) OD value: OD was measured with a microplate reader at a wavelength of 450 nm.

3) Experimental results

The results of the antibody titer detection are shown in table 4.

TABLE 4 results of antibody titer detection

Hole number	Negative of	Blank space	1K	2K	4K	8K	16K	32K	64K	128K	256K	512K
													A	0.046	0.025	3.224	3.201	3.110	3.092	2.974	2.805	2.405	1.466	1.121	0.914

Remarks: ELISA detection data measured by an enzyme label instrument are shown in the table. The serum effective value is more than or equal to 2.5. Antibody titers of Fn14 project: 5D9 is more than or equal to 64K.

The concentration of the antibody was measured to be 0.8mg/mL, and Tris-Gly (pH 7.4) was used as a buffer. The serum potency value is greater than or equal to 2.5 and the negative value is judged to be positive, and the positive value exceeding 64K can be detected according to the table 4, which indicates that the project is successful.

2. Experimental method

2.1 Establishment of mouse model

BALB/c male mice at 6-8 weeks were randomly divided into a blank Control group (Control), a Negative Control group (NC), an imiquimod group (IMQ; i.e., psoriasis group), and a neutralizing anti-Fn14 mAb-treated group (anti-Fn 14 mAb).

The mice of each group were shaved to a size of Mao Yao X4 cm on the back, and the mice of each group were simultaneously given a single daily application, except for the mice of the blank group. Wherein, the back part of the mouse of the negative control group is partially smeared with Tris-Gly buffer solution; the backs of the mice in the imiquimod group are coated with imiquimod cream 62.5mg locally; the back of the mice of the neutralizing Anti-Fn14 monoclonal antibody treatment group is locally smeared with imiquimod cream 62.5mg, and then the mice of the neutralizing Anti-Fn14 monoclonal antibody treatment group are respectively injected with different concentrations (1 mg/kg, 5mg/kg and 10 mg/kg) by adopting a subcutaneous injection mode and an intraperitoneal injection mode respectively, wherein the neutralizing Anti-Fn14 monoclonal antibody treatment group is treated by adopting the preparation method of the Anti-Fn14 monoclonal antibody by Shanghai you Ning vitamin technology Co., ltd.), namely, the mice of the neutralizing Anti-Fn14 monoclonal antibody treatment group are subjected to imiquimod cream molding and drug administration treatment every day. Each group of mice was photographed daily and scored for severity index (psoriasis area and severity index, PASI), the back skin lesions of the mice were scored for severity according to three indices of erythema, scaling, plaque hypertrophy, each index being divided into five classes of 0-4, the sum of the three indices being the total score for severity, for 7 days, blood and skin tissue were harvested for subsequent testing after mice were sacrificed on day eight.

2.2 blood routine and liver and kidney function

And detecting by adopting a blood routine detector.

2.3 Paraffin section preparation

Skin tissues of each group of mice were washed clean with physiological saline, impurities were removed, and the tissues were fixed in 4% paraformaldehyde for 24 hours. And then sequentially placing the materials into 75%, 80%, 95% absolute ethyl alcohol to carry out gradient dehydration, respectively soaking the wax I, the wax II and the wax III after the xylene is transparent, and finally embedding the wax blocks.

2.4 hematoxylin-eosin (HE) staining

Baking the slices for 30min at 60-65 ℃, putting the whole slide frame into a glass jar filled with dimethylbenzene, soaking for 10-15 min, and dewaxing conventionally. The method comprises the following specific steps:

2.5 immunohistochemical staining

a) Baking the cut paraffin tissue cutting glass slide at 62 ℃ for 30-40 minutes;

b) Taking out the slices, dewaxing for 10-15 minutes by using dimethylbenzene I, II;

c) Hydrating with absolute ethanol I, II for 2 min;

d) Hydrating with 95% alcohol I, II for 2 min each;

e) After another 2 minutes of 50% alcohol, ddH was used ₂ O is washed for 2 minutes;

f) Antigen retrieval liquid (1L ddH) ₂ Boiling O+2.94g sodium citrate+0.37 g EDTA+500 mu L Tween 20) P100, placing the slices into the boiled antigen retrieval liquid, boiling the P80 slices for 10 minutes, and naturally cooling to room temperature;

g) After PBS soaks for 1 minute, the slices are placed in a wet box;

h) Sections were incubated with PBS 0.1% TritonX-100 for 15min at room temperature;

i) After 5 minutes of PBS pickling, endogenous peroxidase (3% hydrogen peroxide, diluted by PBS) is dripped on the upper surface of the tissue and incubated for 10 minutes at room temperature, and then PBST pickling is carried out for 5 minutes;

g) The water around the tissue is sucked by filter paper, 2% BSA blocking solution is added to the tissue, and the tissue is incubated for 30 minutes at 37 ℃;

k) Sucking the redundant sealing liquid around the tissue with filter paper;

l) tissue is covered with primary antibody diluted in appropriate proportions (blocking solution dilution) overnight at 4 ℃;

m) taking out the wet box the next day, recovering the room temperature, and soaking and washing with PBST for 3 times, each time for 5 minutes;

n) dropwise adding DAKO secondary antibody, and incubating for 30 minutes at room temperature;

o) PBST was washed 3 times for 5 minutes each with PBS in a water bath for 5 minutes;

p) adding freshly prepared DAB solution (1:50) (in DAKO kit), keeping away from light at room temperature until color development, washing off the excess color-developing agent with tap water, stopping the color-developing reaction, and ddH ₂ Washing in O for 1 minute;

q) hematoxylin counterstaining for 3 minutes, and ddH after running water washing ₂ Soaking in O for 1 minute;

r) returning blue with PBS for 3-5 minutes;

s)ddH ₂ soaking and washing in O for 1 minute;

t) drying, and sealing with neutral resin. Observed under a microscope, photographed, and analyzed for results.

2.6 determination of immunohistochemical results

Positive judgment: CD3 and F4/80 positive cells stained in the cytoplasm and were positive as brown particles. 5 fields were randomly picked under 200-fold mirror and positive cell area analysis was performed using ImageJ software.

2.7 statistical analysis

SPSS18.0 was used for statistics, the metering data were expressed as mean.+ -. Standard deviation, and the differences between the two groups were measured using independent sample t-test. P <0.05 is statistically significant for the differences.

3 results of experiments

3.1 Back skin lesion Change and PASI scoring results in groups of mice

As shown in fig. 1, the back skin of the blank control group has no erythema, scaling and plaque hypertrophy, and compared with the blank control group and the negative control group, the imiquimod group has light erythema, silvery white scaling and plaque hypertrophy on the back skin along with the extension of the molding time, which indicates that the molding is successful; in the neutralizing anti-Fn14 monoclonal antibody treatment group, different dosages of neutralizing anti-Fn14 monoclonal antibody are injected by different injection modes, and the back skin damage of mice is reduced compared with a model group.

Mice were scored for severity of back skin lesions based on three indices of erythema, scaling, plaque hypertrophy. Each index is rated from 0 to 4 for a total of five grades, the sum of the three indices being the total severity score. As can be seen from fig. 2, the PASI score of the neutralizing anti-Fn14 mab-treated group was reduced compared to imiquidone Mo Tezu, demonstrating that both subcutaneous and intraperitoneal injections of neutralizing anti-Fn14 mab significantly improved the pathological features of psoriasis.

3.2 Effect of neutralizing anti-Fn14 monoclonal antibodies on liver and kidney function

Detecting liver and kidney functions of mice in the blank control group, the negative control group, the imiquimod group and the neutralizing anti-Fn14 monoclonal antibody treatment group, wherein the liver function index (glutamic oxaloacetic transaminase and albumin) is unchanged and has no statistical difference compared with imiquidone Mo Tezu in the neutralizing anti-Fn14 monoclonal antibody treatment group as shown in the A-D in fig. 3; as shown in fig. 3E-H, the renal function indicators (serum creatinine and urea nitrogen) were all within normal ranges and the treatment group had a decreasing trend, indicating that neutralizing anti-Fn14 mab may have the potential to improve renal function.

3.3 Effect of neutralizing anti-Fn14 mab on blood normative

As shown in fig. 4, the blood routine of each group of mice was tested, and it was found that the common indicators of blood routine such as lymphocytes, monocytes and eosinophils did not significantly change between each group, indicating that the injection of neutralizing anti-Fn14 mab in two different ways did not affect the blood routine, and the safety was good.

3.4 hematoxylin-eosin (HE) staining

As shown in fig. 5-7, the pathology of imiquimod Mo Tezu is characterized by hypoparagonism, irregular proliferation and hypertrophy of the acantha layer, obvious reduction of the granular layer, upward extension of the dermal head, tissue cell infiltration and lymphocyte infiltration, while the neutralizing anti-Fn14 monoclonal antibody treatment group has thinner epidermis than imiquimod group, excessive keratinization, slight hypoparagonism, increased granular layer, improved symptoms such as tissue cell infiltration and lymphocyte infiltration to different extents, and reduced symptoms. 3.5 detection of CD3 Positive expression of Back skin lesion tissue of mice in each group

As shown in fig. 8 to 10, immunohistochemistry was performed to detect CD3 positive cells in the back skin lesion tissue of mice, and the immunohistochemical results showed that: the blank control group only expresses a small amount in the dermis layer, a large amount of positive cells in the imiquimod group express in the cuticle layer and the dermis layer, and the area of the positive cells in the neutralizing anti-Fn14 monoclonal antibody treatment group is obviously reduced, which indicates that the neutralizing anti-Fn14 monoclonal antibody with different dosages can inhibit T lymphocyte infiltration and inhibit the expression of T lymphocyte marker molecule CD 3.

3.6 detection of F4/80 positive expression of Back skin lesion tissue of mice in each group

F4/80 is a common marker molecule for macrophages. As shown in fig. 11-13, the blank group only expressed in a small amount in the dermis layer, a large number of positive cells in the imiquimod group expressed in the stratum corneum layer, basal layer and dermis layer, while the number of positive cells in the neutralizing anti-Fn14 mab treatment group was significantly reduced, indicating that different doses of neutralizing anti-Fn14 mab could inhibit macrophage infiltration.

Conclusion of the experiment

The imiquimod group has the advantages that with the extension of the molding time, the back skin of the mice has light red spots, silvery white scales and plaque hypertrophy, and the back skin of the normal group and the negative control group has no red spots, scales and plaque hypertrophy; after neutralizing anti-Fn14 mab treatment, mice had reduced back skin lesions compared to the model group. Mice were scored for severity of back skin lesions according to three indices of erythema, scaling, plaque hypertrophy, PASI score decreasing with increasing doses of Fn14 mab. Meanwhile, liver function indexes (glutamic oxaloacetic transaminase and albumin) and kidney function indexes (blood creatinine and urea nitrogen) are in normal ranges, blood conventional common indexes such as lymphocyte, monocyte and eosinophil are not obviously changed among groups, no obvious difference exists, and the neutralizing anti-Fn14 monoclonal antibody has good safety. The pathology of the imiquimod Mo Tezu is characterized by incomplete keratinization, irregular hyperplasia and hypertrophy of the acantha layer, obvious reduction of the granular layer, upward extension of the dermal emulsion, tissue cell infiltration and lymphocyte infiltration, and the neutralization anti-Fn14 monoclonal antibody treatment group is thinner than the imiquimod group epidermis, the keratinization is excessive, the keratinization is slight, the granular layer is increased, and the symptoms such as tissue cell infiltration and lymphocyte infiltration are improved to different degrees. The immunohistochemical result further carries out semi-quantitative infiltration of T lymphocytes and macrophages, the blank control group and the negative control group only express a small amount in the dermis layer, a large amount of positive cells in the imiquimod group express in the stratum corneum and the dermis layer, and the area of the positive cells in the neutralizing anti-Fn14 monoclonal antibody treatment group is obviously reduced.

From the above results we find: the neutralizing anti-Fn14 monoclonal antibody can block TWEAK from combining with a receptor Fn14, is hopeful to become a new target for treating psoriasis, and provides a new basis for clinical treatment.

The above is only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited by this, and any modification made on the basis of the technical scheme according to the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Claims (10)

1. The neutralizing anti-Fn14 monoclonal antibody is characterized in that Fn14 antigen and a viral vector are coupled and then used as immunogens to immunize animals, spleen cells of the animals are taken to be subjected to cell fusion with SP2/0, and the neutralizing anti-Fn14 monoclonal antibody is prepared by subcloning screening, cell construction and in-vivo ascites induction; wherein the amino acid sequence of the Fn14 antigen is shown as SEQ.ID.1.

2. The neutralizing anti-Fn14 mab of claim 1, wherein the viral vector is keyhole limpet hemocyanin.

3. The neutralizing anti-Fn14 mab of claim 1, wherein the animal is a BALB/c mouse.

4. The neutralizing anti-Fn14 monoclonal antibody of claim 2, wherein the Fn14 polypeptide antigen is conjugated to keyhole limpet hemocyanin via SMCC.

5. The neutralizing anti-Fn14 monoclonal antibody of any of the claims 1-4, wherein the immunogen further comprises a CpG ODN, the nucleotide sequence of the CpG ODN is shown in seq id.2.

6. The neutralizing anti-Fn14 mab of claim 5, wherein the immunogen comprises a prime antigen, a di-immune antigen, a tri-immune antigen, a tetra-immune antigen, and a penta-immune antigen; the primary antigen is obtained by uniformly mixing and emulsifying the coupled Fn14 antigen and Freund's complete adjuvant added with CpG ODN in an equal volume, the secondary antigen, the tertiary antigen and the quaternary antigen are obtained by uniformly mixing and emulsifying the coupled Fn14 antigen and Freund's incomplete adjuvant added with CpG ODN in an equal volume, and the penta-antigen is obtained by mixing the coupled Fn14 antigen and normal saline in an equal volume.

7. Use of a neutralizing anti-Fn14 monoclonal antibody of any of the claims 1-6 for the preparation of a medicament for the prevention and treatment of psoriasis.

8. The use according to claim 7, wherein the medicament targets Fn14 at the gene level/protein level.

9. The use according to claim 7, wherein the neutralizing anti-Fn14 mab is administered in an amount of 1-10 mg/kg.

10. A pharmaceutical composition for preventing and treating psoriasis, comprising an effective amount of the neutralizing anti-Fn14 mab of any of claims 1-6.

Images