CN116098126A

CN116098126A - Specific clearing of MHCII + Genetically engineered mice of adipocytes and MHCII + Preparation method and application of adipocytes

Info

Publication number: CN116098126A
Application number: CN202310211471.6A
Authority: CN
Inventors: 邓沱; 宋建峰; 谢丽敏; 麦武倩; 曾琴; 丁豫晋; 焦雅仪; 孙肖霄
Original assignee: Second Xiangya Hospital of Central South University
Current assignee: Second Xiangya Hospital of Central South University
Priority date: 2023-03-07
Filing date: 2023-03-07
Publication date: 2023-05-12

Abstract

The invention discloses a method for specifically clearing MHCII ⁺ Genetically engineered mice of adipocytes and MHCII ⁺ A preparation method and application of fat cells. The preparation method of the genetically engineered mice comprises the following steps: (1) Inserting a-loxp-STOP-loxp-DTR-fragment after the last exon of H2-Aa gene, wherein all cells of the mouse cannot express DTR because the STOP-fragment blocks gene transcription; (2) After hybridization of the mice with the Adipoq-cre mice, only the STOP-fragment in the adipocytes will be excised, thus expressing MHCII of both the H2-Aa gene and cre gene ⁺ Adipocytes can express DTR to obtain aH2-Aa ^DTR A mouse; (3) aH2-Aa ^DTR Mice were used for subsequent experimental study by crossing 5 passages of purified genetic background with inbred C57BL/6J mice. The invention also provides MHCII ⁺ The application of the adipocytes in preparing a product for improving obesity-induced insulin resistance, the application of the adipocytes in preparing a product for improving obesity-induced adipose tissue Th1 cell infiltration and the application of the adipocytes in preparing a product for improving obesity-induced adipose tissue M1 macrophage infiltration.

Description

Specific clearing of MHCII + Genetically engineered mice of adipocytes and MHCII + Preparation method and application of adipocytes

Technical Field

The invention relates to the field of biotechnology, in particular to a method capable of specifically clearing MHCII ⁺ Genetically engineered mice of adipocytes and MHCII ⁺ A preparation method and application of fat cells.

Background

Obesity has become a worldwide epidemic. The main hazard of obesity is that it can cause insulin resistance, promoting numerous complications such as diabetes, cardiovascular disease and cancer. A number of studies have shown that chronic inflammation is a key mechanism for obesity complications, while visceral adipose tissue is a key site for the development and progression of obesity-induced chronic inflammation. Since the 1993 journal of Science published article reported that adipose tissue of obese mice highly expressed inflammatory factor tnfα, there have been nearly ten thousand papers studying the mechanism of occurrence of adipose tissue inflammation and its key role in obesity-related metabolic diseases, and hundreds of clinical trials tested the role of anti-inflammatory therapies on metabolic diseases. Despite the phased success of some therapies, no anti-inflammatory therapy is currently approved by the U.S. Food and Drug Administration (FDA) for the treatment of metabolic disorders. The main reason for failure is that the anti-inflammatory therapies currently tested are directed against classical immune cells and immune signaling molecules, which may increase the risk of infection and tumor in patients, and are unsuitable for the treatment of metabolic diseases, which are usually chronic diseases. The search for new methods that can specifically inhibit adipose tissue inflammation without affecting systemic immunity would bring new promise for immunotherapy of metabolic diseases.

Disclosure of Invention

In order to solve the technical problems, the invention provides a method for specifically clearing MHCII ⁺ A method for preparing genetically engineered mice of adipocytes.

Further, the present invention provides MHCII extracted from the above genetically engineered mice or from adipose tissue of animals or humans ⁺ Adipocytes.

Further, the invention also provides the MHCII ⁺ A method for preparing fat cells.

Still further, the present invention provides the MHCII described above ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced insulin resistance.

Still further, the present invention provides the MHCII described above ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced adipose tissue Th1 cell infiltration.

Still further, the present invention provides the MHCII described above ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced infiltration of adipose tissue M1 macrophages.

Furthermore, the invention also provides the MHCII ⁺ Application of adipocyte magnetic bead sorting technology.

The technical scheme of the invention is as follows:

specific clearing of MHCII ⁺ The preparation method of the genetically engineered mice of the adipocytes comprises the following steps:

(1) Construction of H2-Aa ^DTR Mice: gene editing was performed on the H2-Aa gene of C57BL/6J mice, inserting a-loxP-eGFP-STOP-loxP-DTR-mCherry-fragment after the last exon (exon 4) of the H2-Aa gene, wherein the loxP site is the sequence recognized and bound by Cre recombinase, eGFP is a enhanced green fluorescent protein, STOP is a transcription termination sequence capable of blocking transcription of the latter gene, DTR is diphtheria toxin receptor, mCherry is a type of geneRed fluorescent protein, cells expressing H2-Aa gene (i.e., expressing MHCII) in this mouse will express eGFP fluorescent protein, but not DTR and mCherry, resulting in H2-Aa ^DTR A mouse;

(2) H2-Aa ^DTR The mice are hybridized with the Adipoq-cre mice to obtain aH2-Aa ^DTR Mice: the adipocytes of the mice can express Cre recombinase, the Cre recombinase recognizes loxP sites and cuts off DNA sequences between the two loxP sites, and cells which can express H2-Aa gene and Cre gene simultaneously, namely, the genetically engineered mice which can express DTR and mCherry fluorescent protein and can specifically remove MHCII+ adipocytes, namely aH2-Aa ^DTR And (3) a mouse.

Wherein said specifically scavengeable MHCII ⁺ The preparation method of the genetically engineered mice of the adipocytes further comprises the following steps:

(3)aH2-Aa ^DTR the mice can obtain purified specific clearing MHCII after crossing with pure C57BL/6J mice for 5 generations to purify genetic background ⁺ Genetically engineered mice of adipocytes.

MHCII ⁺ Adipocytes:

said MHCII ⁺ Adipocytes derived from the above aH2-Aa ^DTR The adipose tissue of mice, adipose tissue of other animals or humans is obtained by flow sorting or magnetic bead sorting.

Wherein said MHCII ⁺ The presence of adipocytes,

specific methods obtained by magnetic bead sorting from adipose tissue of other animals or humans are:

(1) Obtaining adipose tissue of an animal or human;

(2) Extraction of adipocytes: cutting the adipose tissue to about 1mm with surgical scissors ³ Adding 5mL collagenase II buffer solution into each gram of adipose tissue, digesting for 45 minutes at 37 ℃ and 100rpm, filtering animal adipose tissue with a 200 mu m filter screen, filtering human adipose tissue with a 300 mu m filter screen, centrifuging the filtered cell suspension at 200g speed for 1 minute, and floating fat cells in the upper layer, wherein the lower layer is a vascular matrix component;

(3) Sucking the upper layer fat cells by using a Pasteur pipette, transferring the upper layer fat cells into a new tube, adding 5mL of 2mM EDTA solution, slightly shaking the tube upside down for 5 minutes to wash the fat cells, centrifuging at a speed of 200g for 1 minute, removing the lower layer liquid, and repeating the steps for 3 times to obtain the fat cells;

(4) The obtained adipocytes were divided into 200. Mu.L portions, 200. Mu.L of a CD45 antibody working solution prepared by adding 2. Mu.L of biotin-conjugated anti-mouse CD45 antibody to 200. Mu.L of PBS containing 2mM EDTA and 1% BSA was added, and incubated at room temperature for 15 minutes;

(5) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

(6) 200. Mu.L of the magnetic bead suspension is added and incubated for 15 minutes at room temperature;

(7) Placing the tube containing the cell suspension on a magnetic rack, CD45 ⁺ The cells are combined with the magnetic beads and adsorbed on the tube wall, so that the CD45 is removed ⁺ Cells, which are not adsorbed by the magnetic beads, are sucked and transferred to a new tube;

(8) 200. Mu.L of MHCII antibody working solution, which is prepared by adding 200. Mu.L of PBS containing 2mM EDTA and 1% BSA to 2. Mu.L of biotin-conjugated anti-mouse MHCII antibody, is added, and incubated for 15 minutes at room temperature;

(9) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

(10) 200. Mu.L of a bead suspension prepared by adding 2.5. Mu.L of biotin-binding agent beads to 200. Mu.L of PBS containing 2mM EDTA and 1% BSA was added, and incubated at room temperature for 15 minutes;

(11) Placing the tube containing the cell suspension on a magnetic rack, MHCII ⁺ The fat cells are combined with the magnetic beads and adsorbed on the tube wall, and the MHCII which is not adsorbed by the magnetic beads is firstly carried out ^- Sufficient removal of adipocytes, remaining MHCII ⁺ Adipocytes were washed three times with PBS containing 2mM EDTA and 1% BSA to give MHCII ⁺ Adipocytes and MHCII ^- Adipocytes.

The MHCII described above ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced insulin resistance.

The MHCII described above ⁺ Adipocytes for improving obesity inductionApplication of adipose tissue Th1 cell infiltration in product research.

The MHCII described above ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced infiltration of adipose tissue M1 macrophages.

In order to find new methods that can specifically inhibit adipose tissue inflammation without affecting systemic immunity, the present invention focuses on adipocytes. Adipocytes are naturally tissue-specific as a kind of cells that are present almost exclusively in adipose tissue. The inventors have found that there is a population of MHCII in adipose tissue ⁺ Adipocytes, MHCII in adipose tissue of humans and mice as obesity progresses ⁺ The proportion of adipocytes gradually increases. This means that MHCII ⁺ Adipocytes may be enriched in adipose tissue as a specific subset of adipocytes.

The invention can specifically clear MHCII by using brand new construction ⁺ The genetic engineering mouse model of the fat cells can remove the inflammatory fat cells in the early stage of obesity, reduce the quantity of the inflammatory Th1 cells and M1 macrophages of adipose tissues and improve insulin resistance. These studies indicate that MHCII ⁺ Adipocytes may be a critical cell subset that triggers obesity-induced adipose tissue inflammation. By targeting MHCII ⁺ Adipocytes are expected to create new pathways specifically inhibiting obesity-induced chronic inflammation.

The invention develops a brand new MHCII ⁺ The separation technology of the fat cell magnetic beads can greatly improve the MHCII ⁺ Sorting rate, survival rate and purity of adipocytes, which are MHCII ⁺ Subsequent studies of adipocytes provide a solid physiological basis.

Specific clearance of MHCII based on the above ⁺ Genetically engineered mouse model of adipocytes and MHCII ⁺ The magnetic bead sorting technology for the fat cells, the invention constructs a method using MHCII ⁺ Drug screening model with adipocytes as targets. The invention can specifically clear MHCII from the above ⁺ Adipose tissue is obtained from mice with adipocytes, and MHCII is obtained by magnetic bead sorting technology ⁺ Adipocytes (the cells express mCh)erry red fluorescent protein), MHCII ⁺ Culturing adipocytes in 96-well plates, adding a drug to each well of the 96-well plates, and directly observing whether red fluorescence increases (increases) or decreases (decreases) under a fluorescence microscope after 24 hours to determine whether the drug has an effect on MHCII ⁺ The promotion or inhibition effect of the fat cells can be realized, so that the large-batch high-throughput drug screening can be realized.

Drawings

FIG. 1 shows example 1-specific clearing of MHCII ⁺ Preparation and validation of genetically engineered mice of adipocytes. (A) aH2-Aa ^DTR Preparation strategy of mice; (B) Flow cytometry for detecting HFD 9 week H2-Aa ^DTR And aH2-Aa ^DTR MHCII in mouse epididymal adipose tissue ⁺ Content of adipocytes, n=5/group, p<0.05。

FIG. 2 shows example 3-clearing MHCII ⁺ Adipocytes can prevent obesity-induced insulin resistance. (A) H2-Aa ^DTR And aH2-Aa ^DTR Insulin resistance test (ITT) results in mice at HFD 9 weeks; (B) Statistical plot of area under curve (Area under the curve, AUC) for ITT results, n=6-7/group, ×p<0.05，***p<0.001。

FIG. 3 shows example 4-clearing MHCII ⁺ Adipocytes reduce the accumulation of obesity-induced inflammatory T cells (Th 1) and macrophages (M1) in adipose tissue. (A) Flow cytometry detection of H2-Aa ^DTR And aH2-Aa ^DTR Content of Th1 cells in epididymal adipose tissue of mice; (B) H2-Aa ^DTR And aH2-Aa ^DTR Th1 cell number per gram epididymal adipose tissue in mice; (C) Flow cytometry detection of H2-Aa ^DTR And aH2-Aa ^DTR Content of M1 macrophages in mouse epididymal adipose tissue; (D) H2-Aa ^DTR And aH2-Aa ^DTR Number of M1 cells per gram of epididymal adipose tissue in mice. n=5-6/group,/p<0.01，***p<0.001。

FIG. 4 shows example 5-separation by magnetic bead separation technique to obtain MHCII ⁺ Adipocytes. (A) MHCII ⁺ A magnetic bead sorting mode diagram of the adipocytes; (B) qPCR detection of MHCII from magnetic bead sorting ⁺ Adipocytes and MHCII ^- Expression of H2-Ab1, ciita and Cd74 in adipocytes, n=4/group, p<0.01，***p<0.001。

Detailed Description

In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Unless otherwise specified, all reagents involved in the examples of the present invention are commercially available products and are commercially available.

Biotin-binding agent magnetic beads (Biotin Binder Dynabeads): purchased from Invitrogen company under the product number 11533D;

collagenase II:1mg/mL,250U/mg, purchased from Worthington company.

Example 1

Can specifically clear MHCII ⁺ Preparation of genetically engineered mice of adipocytes:

(1) Construction of H2-Aa ^DTR Mice: gene editing was performed on the H2-Aa gene of a C57BL/6J mouse, and a-loxP-eGFP-STOP-loxP-DTR-mCherry-fragment was inserted after the last exon (exon 4) of the H2-Aa gene, wherein the loxP site is a sequence recognized and bound by Cre recombinase, eGFP is an enhanced green fluorescent protein, STOP is a transcription termination sequence capable of blocking transcription of the latter gene, DTR is diphtheria toxin receptor, mCherry is a red fluorescent protein, and cells expressing the H2-Aa gene (i.e., expressing MHCII) in the mouse express eGFP fluorescent protein, but do not express DTR and mCherry, resulting in H2-Aa ^DTR A mouse;

(2) H2-Aa ^DTR The mice are hybridized with the Adipoq-cre mice to obtain aH2-Aa ^DTR Mice: the adipocytes of the mice can express Cre recombinase, which recognizes loxP sites and cuts DNA sequences between the two loxP sites, and can express H2-Aa gene and H2-Aa gene simultaneouslyCells of Cre gene (MHCII) ⁺ Adipocytes) can express DTR and mCherry fluorescent protein to obtain the genetically engineered mouse capable of specifically eliminating MHCII+ adipocytes, namely aH2-Aa ^DTR A mouse;

(3)aH2-Aa ^DTR the mice were purified by crossing 5 passages of purified genetic background with the inbred C57BL/6J mice to obtain purified MHCII ⁺ Genetically engineered mice of adipocytes.

In an embodiment: (1) Construction of H2-Aa as shown in FIG. 1 ^DTR Mice: the H2 gene is a mouse gene for encoding MHCII, the MHCII molecule consists of an alpha chain and a beta chain, wherein the alpha chain is encoded by the H2-Aa gene, and the beta chain is encoded by the H2-Ab1 gene. Since H2-Aa gene expression was higher than H2-Ab1 gene expression in adipocytes of C57BL/6J mice, gene editing was selected on the H2-Aa gene. Inserting a-loxP-eGFP-STOP-loxP-DTR-mCherry-fragment after the last exon (exon 4) of the H2-Aa gene, wherein the loxP site is the sequence recognized and bound by Cre recombinase, eGFP is an enhanced green fluorescent protein, STOP is a transcription termination sequence capable of blocking transcription of the latter gene, DTR is a diphtheria toxin receptor, mCherry is a red fluorescent protein, the sequence behind the STOP fragment will not be expressed due to the STOP fragment blocking transcription, cells expressing the H2-Aa gene (i.e., expressing MHCII) in the mice will express eGFP fluorescent protein, but not DTR and mCherry, resulting in H2-Aa ^DTR A mouse;

(2) H2-Aa ^DTR The mice are hybridized with the Adipoq-cre mice to obtain aH2-Aa ^DTR Mice: the adipocytes of the mice can express Cre recombinase which recognizes the loxP site and cuts the DNA sequence between the two loxP sites, and since the STOP fragment is excised, cells expressing both the H2-Aa gene and the Cre gene (MHCII) ⁺ Adipocytes), i.e. genetically engineered mice capable of expressing DTR and mCherry fluorescent proteins that specifically clear MHCII+ adipocytes, i.e. aH2-Aa ^DTR A mouse;

(3)aH2-Aa ^DTR the mice were used to obtain purified specific clearance of MHCII after crossing 5 passages of purified genetic background with inbred C57BL/6J mice ⁺ Genetically engineered mice of adipocytes.

Example 2

MHCII ⁺ The preparation method of the fat cells comprises the following steps:

or extracting MHCII from adipose tissue of animals or humans by the following method (magnetic bead sorting) ⁺ Method of adipocytes:

(1) Obtaining adipose tissue of an animal or human;

(5) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

(9) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

(11) Placing the tube containing the cell suspension on a magnetic rack, MHCII ⁺ The fat cells are combined with the magnetic beads and adsorbed on the tube wall, and the MHCII which is not adsorbed by the magnetic beads is firstly carried out ^- Sufficient removal of adipocytes, remaining MHCII ⁺ Adipocytes were washed three times with PBS containing 2mM EDTA and 1% BSA to give MHCII ⁺ Adipocytes and MHCII ^- Adipocytes, MHCII ^- Adipocytes are derived from MHCII ⁺ The remaining adipocytes after adipocyte removal can be used to interact with MHCII ⁺ Adipocytes were compared and MHCII was explored ⁺ Characteristics of adipocytes.

EXAMPLE 3 clearing MHCII ⁺ Verification 1 and experimental method for preventing obesity-induced insulin resistance by adipocytes

Mouse insulin resistance test (Insulin tolerance test, ITT)

Male aH2-Aa at 6 weeks of age ^DTR Mice and control mice H2-Aa thereof ^DTR Mice were fed a High Fat Diet (HFD) and 4 weeks later were given an intraperitoneal injection of diphtheria toxin (6.25 ng/g body weight twice weekly) to clear aH2-Aa ^DTR MHCII in mice ⁺ Adipocytes. Insulin resistance experiments (ITT) were performed at 9 weeks on a high fat diet.

(1) Fasted for 6h: the feed was removed from the squirrel cage and the litter was replaced.

(2) Marking was done by scoring the rat tail with a marker to quickly differentiate each mouse, weighing the mice and recording.

(3) Measuring fasting blood glucose: the tip of the tail of the mouse is wiped by an alcohol cotton ball, the tail end of the tail of the mouse is cut by a sterile pair of scissors to be about 1mm, then the first drop of blood is wiped by a sterile pair of gauze, and the second drop of blood is absorbed by a glucometer and blood sugar is measured.

(4) Intraperitoneal injection of insulin: insulin amounts are determined based on the body weight of the mice, and are typically 0.5U-0.8U/kg body weight. Adding 5-8 μl insulin into 5ml sterile physiological saline to obtain working solution. Insulin injection volume was [ 5X mouse body weight (g) ] μl.

(5) Timing was started after the injection of the first mouse, insulin injections were completed in 15min for all mice, and the time interval between injections was determined according to the number of mice.

(6) The blood glucose values of the mice are sequentially detected after 15min, and the time points to be detected in the experiment comprise 15min, 30min, 45min, 60min and 90min after insulin injection.

(7) After all time points are detected, the mice are fed with feed continuously.

The above results are shown in FIG. 2.

2. Experimental results

ITT results showed that MHCII was cleared in the case of high fat diet feeding ⁺ aH2-Aa of adipocytes ^DTR The insulin sensitivity of the mice was significantly improved (fig. 2). The above results illustrate clearing MHCII ⁺ The adipocytes can prevent obesity-induced insulin resistance, which indicates that the MHCII prepared by the invention ⁺ Adipocytes can be used in the research of the preparation of products for improving obesity-induced insulin resistance.

Example 4 demonstration that removal of MHCII+ adipocytes reduced accumulation of obesity-induced inflammatory T cells (Th 1) and macrophages (M1) in adipose tissue

1. Experimental method

Vascular matrix composition and spleen cell flow cytometry analysis

(1) Male aH2-Aa at 6 weeks of age ^DTR Mice and control mice H2-Aa thereof ^DTR Mice were fed a High Fat Diet (HFD) and 4 weeks later were started with intraperitoneal injection of diphtheria toxin (6.25 ng/g body weight, twice/week) to clear aH2-Aa ^DTR MHCII in mice ⁺ Adipocytes. Mice were sacrificed at cervical breakup 9 weeks on high fat diet, and the epididymal adipose tissue and spleen of the mice were taken and weighed for subsequent calculation of absolute numbers of Th1 cells and M1 macrophages.

(2) Extraction of vascular matrix components: surgical scissors are used for surrounding epididymisShearing adipose tissue to about 1mm ³ The pellet was digested with 5mL collagenase II (1 mg/mL,250U/mg, worthington) buffer per gram of adipose tissue at 37℃for 45 minutes at 100rpm, and filtered through a 70 μm sieve. The filtered cell suspension was centrifuged at 500g for 5min and the adipocytes were floated on the top and the lower pellet was the vascular matrix component (Stromal Vascular Fraction, SVF).

(3) Extraction of spleen cells: the spleens of the mice were removed and placed in a petri dish. The clean syringe was taken and the tissue was rolled with the end where it was pressed. The dishes were rinsed with PBS and filtered through a 70 μm filter. The filtered cell suspension was centrifuged at 500g for 5 minutes, the supernatant was removed and the lower pellet was the spleen cells.

(4) Split red: to the obtained SVF and spleen cells, 1mL of erythrocyte lysate was added, the cells were resuspended, and the mixture was allowed to stand on ice for 5 minutes. 500g was centrifuged for 5min, the supernatant removed and 1mL PBS was resuspended.

(5) The resulting SVF cell suspension was taken 700. Mu.L for Th1 cell staining and 300. Mu.L for M1 macrophage staining. Spleen single cell suspension, 100. Mu.L was used for Th1 staining and 50. Mu.L was used for M1 macrophage staining.

(6) Intracellular stimulation: SVF cell suspensions and spleen single cell suspensions for Th1 cell staining were resuspended in 12-well plates after centrifugation with 1mL of cell stimulation medium (RPMI 1640 complete medium plus 20ng/mL PMA, 1. Mu.L/mL lonomemycin and 2. Mu.M Monensin) for a total incubation period of 6 hours.

(7) All cells at the end of stimulation were collected and centrifuged at 500g for 5min to remove the supernatant.

(8) Cell death and viability: 100. Mu.L PBS and 1. Mu.L Zombie NIR were added to each sample, gently swirled, and incubated at room temperature for 7 minutes in the absence of light.

(9) Closing: 1 μl of CD16/32 was added to each sample, gently blown well, and incubated at room temperature for 7 minutes in the dark.

(10) Surface staining: th1 cell staining (CD 45-FITC, CD3-Percp/Cy5.5 and CD4-APC antibody are sequentially added to each sample), M1 macrophage staining (CD 45-FITC, F4/80-PE/Cy7, CD11b-APC and CD11c-PE are sequentially added to each sample), gentle blowing, and incubation at room temperature in dark for 7 minutes.

(11) 1mL of PBS was added and washed once, and centrifuged at 500g for 5 minutes at 4 ℃. M1 macrophage staining here can be added with 200 u L PBS to resuspend, transfer to flow tube, on-machine detection analysis. Th1 cell staining was also performed as follows.

(12) Fixing and rupture of membranes: the supernatant was discarded, 100. Mu.L of Fixation/Permeablization (solution A: solution B=1:3) was added to each tube, and incubated at 4℃for 40 minutes in the absence of light.

(13) And (3) terminating: 1mL of 1X Permeabilization Buffer was added and centrifuged at 500g for 5 minutes at 4 ℃.

(14) Intracellular staining: the supernatant was discarded, 100. Mu.L of 1X Permeabilization Buffer was added to each sample and the IFN gamma-PE antibody was added and incubated at 4℃for 40 minutes in the absence of light after homogenization.

(15) And (3) terminating: 1mL of 1X Permeabilization Buffer was added and the mixture was centrifuged at 500g at 4℃for 5 minutes.

(16) The supernatant was discarded, resuspended in 200. Mu.L PBS, transferred to a flow tube, and analyzed on-press.

The above results are shown in FIG. 3.

2. Experimental results

Since Th1 cells and M1 macrophages play the most critical role in obesity-induced adipose tissue inflammation, the inventors examined H2-Aa by flow cytometry ^DTR And aH2-Aa ^DTR Th1 cells (CD 45) in mouse epididymal adipose tissue and spleen ⁺ 、CD3 ⁺ 、CD4 ⁺ And IFN gamma ⁺ ) And M1 macrophage (CD 45) ⁺ 、F4/80 ⁺ 、CD11b ⁺ And CD11c ⁺ ) The results show that aH2-Aa is ^DTR The proportion of Th1 cells and M1 macrophages in the epididymal adipose tissue of mice was significantly reduced as well as the absolute number (fig. 3); there was no significant difference in both cell subsets in the spleens of both groups of mice (fig. 3A and C). The above results indicate that MHCII is cleared ⁺ Adipocytes can reduce the accumulation of obesity-induced inflammatory Th1 and M1 macrophages in adipose tissue, demonstrating the MHCII prepared by the present invention ⁺ Application of adipocytes in preparation of products for improving fat-induced adipose tissue Th1 cell infiltration and preparation of fat for improving fat inductionUse of tissue M1 macrophage infiltration in product research.

Example 5

1. Experimental method

From aH2-Aa ^DTR The mouse adipocytes are separated by magnetic beads to obtain MHCII ⁺ Adipocytes

(1) aH2-Aa was fed on a high fat diet for 12 weeks ^DTR Mice were sacrificed by cervical fracture and epididymal adipose tissue was harvested.

(2) Extraction of adipocytes: cutting the fat tissue around epididymis to about 1mm with surgical scissors ³ The pellet was digested with 5mL collagenase II (1 mg/mL,250U/mg, worthington) buffer per gram of adipose tissue at 37℃for 45 minutes at 100rpm, and filtered through a 200 μm filter. The filtered cell suspension, centrifuged at 200g for 1 min, the adipocytes will float in the upper layer and the lower pellet is the vascular matrix component (Stromal Vascular Fraction, SVF).

(3) The upper layer of adipocytes was transferred to a new tube by suction with a Pasteur pipette, 5mL of 2mM EDTA solution was added, the tube was gently shaken upside down for 5 minutes to wash the adipocytes, centrifuged at 200g for 1 minute, the lower layer of liquid was removed, and the above steps were repeated 3 times.

(4) The adipocytes obtained were divided into 200. Mu.L portions, 200. Mu.L of CD45 antibody working solution (200. Mu.L of PBS containing 2mM EDTA and 1% BSA added with 2. Mu.L of biotin-conjugated anti-mouse CD45 antibody) was added, and incubated at room temperature for 15 minutes.

(5) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute.

(6) 200. Mu.L of a magnetic bead suspension (200. Mu.L of PBS containing 2mM EDTA and 1% BSA plus 2.5. Mu. L Biotin Binder Dynabeads, purchased from Invitrogen) was added and incubated at room temperature for 15 minutes.

(7) Placing the tube containing the cell suspension on a magnetic rack, CD45 ⁺ The cells are combined with the magnetic beads and adsorbed on the tube wall, so that the CD45 is removed ⁺ And (3) cells. Cells not adsorbed by the magnetic beads were aspirated and transferred to a new tube.

(8) 200. Mu.L of MHCII antibody working solution (200. Mu.L of PBS containing 2mM EDTA and 1% BSA added with 2. Mu.L of biotin-conjugated anti-mouse MHCII antibody) was added, and incubated at room temperature for 15 minutes.

(9) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute.

(10) 200. Mu.L of the magnetic bead suspension (200. Mu.L of PBS containing 2mM EDTA and 1% BSA plus 2.5. Mu. L Biotin Binder Dynabeads) was added and incubated at room temperature for 15 minutes.

(11) Placing the tube containing the cell suspension on a magnetic rack, MHCII ⁺ The adipocytes will be bound to the magnetic beads and adsorbed on the vessel wall, and cells not adsorbed by the magnetic beads (MHCII ^- Adipocytes) are sufficiently removed, the remaining MHCII ⁺ Adipocytes were washed three times with PBS containing 2mM EDTA and 1% BSA to give MHCII ⁺ Adipocytes and MHCII ^- Adipocytes for subsequent experiments, MHCII ^- Adipocytes are derived from MHCII ⁺ The remaining adipocytes after adipocyte removal can be used to interact with MHCII ⁺ Adipocytes were compared and MHCII was explored ⁺ Characteristics of adipocytes.

Fluorescent quantitative PCR (qPCR)

(1) MHCII obtained by sorting the above magnetic beads ⁺ Adipocytes and MHCII ^- The adipocytes were extracted with the Quick-RNAMicroPrep kit from Zymo company.

(2) Reverse transcription: reverse transcription was performed using the PrimeScript RT reagent Kit with gDNA Eraser reverse transcription kit from Takara.

(3) qPCR: the expression of the MHCII complex-related gene H2-Ab1 (F: TGCCATTACCTGTGCCTTAG; R: CCTCCCGGTTGTAGATGTATC), ciita (F: GATCCTTCCAGCCTTCTCTTC; R: GTTTTGGGACAAGTTGAGCG), CD74 (F: AAGTACGGCAACATGACCC; R: ATCTTCCAGTTCACGCCATC) was detected by qPCR with SYBR Green Master Mix from Saint Corp.

The above results are shown in FIG. 4.

2. Experimental results

The inventors isolated MHCII according to the above-described magnetic bead sorting method (FIG. 4A) ⁺ Adipocytes and MHCII ^- Adipocytes, followed by RNA extraction and cDNA reversion, were subjected to qPCR detection, and found MHCII ⁺ Expression of MHCII complex-associated genes (H2-Ab 1, ciita, CD 74) in adipocytes was significantly elevated and farHigher than MHCII ^- Adipocytes (fig. 4B). The above results illustrate the separation of MHCII by the magnetic bead sorting technique of the present invention ⁺ Adipocytes are very efficient and simple.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Specific clearing of MHCII ⁺ The preparation method of the genetically engineered mice of the adipocytes comprises the following steps:

2. Specific clearance of MHCII according to claim 1 ⁺ The preparation method of the genetically engineered mice of the adipocytes further comprises the following steps:

3. MHCII ⁺ Adipocytes:

said MHCII ⁺ Adipocytes derived from aH2-Aa as claimed in claim 1 or 2 ^DTR The adipose tissue of mice, adipose tissue of other animals or humans is obtained by flow sorting or magnetic bead sorting.

4. A MHCII according to claim 3 ⁺ An adipocyte, characterized in that:

(1) Obtaining adipose tissue of an animal or human;

(5) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

(9) 1mL of PBS was added, washed once, and centrifuged at 200g for 1 minute;

5. The MHCII of claim 3 or 4 ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced insulin resistance.

6. The MHCII of claim 3 or 4 ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced adipose tissue Th1 cell infiltration.

7. The MHCII of claim 3 or 4 ⁺ Use of adipocytes in the preparation of a product for improving obesity-induced infiltration of adipose tissue M1 macrophages.