CN116086911A - MALDI-TOF mass spectrum sample preparation method - Google Patents

MALDI-TOF mass spectrum sample preparation method Download PDF

Info

Publication number
CN116086911A
CN116086911A CN202310025413.4A CN202310025413A CN116086911A CN 116086911 A CN116086911 A CN 116086911A CN 202310025413 A CN202310025413 A CN 202310025413A CN 116086911 A CN116086911 A CN 116086911A
Authority
CN
China
Prior art keywords
solution
target plate
sample
maldi
matrix
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310025413.4A
Other languages
Chinese (zh)
Inventor
尹君
陈晨
李静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiamen University
Original Assignee
Xiamen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiamen University filed Critical Xiamen University
Priority to CN202310025413.4A priority Critical patent/CN116086911A/en
Publication of CN116086911A publication Critical patent/CN116086911A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/62—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating the ionisation of gases, e.g. aerosols; by investigating electric discharges, e.g. emission of cathode
    • G01N27/64—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating the ionisation of gases, e.g. aerosols; by investigating electric discharges, e.g. emission of cathode using wave or particle radiation to ionise a gas, e.g. in an ionisation chamber
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a MALDI-TOF mass spectrometry sample preparation method, which comprises the following steps: preparing a matrix/sample mixture solution by using a hydrophilic organic solute; the substrate/sample mixed solution is easy to attach on the surface of the carrier target plate by surface treatment; and the sample is processed by adopting a vacuum drying method to regulate and control the crystallization process, so that the matrix/sample crystallization substance is uniformly covered in the sample application area, and the repeatability of sample detection in the MALDI-TOF detection process is improved. The method provided by the invention can improve the uniformity of the detected substance in the substrate in the spectroscopy detection, thereby improving the repeatability and reliability of the spectrogram, and has wide potential application in the aspects of biological detection, chemical substance characterization and the like.

Description

MALDI-TOF mass spectrum sample preparation method
Technical Field
The present invention relates to the field of spectroscopy detection. More particularly, it relates to a sample preparation method and a surface treatment method capable of improving reliability and reproducibility of mass spectrometry in biological detection.
Background
During the spectroscopic test, the surface condition of the sample often has a large influence on the test result. Taking mass spectrometry as an example, the uniformity degree, coverage rate, surface flatness degree and the like of the component distribution of the surface measured object of the sample can have different degrees of influence on the test result, especially in the test of organic matters.
In the field of biological detection, the crystallization distribution of biological macromolecules has a great influence on the test results. Taking MALDI-TOF mass spectrometry for nucleic acid detection as an example, at present, the conventional sample preparation method is a dry-drop method, i.e., mixing a matrix and a nucleic acid sample, spotting the mixture into a MALDI target plate spotting area using a pipette, and allowing the mixture to air dry. The sample prepared by the method has obvious coffee ring effect, namely crystals are concentrated at the edge of the sample application area, so that the edge of the sample application area is coarse in crystals, crystals are not formed in the sample application area, the coverage rate of the sample in the detection area is low, the content of the to-be-detected substances in each area is different, and the strength is inconsistent, so that a great deal of time and effort are required to find a proper point sampling spectrum, which is contrary to the original purpose of rapid detection by mass spectrometry, and the development of automatic detection is not facilitated.
Based on the above, many researchers use hydrophilic-hydrophobic polymer combination as a carrier to enable the sample to be selectively adsorbed to a hydrophilic area or aggregated to a hydrophobic area, so that the enrichment degree of the sample is improved; or inorganic nano particles are adopted to replace the conventional matrix, so that the process of separating out and crystallizing the matrix is omitted. These methods have some effect on improving the uniformity of crystallization of the matrix/sample, but are costly.
Disclosure of Invention
The invention mainly aims at providing a MALDI-TOF mass spectrometry sample preparation method, which comprises the following steps:
(1) Mixing a hydrophilic organic solvent with a matrix solution and a measured object solution;
(2) Performing surface activation treatment on the target plate;
(3) Carrying out spot targeting on the mixture solution obtained in the step (1);
(4) The target plate is vacuum dried, and the solvent in the mixture solution is volatilized to crystallize.
In the present invention, after the hydrophilic organic solvent is added, the water contact angle between the substrate solution and the test object solution is reduced by 10 degrees or more, for example, by 10 to 20 degrees. Further preferably, the reduction is 12 degrees or more. Further preferably, the hydrophilic organic solvent in step (1) comprises DMSO (dimethyl sulfoxide), ethanol, acetone, N-methylpyrrolidone, sulfonate-containing organic solvents, or mixtures thereof.
Preferably, the ratio of the solvent to the matrix solution and the measured object solution in the step (1) is v:v= (1-3): (1-3): (1-3). For example 1:3:3, 1:2:2, 1:1:1, 2:1:1 or 3:1:1.
In the embodiment of the invention, the target plate can be a stainless steel target plate or a gold nanoparticle-silicon-based micro-nano array structure target plate, the diameter of a sample application area of the target plate is 100nm-10 mu m, and the liquid drop amount is 0.1 mu L-10 mu L.
In the embodiment of the invention, the target plate surface activation treatment method in the step (2) is one or more of oxygen plasma treatment, nitrogen plasma treatment and hydrophilic coating application.
In the embodiment of the invention, the vacuum degree of the vacuum environment is between-0.01 MPa and-0.1 MPa, and the vacuum drying time is between 1min and 30min.
In embodiments of the invention, the matrix includes, but is not limited to, MALDI-TOF mass spectrometry matrices commonly used, for example, 3-hydroxy-2-picolinic acid (3-HPA), α -cyano-4-hydroxycinnamic acid (CHCA), 2, 5-dihydroxybenzoic acid (DHB), picolinic acid, 3-aminopicolinic acid, 3-picolinic acid, anthranilic acid, nicotinic acid, and the like.
The sample to be tested for which the mass spectrometry detection of the present invention is applicable includes, but is not limited to, at least one of various organic and inorganic small molecules, high molecular compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, carbohydrates, antigens, antibodies, cells and cell metabolites. Preferably an oligonucleotide or a nucleic acid or a polypeptide or a colony.
In the step (4), specifically, the method includes:
s1, placing a target plate in a vacuum environment until a crystal grain layer is formed on the contact surface of the target plate and the mixed liquid;
s2, taking the target plate out of the atmosphere, and naturally airing the rest solution until the solvent is completely volatilized.
Another object of the present invention is to provide a mixture solution, wherein the mixture solution is formed by mixing a hydrophilic organic solvent with a matrix solution and a solution of a measured object according to a ratio of v:v= (1-3): (1-3): (1-3), for example, 1:3:3, 1:2:2, 1:1:1, 2:1:1 or 3:1:1.
The invention also provides application of the mixture solution in mass spectrometry detection, wherein the mixture solution is formed by mixing a hydrophilic organic solvent with a matrix solution and a measured object solution according to the proportion of v:v= (1-3): (1-3): (1-3).
According to the invention, the hydrophilic solvent is added, so that the contact angle between the mixture solution and the surface of the target plate can be reduced, and the formation energy during crystallization is reduced; the vacuum environment is assisted, so that the mixture solution can quickly form crystal nuclei on the contact surface; and then the vacuum degree and the vacuum drying time are regulated so as not to quickly crystallize and cause fine stacking of crystal grains, thereby achieving the effect of improving the crystallization uniformity and further improving the repeatability of a mass spectrogram. Therefore, the invention can effectively improve the crystallization uniformity of the matrix/the sample of the measured object in the sample application area of the target plate, thereby improving the repeatability of mass spectrograms in the sample application area.
Drawings
The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate the invention and together with the description serve to explain the embodiment of the invention and the comparative examples, without limitation to the invention. Furthermore, the drawing data is a descriptive summary and not to scale.
FIG. 1 (A) is a photograph of the apparent contact angle of the mixed solution of comparative example 1 of the present invention, and FIG. 1 (B) is a photograph of the apparent contact angle of the mixed solution of example 1 of the present invention.
Fig. 2 (a) is a photograph of the apparent contact angle of the mixed solution of comparative example 2 of the present invention, and fig. 2 (B) is a photograph of the apparent contact angle of the mixed solution of example 2 of the present invention.
FIG. 3 (A) is an SEM photograph showing the whole crystallization of a matrix/nucleic acid sample according to example 1 of the present invention, and FIG. 3 (B) is an enlarged view of FIG. 3 (A).
FIG. 4 (A) is an SEM photograph showing the whole crystallization of a matrix/nucleic acid sample according to example 2 of the present invention, and FIG. 4 (B) is an enlarged view of FIG. 4 (A).
FIG. 5 is an SEM electron micrograph of a substrate/nucleic acid sample of comparative example 1 of the present invention.
FIG. 6 is an SEM electron micrograph of a matrix/nucleic acid sample of comparative example 2 of the present invention.
FIG. 7 is a schematic diagram showing the sampling positions at the time of MALDI-TOF MS detection according to the embodiment and comparative example of the present invention.
Fig. 8 is a mass spectrum measured in example 1 of the present invention.
Fig. 9 is a mass spectrum measured in example 2 of the present invention.
FIG. 10 is a mass spectrum of comparative example 1 of the present invention.
FIG. 11 is a mass spectrum of comparative example 2 of the present invention.
Component reference numerals description:
S1-S5: and (3) step (c).
Detailed Description
The following description of the embodiments of the present invention refers to the accompanying drawings, which illustrate some, but not all embodiments of the invention. All other embodiments, which can be made by one of ordinary skill in the art without undue burden from the present disclosure, are within the scope of the present disclosure.
Example 1:
s1 target plate treatment
Standard stainless steel MALDI-TOF target plates were used, with spot areas 2.6mm in diameter. Placing the target plate in an acetone solution, and ultrasonically cleaning for 5min; placing the target plate in ethanol solution, and ultrasonically cleaning for 5min; finally, placing the target plate in deionized water, ultrasonically cleaning for 5min, and taking out for use N 2 And (5) blow-drying. O is used for the cleaned stainless steel target plate 2 Plasma activation treatment for 3min.
S2 preparation of mixed solution
The oligonucleotide samples P1 used had the following sequences: GATCATCAGTACTAGTCT, relative molecular weight 5473.6, concentration 100. Mu.M,
the oligonucleotide samples P2 used had the following sequences: GATCATCAGCTCGACTAGTAGC, relative molecular weight 6719.4, concentration 100. Mu.M,
the oligonucleotide samples P3 used had the following sequences: TCAGACGTCAGATCGA, relative molecular weight 4890.3, concentration 100. Mu.M;
the matrix used was a saturated solution of 3-HPA.
Taking 10 mu l of each of the P1, P2 and P3 oligonucleotide solutions, taking 30 mu l of the matrix solution, taking 30 mu l of N-methylpyrrolidone (NMP), placing the mixture into a same centrifuge tube, and placing the centrifuge tube on a vortex oscillator for fully and uniformly mixing to obtain a matrix/nucleic acid/N-methylpyrrolidone (NMP) mixed solution;
s3 sample application
Mu.l of the mixed solution was taken out using a pipette and dropped into the spot area of the stainless steel target plate.
S4 vacuum drying
The target plate with the mixed liquid is placed in a vacuum oven, a mechanical pump is used for vacuumizing to the relative vacuum degree of-0.1 MPa, timing is started at the moment, and the target plate is taken out after vacuum drying is carried out for 2.5 min.
S5, naturally airing
And (3) placing the target plate in an atmospheric pressure environment, and naturally airing until the residual solvent is completely volatilized.
This example produced a uniform coverage inside the spot area of the stainless steel MALDI-TOF target plate, and the crystallization is shown in FIG. 3.
Example 2:
s1 target plate treatment
And taking a silicon-based micro-nano array structure target plate, wherein the diameter of a sample application area is 2.6mm. Placing the target plate in an acetone solution, and ultrasonically cleaning for 5min; placing the target plate in ethanol solution, and ultrasonically cleaning for 5min; finally, placing the target plate in deionized water, ultrasonically cleaning for 5min, and taking out for use N 2 And (5) blow-drying. O is used for the target plate with the silicon-based micro-nano array structure after cleaning 2 Plasma activation treatment for 3min.
Steps S2, S3, S4, S5 are the same as in example 1.
In this example, a matrix/nucleic acid crystal with a uniform coverage and a grain diameter of 1 μm to 2 μm was prepared in the spotted region of the target plate of the silicon-based micro-nano array structure, and the crystallization is shown in FIG. 4.
Comparative example 1:
the S1 procedure is as in example 1.
S2 preparation of mixed solution
The oligonucleotide samples P1 used had the following sequences: GATCATCAGTACTAGTCT, relative molecular weight 5473.6, concentration 100. Mu.M,
the oligonucleotide samples P2 used had the following sequences: GATCATCAGCTCGACTAGTAGC, relative molecular weight 6719.4, concentration 100. Mu.M,
the oligonucleotide samples P3 used had the following sequences: TCAGACGTCAGATCGA, relative molecular weight 4890.3, concentration 100. Mu.M;
the matrix used was a saturated solution of 3-HPA.
Taking 10 mu l of each of the P1, P2 and P3 oligonucleotide solutions, taking 30 mu l of the matrix solution, taking 30 mu l of the acetonitrile/water solution, placing the mixture into the same centrifuge tube, and placing the centrifuge tube on a vortex oscillator for fully and uniformly mixing to obtain a matrix/nucleic acid mixed solution;
s3 procedure is as in example 1.
S4 vacuum drying
And (3) placing the target plate with the mixed liquid in a vacuum oven, vacuumizing by using a mechanical pump until the relative vacuum degree is-0.1 MPa, and vacuum drying for 10min until the target plate is completely crystallized.
The crystallization of the matrix/nucleic acid prepared in this comparative example is shown in FIG. 5.
Comparative example 2:
the step S1 is the same as in example 2.
Steps S2, S3, S4 are the same as comparative example 1.
The crystallization of the matrix/nucleic acid prepared in this comparative example is shown in FIG. 6.
Testing and analysis of samples
The above examples 1, 2, 1 and 2 were fed to MALDI-TOF MS for detection, and 9 spots were detected at the same position in each sample area, and the positions were shown in FIG. 7. The mass spectrum obtained in example 1 of the present invention is shown in fig. 8, the mass spectrum obtained in example 2 is shown in fig. 9, the mass spectrum obtained in comparative example 1 is shown in fig. 10, and the mass spectrum obtained in comparative example 2 is shown in fig. 11.
As can be seen from the comparison of FIGS. 3 and 5 and FIGS. 4 and 6, the matrix/nucleic acid crystals prepared by the method of the present invention are uniformly distributed in the spotting region, and the crystal thickness of each region is similar, without coffee ring effect.
As can be seen from the comparison of fig. 8 and 10 and fig. 9 and 11, the samples prepared by the method of the present invention have smaller peak intensity deviations of the mass spectrogram obtained at each position. Therefore, the sample preparation method can obtain better mass spectrogram repeatability, saves time for searching a proper detection point, greatly improves the detection efficiency of mass spectrum in the aspect of nucleic acid detection, and has important significance for automation of mass spectrum nucleic acid detection. In addition, the invention has potential application to the fields of organic acid crystallization, biomacromolecule crystallization and the like.
The above-described embodiments are provided to illustrate the principle of the present invention and its effects, and are not intended to limit the present invention. Modifications to the above would be obvious to those of ordinary skill in the art, without departing from the spirit and scope of the present invention. The scope of the invention is therefore intended to be indicated by the appended claims.

Claims (10)

1. A method for MALDI-TOF mass spectrometry, comprising the steps of:
(1) Mixing a hydrophilic organic solvent with a matrix solution and a measured object solution;
(2) Performing surface activation treatment on the target plate;
(3) Carrying out spot targeting on the mixture solution obtained in the step (1);
(4) And (3) carrying out vacuum drying treatment on the target plate, volatilizing the solvent in the mixture solution to crystallize, wherein the relative vacuum degree of vacuum drying is between-0.01 Mpa and-0.1 Mpa, and the vacuum drying time is between 1min and 30min.
2. The method according to claim 1, wherein the hydrophilic organic solvent in step (1) is: after the addition, the water contact angle of the matrix solution and the mixed solution of the object to be measured is reduced by more than 10 degrees.
3. The method of claim 1, wherein the substrate of step (1) is at least one of 3-hydroxy-2-picolinic acid, 2, 5-dihydroxybenzoic acid, α -cyano-4-hydroxycinnamic acid, picolinic acid, 3-aminopicolinic acid, 3-picolinic acid, anthranilic acid, or niacin.
4. The method of claim 1, wherein the test substance of step (1) comprises at least one of small organic molecules, inorganic, polymeric compounds, viruses, microorganisms, nucleotides, nucleosides, oligonucleotides, nucleic acids, amino acids, peptides, proteins, lipids, carbohydrates, antigens, antibodies, cells, and cell metabolites.
5. The method of claim 1, wherein in step (1), the solvent: matrix solution: the ratio of the measured object solution is v:v= (1-3): (1-3): (1-3).
6. The method of claim 1, wherein the target plate surface activation treatment in step (2) comprises one or more of oxygen plasma treatment, nitrogen plasma treatment, and application of a hydrophilic coating.
7. A MALDI-TOF mass spectrometry method comprising the steps of:
(1) Mixing a hydrophilic organic solvent with a matrix solution and a measured object solution;
(2) Performing surface activation treatment on the target plate;
(3) Carrying out spot targeting on the mixture solution obtained in the step (1);
(4) Vacuum drying the target plate to volatilize the solvent in the mixture solution so as to crystallize the target plate, wherein the relative vacuum degree of the vacuum drying is between-0.01 Mpa and-0.1 Mpa, and the vacuum drying time is between 1min and 30min;
(5) The uniformly dried target plate was subjected to MALDI-TOF mass spectrometry.
8. The method for detecting MALDI-TOF mass spectrometry according to claim 7, wherein: the hydrophilic organic solvent in the step (1) comprises DMSO, ethanol, acetone, N-methylpyrrolidone, an organic solvent containing sulfonate, or a mixture thereof.
9. The mixture solution is formed by mixing a hydrophilic organic solvent with a matrix solution and a measured object solution according to the proportion of v:v= (1-3): (1-3): (1-3).
10. The application of the mixture solution in mass spectrometry detection is that the mixture solution is formed by mixing a hydrophilic organic solvent with a matrix solution and a measured object solution according to the proportion of v:v= (1-3): (1-3): (1-3).
CN202310025413.4A 2023-01-09 2023-01-09 MALDI-TOF mass spectrum sample preparation method Pending CN116086911A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310025413.4A CN116086911A (en) 2023-01-09 2023-01-09 MALDI-TOF mass spectrum sample preparation method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310025413.4A CN116086911A (en) 2023-01-09 2023-01-09 MALDI-TOF mass spectrum sample preparation method

Publications (1)

Publication Number Publication Date
CN116086911A true CN116086911A (en) 2023-05-09

Family

ID=86186456

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310025413.4A Pending CN116086911A (en) 2023-01-09 2023-01-09 MALDI-TOF mass spectrum sample preparation method

Country Status (1)

Country Link
CN (1) CN116086911A (en)

Similar Documents

Publication Publication Date Title
US20210280406A1 (en) General-purpose nanochip for mass spectrum analysis, preparation method therefor, and application thereof
Gologan et al. Ion soft-landing into liquids: Protein identification, separation, and purification with retention of biological activity
US7655902B2 (en) Nanowire assisted laser desorption/ionization mass spectrometric analysis
CN112858459B (en) Matrix sample preparation method and matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis method
JP2007535107A (en) Use of diamond and other materials composites or compositions for analyte analysis
US8278117B2 (en) Sample holder for maldi mass spectrometric analysis, and mass spectrometric analysis method
Patil et al. Forced dried droplet method for MALDI sample preparation
CN108845023A (en) A kind of laser desorption ionisation Mass Spectrometry detection method
Wu et al. Combination of nano-material enrichment and dead-end filtration for uniform and rapid sample preparation in matrix-assisted laser desorption/ionization mass spectrometry
JP3548769B2 (en) Carbon support plate for forming fine and uniform crystals and its application
CN110243920A (en) Application of the 2- hydrazine quinoline as matrix in MALDI-TOF-MS analysis carbohydrate
US20040217277A1 (en) Apparatus and method for surface activation and selective ion generation for MALDI mass spectrometry
CN116086911A (en) MALDI-TOF mass spectrum sample preparation method
CN107884466A (en) Correct the method and product of the accuracy rate of Mass Spectrometer Method microbiological specimens
CN116660359A (en) Composition for mass spectrometry, chip and application thereof
CN108344793B (en) Matrix, preparation method thereof and mass spectrometry detection method of metabolic molecules
US20050133715A1 (en) Matrix with noise reduction additive and disposable target containing the same
CN113176329A (en) Application of cobaltosic oxide as matrix in MALDI-TOF MS detection of small molecules
US9455130B2 (en) Preparation of test plates for matrix assisted laser desorption ionization
CN107884467A (en) Improve the method and product of Mass Spectrometer Method glycosyl crystallization
CN107991491A (en) Correct the method and product of the accuracy rate of Mass Spectrometer Method protein sample
CN109490404B (en) Application of metal-nitrogen doped porous carbon material in mass spectrometry detection
Patil et al. MALDI sample preparation methods: A mini review
CN108132295B (en) Application of 1, 8-naphthalimide derivative as matrix in MALDI-MS
CN111205466A (en) Covalent organic framework material, preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination