CN116083541A

CN116083541A - Method for enriching low-abundance mononucleotide variant

Info

Publication number: CN116083541A
Application number: CN202211705759.0A
Authority: CN
Inventors: 刘翼振; 陈勇; 赵屹
Original assignee: Shenzhen University
Current assignee: Shenzhen University
Priority date: 2022-12-29
Filing date: 2022-12-29
Publication date: 2023-05-09
Anticipated expiration: 2042-12-29
Also published as: CN116083541B

Abstract

The invention relates to the technical field of biological detection, in particular to a method for enriching low-abundance mononucleotide variants, which comprises the following steps: designing crrnas of Cas12a protein according to the target sequence; designing a forward primer and a reverse primer for amplification according to a target sequence; mixing the buffer solution with the forward primer, the reverse primer, the Cas12a protein and the crRNA to obtain a reaction system; and adding a sample to be detected into the reaction system, and then reacting for a preset time at a preset temperature to realize enrichment of the low-abundance mononucleotide variant. In particular, when a fluorescence detection DNA single-stranded probe (reporter) is added to the reaction system, the cleavage probe generates a fluorescence signal by using the trans-cleavage activity of Cas12a, and the SNV abundance of the sample can be primarily determined. The invention utilizes the characteristics of a reaction system comprising an RPA reaction system and a CRISPR/Cas12a reaction system, realizes the purpose of enriching SNV by the competitive reaction of recombinase polymerase amplification and CRISPR-Cas12a on a low-abundance sample in a tube, and has the detection limit of 0.01 percent.

Description

Method for enriching low-abundance mononucleotide variant

Technical Field

The invention relates to the technical field of biological detection, in particular to a method for enriching low-abundance mononucleotide variants.

Background

Single nucleotide variants (Single Nucleotide Variants, SNVs) in humans have been used as detection markers, such as drug resistance, cancer diagnosis, infectious diseases, etc. In the prior art, sequencing is the gold standard for detecting SNV. However, single nucleotide variants are not only extremely small in absolute number, but are also often severely disturbed by large amounts of Wild-Type nucleic acid (WT). Thus, sequencing of less than 1% of samples is not accurately detected. Thus, a related art for enriching SNV was developed to meet the sequencing standards.

Traditional enrichment techniques for single nucleotide variants fall into two categories; one is capture enrichment technology, and the other is enrichment technology based on PCR amplification technology. However, capture enrichment techniques can result in the loss of nucleic acid during capture elution and still require amplification when the captured SNV is insufficient to meet sequencing standards. The specific primers for the enrichment technology based on the PCR amplification technology have high design and screening difficulty, can cause poor amplification efficiency, and can still amplify the WT to a certain extent. In addition, the precise temperature control required for these techniques requires large and expensive instrumentation support.

The CRISPR/Cas system has single nucleotide resolution capability, cas protein is combined with guide crRNA thereof, and the base complementary pairing of the crRNA and the target sequence is used for further exciting the cis-cleavage activity of the Cas protein so as to cut off the target sequence from the middle. Because WT and SNV have single base differences, they can cause Cas protein cleavage rates to be different, and enrichment is achieved by amplifying the uncleaved sequence by isothermal amplification techniques.

Chen et al realized the purpose of enriching SNV by combining RPA amplification technology with Cas9, but Cas9 protein off-target effect was higher, seed region was shorter, and its guide RNA was up to 100nt, with higher cost.

Accordingly, the prior art is still in need of improvement and development.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a method for enriching low abundance single nucleotide variants, which aims to solve the problem that sequencing of single nucleotide variants in the prior art cannot accurately detect samples with less than 1% SNV.

The technical scheme of the invention is as follows:

a method of enriching for low abundance single nucleotide variants, comprising the steps of:

designing crrnas of Cas12a protein according to the target sequence;

designing a forward primer and a reverse primer for amplification according to a target sequence;

mixing a buffer solution with the forward primer, the reverse primer, the Cas12a protein and the crRNA to obtain a reaction system;

and adding a sample to be detected into the reaction system, and then reacting for a preset time at a preset temperature to realize enrichment of the low-abundance mononucleotide variant.

The method of enriching for low abundance single nucleotide variants, wherein the crRNA is a guide RNA of the Cas12a protein, the guide RNA comprising a universal sequence and a spacer sequence.

The method for enriching low-abundance mononucleotide variants, wherein the universal sequence autonomously forms a hairpin structure which is specifically identified with the Cas12a protein; the spacer sequence is fully complementary to wild-type DNA in the sample to be tested, and the spacer sequence has a mismatch to the single nucleotide variant in the sample to be tested.

The method for enriching the low-abundance mononucleotide variant, wherein the general sequence is 5'-UAAUUUCUACUAAGUGUAGAU-3', and the interval sequence is at least 18 base X connected to the 3' -end of the general sequence; wherein each base X is independently selected from one of A, G, C or T.

The method for enriching the low-abundance mononucleotide variant comprises the following steps of; the RPA reaction system comprises the forward primer, the reverse primer, recombinase, polymerase, single-stranded binding protein and buffer solution; the CRISPR-Cas12a reaction system comprises the Cas12a protein, the crRNA.

The method for enriching the low-abundance single nucleotide variant, wherein the preset temperature is 37-42 ℃; the predetermined time is greater than 20 minutes.

The method for enriching the low-abundance single nucleotide variant comprises the step of detecting the sample containing wild DNA and the single nucleotide variant.

In the method for enriching the low-abundance mononucleotide variant, a fluorescence detection DNA single-stranded probe is added into the reaction system, the fluorescence detection DNA single-stranded probe is cut by utilizing the trans-cleavage activity of the Cas12a protein to generate a fluorescence signal, and the SNV abundance of the sample to be detected is preliminarily judged;

fluorescent groups and quenching groups are respectively modified at two ends of the fluorescent detection DNA single-chain probe. .

The method of enriching low abundance single nucleotide variants, wherein the Cas12a protein comprises one or more of LbCas12a, fnCas12a, asCas12 a; the Cas12a protein is obtained by recombinant expression or protein purification.

The method for enriching the low-abundance mononucleotide variant comprises the step of selecting a sample to be detected from one of bacteria, tissues and body fluid.

The beneficial effects are that: the invention provides a method for enriching low-abundance mononucleotide variants, which comprises the following steps: designing crrnas of Cas12a protein according to the target sequence; designing a forward primer and a reverse primer for amplification according to a target sequence; mixing a buffer solution with the forward primer, the reverse primer, the Cas12a protein and the crRNA to obtain a reaction system; and adding a sample to be detected into the reaction system, and then reacting for a preset time at a preset temperature to realize enrichment of the low-abundance mononucleotide variant. Particularly, when a fluorescence detection DNA single-stranded probe (reporter) is added into the reaction system, a fluorescence signal is generated by using the trans-cleavage active cleavage probe of Cas12a, so that the SNV abundance of the sample to be detected can be primarily determined. The invention utilizes the characteristics of a reaction system comprising an RPA reaction system and a CRISPR/Cas12a reaction system, realizes the purpose of enriching SNV by the competitive reaction of recombinase polymerase amplification (Recombinase polymerase amplification, RPA) and CRISPR-Cas12a on low-abundance samples in a tube, and has the detection limit of 0.01 percent.

Drawings

FIG. 1 is a schematic diagram of a method of enriching low abundance single nucleotide variants according to the present invention;

FIG. 2 is a gel electrophoresis diagram of the reaction system of example 1 of the present invention for optimizing the concentration of Cas12 a-crRNA;

FIG. 3 is a data graph of example 2 enriched FLT 3F 691L samples of this invention;

FIG. 4 (A-B) is a graph showing trans-cleavage data for FLT 3F 691L enriched samples according to example 3 of the present invention;

FIG. 5 is a data graph of EGFR-enriched L858R samples of example 4 of the present invention;

fig. 6 (a-B) is a data graph of PAM-free EGFR L858R enriched sample of example 5 of the present invention;

FIG. 7 is a data graph of example 6 enriched BRCA1-3232A > G samples of the present invention.

Detailed Description

The invention provides a method for enriching low-abundance mononucleotide variants, which is used for making the purposes, technical schemes and effects of the invention clearer and more definite, and is further described in detail below. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

It will be understood by those skilled in the art that all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs unless defined otherwise. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Traditional enrichment techniques for single nucleotide variants fall into two categories, including capture enrichment techniques, enrichment techniques based on PCR amplification techniques. Specifically, the capture enrichment technology is to separate mutant DNA fragments from mixed samples by specifically combining modified magnetic beads or probes modified on a biochip with the mutant gene fragments based on DNA hybridization reaction, so as to improve the abundance of the mutant DNA fragments for subsequent detection, but the technology causes loss of nucleic acid during capture elution, and amplification is still required when the captured SNV is insufficient to meet the sequencing standard. Enrichment techniques based on PCR amplification techniques include mutant amplification blocker systems (ARMS), blocker PCR (Blocker PCR), low temperature annealing co-amplification PCR (COLD-PCR), blocker displacement amplification systems (BDA), etc.; these techniques increase enrichment sensitivity and specificity of low abundance samples either by designing specific primers or by adding a blocker probe, both by virtue of hybridization thermodynamic differences due to single base differences of WT and SNV; however, not only is the difficulty of designing and screening with specific primers high, but it also results in poor amplification efficiency and to some extent WT will still be amplified, in addition to the precise temperature control required for these techniques, large and expensive instrumentation support is required.

In contrast, in the CRISPR-Cas system, cas12a seed regions are wider and off-target effects are low compared to other Cas proteins, and are suitable for enrichment of single nucleotide variants. And trans-cleavage activity of Cas12a can provide one preliminary detection result of the sample by the fluorescent probe.

Based on this, the present invention provides a method for enriching low abundance single nucleotide variants, comprising the steps of:

step S10: designing crrnas of Cas12a protein according to the target sequence;

step S20: designing a forward primer and a reverse primer for amplification according to a target sequence;

step S30: mixing a buffer solution with the forward primer, the reverse primer, the Cas12a protein and the crRNA to obtain a reaction system;

step S40: and adding a sample to be detected into the reaction system, and then reacting for a preset time at a preset temperature to realize enrichment of the low-abundance mononucleotide variant.

Because the CRISPR/Cas12a reaction has single nucleotide resolution capability, the crRNA with high reactivity to WT (Wild-Type nucleic acid) samples is designed in a targeted manner to achieve cleavage damage to WT samples, while the SNV samples have lower binding efficiency to crRNA, so that the reactivity is lower and cannot be damaged.

In the embodiment, the cutting damage of the CRISPR/Cas12a to the WT sample in the sample to be detected in the single-tube reaction causes the reduction of the RPA amplification template, thereby inhibiting the RPA amplification of the WT sample; the SNV sample in the sample to be detected is not interfered by CRISPR/Cas12a, so that a large number of amplicons can be rapidly generated, enrichment of the SNV sample in a tube type is realized, meanwhile, a fluorescent detection DNA probe is added into a reaction system of the method, and a fluorescent signal can be generated by utilizing a trans-cleavage active cleavage probe of the Cas12a, so that the abundance of SNV is detected. The method does not need a precise temperature control system and is simple and convenient to operate. By utilizing the method, less than 1% of samples can be enriched to reach the sequencing standard in a short time through simple operation, and the design is flexible.

That is, the method for enriching the low-abundance mononucleotide variant based on RPA-CRISPR of the invention realizes the purpose of enriching SNV by the competitive reaction of Recombinase Polymerase Amplification (RPA) and CRISPR-Cas12a on a low-abundance sample in a tube, and the detection limit can reach 0.01 percent.

In some embodiments, the crRNA is a guide RNA of the Cas12a protein, the guide RNA comprising a universal sequence and a spacer sequence.

In some embodiments, the universal sequence autonomously forms a hairpin structure; the spacer sequence is fully complementary to wild-type DNA in the sample to be tested, and the spacer sequence has a mismatch to the single nucleotide variant in the sample to be tested.

Specifically, the universal sequence can autonomously form a hairpin structure; the spacer sequence can be fully base complementary paired with the Target Sequence (TS) of wild-type DNA in the sample to be tested, while there is a mismatch site with the target sequence of SNV, thereby allowing for a difference in the rate of WT and SNV binding to Cas12 a-crRNA.

In some embodiments, the universal sequence is 5'-UAAUUUCUACUAAGUGUAGAU-3' and the spacer sequence is at least 18 base X attached to the 3' end of the universal sequence; wherein each base X is independently selected from one of A, G, C or T.

In another embodiment, specificity may be increased by introducing a mismatch on the crRNA when the mutation site of the target is insufficient for the Cas12a-crRNA to distinguish WT from SNV.

In some embodiments, the reaction system comprises an RPA reaction system and a CRISPR-Cas12a reaction system; the RPA reaction system comprises the forward primer, the reverse primer, recombinase, polymerase, single-stranded binding protein and buffer solution; the CRISPR-Cas12a reaction system comprises the Cas12a protein, the crRNA.

Specifically, the RPA reaction system comprises a specific amplification primer, recombinase, polymerase, single-chain binding protein and buffer solution aiming at a sample to be detected; the CRISPR-Cas12a reaction system includes the Cas12a protein and a crRNA with high specificity to a WT sample.

In some embodiments, the primer is added to the reaction system at a concentration of C _{Guiding device} At this time, it is necessary to adjust the respective concentrations of Cas12a and crRNA to 0-C _{Guiding device} In between, the amplification of the WT is inhibited to the greatest extent, and the amplification of the SNV is not interfered, namely, the ratio of the SNV to the amplification product of the WT is maximized.

In some embodiments, the RPA amplification in the RPA reaction system includes, but is not limited to, isothermal amplification techniques like RPA.

In some embodiments, the step S40 further comprises detection after reacting for a predetermined time at a predetermined temperature, including but not limited to sequencing, digital PCR (Digital Polymerase Chain Reaction, dPCR), and the like.

In some embodiments, the predetermined temperature is 37-42 ℃; the predetermined time is greater than 20 minutes.

Specifically, in the step S40, after adding a sample to be tested into the reaction system, performing a constant temperature timing reaction, wherein Ribonucleoprotein (RNP) formed by Cas12a-crRNA specifically binds to the WT sample and generates cis-cleavage to damage the WT template strand, thereby inhibiting amplification of the WT sample; and SNV is not easy to be identified by Cas12a-crRNA, so that the protected SNV template can be combined with a primer for amplification, enrichment of SNV is finally realized, and a result can be obtained by sequencing an enriched sample.

In a preferred embodiment, the predetermined temperature is 37 ℃; the predetermined time is 30 minutes. And (3) reacting for 30 minutes at the temperature to realize enrichment of the SNV sample.

Specifically, the ribonucleoprotein formed by the Cas12a-crRNA is preferentially combined with the wild type nucleic acid to generate cis-cleavage after being mixed with a sample to be detected through the reaction system for carrying out constant temperature and timing reaction for 30min at 37 ℃, and simultaneously SNV is more slowly recognized by the Cas12a-crRNA, so that the SNV is combined with a primer for amplification, enrichment of the SNV is finally caused, and a result can be obtained by sequencing the enriched sample. The principle diagram of the method for enriching the low-abundance mononucleotide variant is shown in fig. 1, and the method comprises two parts: one is the effect of wild-type DNA and SNV with Cas12a protein; secondly, the amplification condition of the wild DNA and the SNV RPA; specifically, the target sequence of wild-type DNA is fully base-complementary to crRNA, while SNV has a base mismatch with it, and the template and amplicon of WT are more easily cleaved by Cas12a-crRNA because Cas12a-crRNA complex recognizes and cleaves WT (template/amplicon) faster than SNV, and the wild-type sequence content is higher in low abundance samples. Ultimately resulting in enrichment of SNV.

In some embodiments, adding a fluorescence detection DNA single-stranded probe to the reaction system, cleaving the fluorescence detection DNA single-stranded probe with the trans-cleavage activity of the Cas12a protein to generate a fluorescence signal, and performing a preliminary determination of the SNV abundance of the sample to be detected; fluorescent groups and quenching groups are respectively modified at two ends of the fluorescent detection DNA single-chain probe.

Specifically, both ends of the fluorescence detection DNA single-stranded probe are respectively modified with a fluorescent group and a quenching group. The fluorophores include, but are not limited to, one or more of carboxyfluorescein (FAM), tetrachloro-6-carboxyfluorescein (TET), and hexachloro-6-methylfluorescein (HEX); the excitation wavelength used by the different fluorophores during the detection process is also different, for example, the fluorophores can be, but are not limited to, carboxyfluorescein, the excitation wavelength used during the fluorescence detection process is about 494nm, and the emission wavelength of the collected carboxyfluorescein is about 518nm; the quenching groups include, but are not limited to, one or more of 4- (4-dimethylaminoazobenzene) benzoic acid (DABCYL) and Black Hole Quenching (BHQ) and; wherein the fluorescent group may also be a fluorescent dye of other emission wavelength, the Black Hole Quencher (BHQ) includes, but is not limited to, black hole quencher 1 (BHQ-1), black hole quencher 2 (BHQ-2), or black hole quencher (BHQ-3). The detectable marker may be a fluorophore, digoxin or other substance that produces a detectable signal.

In some embodiments, the test sample contains wild-type DNA and single nucleotide variants.

In some embodiments, when the 5' end of the non-target sequence of the target DNA does not contain the PAM sequence TTTN recognized by the Cas12a protein, it can be introduced by designing the PAM sequence on the amplification primer.

In some embodiments, the Cas12a protein includes, but is not limited to, one or more of LbCas12a, fnCas12a, asCas12a, or other Cas12 a-like proteins with specific cleavage activity.

In some embodiments, the Cas12a protein may be obtained by, but is not limited to, recombinant expression or protein purification. Alternatively, the Cas12a is also available through commercial purchase.

In some embodiments, the sample to be tested is selected from one of bacteria, tissue, body fluid.

Specifically, the sample to be tested may be subjected to nucleic acid extraction treatment; the sample to be tested includes, but is not limited to, a mammal or plant derived from a human.

The following examples are further illustrative of the invention. It is also to be understood that the following examples are given solely for the purpose of illustration and are not to be construed as limitations upon the scope of the invention, since numerous insubstantial modifications and variations will now occur to those skilled in the art in light of the foregoing disclosure.

Example 1

And (3) establishing an RPA-CRISPR reaction system of the FLT 3F 691L target gene.

1. Sequence selection: searching a target sequence containing a single-base nucleic acid mutation site in NCBI website, wherein the single-base mutation site of the sequence is positioned within 24 bases after the PAM sequence TTTN of the Cas12a protein.

The gene fragment (NCBI Reference Sequence:NG_ 007066.1) of FLT 3F 691L is screened, the forward sequence of the gene fragment is shown as a sequence table SEQ ID NO. 1, and the nucleotide sequence of the sequence table SEQ ID NO. 1 is TAAGAAGAGCTAGGCTCAGAAAAAGTTGTACTGTCCCCAAGTCAGCAGAGAACCAAGCCCTCCTAAGAGTATGTTGTCTGCTACATAGACTTCTGAAATAACAGTTTGCTTTGTGTATGCCTATAATTGAAACTGTAACTATTTCAGGACCAATTTA (italic TTTA represents PAM) CTTGATTTTT (italic T represents mutation site) GAATACTGTTGCTATGGTGATCTTCTCAACTATCTAAGAAGTAAAAGAGAAAAATTTCACAGGACTTGGACAGAGATTTTCAAGGAACACAATTTCAGTTTTTACCCCACTTTCCAATCACATCCAAATTCCAGGTAAGAGGCTGGGTCAGGGTTTCGTAATTACACATCATAGAACGTAGGCAAAGTGTGCT. The nucleic acid plasmids of the samples were synthesized by third party synthesis companies.

Crrna design: the crRNA is designed according to the target sequence selected, and is fully complementary with the wild type DNA, and has mismatch with SNV. The crRNA sequence is designed near the mutation site,

its forward sequence targeting FLT3 genome is 5'-UAAUUUCUACUAAGUGUAGAUCUUGAUUUUUGAAUACUGUUGCU-3'.

3. Primer design: forward and reverse primers were designed based on the target sequences screened. The forward sequence is shown as a sequence table SEQ ID NO. 2; the reverse sequence is shown in a sequence table SEQ ID NO. 3.

4. And (3) optimizing a reaction system: in the reaction system, equal amounts of WT and SNV samples were reacted at 37℃for 30 minutes, with primer concentrations of 800nM unchanged, and Cas12a-crRNA concentrations of 0, 200, 400, 600, 800nM were selected to achieve the maximum amplification product ratio (SNV/wild-type DNA).

As shown in fig. 2, the product band intensities of WT and SNV are substantially consistent with Cas12a-crRNA concentration of 200 nM; and as Cas12a-crRNA concentration increases to 600 and 800nM, the product band of SNV becomes shallower or even disappears. Thus, 400nM of Cas12a-crRNA was chosen as the final concentration for a tubular reaction.

Example 2

Enrichment and detection limit assessment of low-abundance single nucleotide variants in FLT 3F 691L target genes.

To further evaluate the enrichment effect of the mutation enrichment methods described herein, the following effect examples were performed. The examples are given by way of illustration only and are not to be construed as limiting the scope of the invention in any way.

Enrichment reaction system: a total volume of 50uL, including 400nM Cas12a, 400nM crRNA, 800nM forward primer, 800nM reverse primer, 4uL sample DNA, buffer, and reaction at 37℃for 30min, followed by sequencing.

As shown in FIG. 3, the mutation enrichment method can effectively enrich FLT F691L samples, and 1% of sample mutation site T bases are changed into G bases. The 0.01% sample was enriched 826-fold.

Example 3

The FLT 3F 691L gene was detected in trans-cleavage in this method.

The reaction system: the total volume is 25uL, and 400nM of Cas12a, 400nM of crRNA, 800nM of forward primer, 800nM of reverse primer, 100fM of sample DNA with different abundance, 1uM of fluorescence detection DNA single-stranded probe reporter (5 '-BHQ 1-TTTTTTTT-FAM-3'), buffer solution and the reaction is carried out for 30min at the constant temperature of 37 ℃.

As shown in fig. 4 (a), each system starts generating a fluorescence signal at 600s, and each abundance is discriminated and gradually increased at about 800s, and an end point fluorescence signal at 30min can be obtained in combination with fig. 4 (B), and the fluorescence signal increases as the ratio of SNV increases. That is, the fluorescent signal is mainly excited by SNV rather than WT, which is suppressed at the beginning of the reaction.

Example 4

Enrichment and detection limit assessment of low-abundance single nucleotide variants in EGFR L858R target genes.

Screening the gene fragment and designing crRNA and primers as shown in example 1 to obtain a gene sequence (NCBI Reference Sequence:NM_ 005228.5) with the sequence shown in a sequence table: ATCAGTAGTCACTAACGTTCGCCAGCCATAAGTCCTCGACGTGGAGAGGCTCAGAGCCTGGCATGAACATGACCCTGAATTCGGATGCAGAGCTTCTTCCCATGATGATCTGTCCCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCT (italic T indicates mutation site) GGCCAAA (italic CAAA indicates PAM) CTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGTCAGCCAGCATTTTCCTGACACCAGGGACCAGGCTGCCTTCCCACTAGCTGTATTGTTTAACACATGCAGGGGAGGATGCTCTCCAGACATTCTGGGTGAGCTCGCAGCAGCTGCTGC shown in SEQ ID NO. 4.

The crRNA has the sequence of

5’-UAAUUUCUACUAAGUGUAGAUGCCAGCCCAAAAUCUGUGAU-3’；

The sequence of the forward primer is shown in a sequence table SEQ ID NO. 5;

the sequence of the reverse primer is shown in a sequence table SEQ ID NO. 6.

Enrichment reaction system: a total volume of 50uL, including 800nM Cas12a, 800nM crRNA, 800nM forward primer, 800nM reverse primer, 4uL sample DNA, buffer, was reacted at 37℃for 30min and then sequenced.

As shown in fig. 5, the mutation enrichment method of the present application can effectively enrich EGFR L858R samples, and 1% of the sample mutation sites T bases are changed to G bases. The 0.01% samples were enriched 2728-fold.

Example 5

PAM-free enriched EGFR L858R sample and detection limit assessment

To verify that the system of the invention can still function in the absence of PAM from the target, the EGFR L858R gene fragment (example 4) was stripped of its PAM sequence, while primers were designed to introduce the PAM at the same positions. The specific gene sequence is shown in a sequence table SEQ ID NO. 7, namely ATCAGTAGTCACTAACGTTCGCCAGCCATAAGTCCTCGACGTGGAGAGGCTCAGAGCCTGGCATGAACATGACCCTGAATTCGGATGCAGAGCTTCTTCCCATGATGATCTGTCCCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCT (italic T indicates mutation site) GGCCTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGTCAGCCAGCATTTTCCTGACACCAGGGACCAGGCTGCCTTCCCACTAGCTGTATTGTTTAACACATGCAGGGGAGGATGCTCTCCAGACATTCTGGGTGAGCTCGCAGCAGCTGCTGC;

the primer sequences are shown in SEQ ID NO. 8 and SEQ ID NO. 9 of the sequence list. The crRNA sequence remained unchanged in example 4.

Enrichment reaction system: a total volume of 50uL, including 100nM Cas12a, 100nM crRNA, 800nM forward primer, 800nM reverse primer, 4uL sample DNA, buffer, and reaction at 37℃for 30min, followed by sequencing.

As shown in FIG. 6 (A), both WT and SNV can normally introduce PAM sequences by amplification. Thereafter, fig. 6 (B) shows that the system of the present invention can effectively enrich the target without PAM region, and the detection limit can reach 0.01%. 0.01% of EGFR L858R (without PAM) was enriched to more than 85%.

Example 6

Enrichment and detection limit assessment of low-abundance single nucleotide variants in BRCA1 target genes.

Screening the gene fragment and designing crRNA and primers as shown in example 1 to obtain the gene sequence shown in SEQ ID NO. 10 of the sequence Listing as

ACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAG

AACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAA AATGTTTTTA (italic TTTA for PAM) AAGA (italic A for mutation site) AGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGT GGGCTCCAGTATTAATGAAATAGGTTCCAGTGA

The crRNA has a sequence of 5'

-UAAUUUCUACUAAGUGUAGAUAAGAAGCCAGCUCAAGCAAUAU-3’；

The sequence of the forward primer is shown in a sequence table SEQ ID NO. 11.

The sequence of the reverse primer is shown in a sequence table SEQ ID NO. 12

As shown in FIG. 7, the mutation enrichment method can effectively enrich BRCA1-3232A > G samples, and 1% of the samples change mutation site A bases into G bases. The 0.01% samples were enriched 223-fold.

In summary, the method for enriching low-abundance single nucleotide variants provided by the invention comprises the following steps: designing crrnas of Cas12a protein according to the target sequence; designing a forward primer and a reverse primer for amplification according to a target sequence; mixing a buffer solution with the forward primer, the reverse primer, the Cas12a protein and the crRNA to obtain a reaction system; and adding a sample to be detected into the reaction system, then reacting for a preset time at a preset temperature, and sequencing to realize enrichment of the low-abundance mononucleotide variant. Particularly, when a fluorescence detection DNA single-stranded probe (reporter) is added into the reaction system, a fluorescence signal is generated by using the trans-cleavage active cleavage probe of Cas12a, so that the SNV abundance of the sample to be detected can be primarily determined. The invention utilizes the characteristics of a reaction system comprising an RPA reaction system and a CRISPR/Cas12a reaction system, realizes the purpose of enriching SNV by the competitive reaction of recombinase polymerase amplification (Recombinase polymerase amplification, RPA) and CRISPR-Cas12a on low-abundance samples in a tube, and has the detection limit of 0.01 percent.

Meanwhile, the method for enriching the low-abundance mononucleotide variant based on the RPA isothermal amplification technology and the CRISPR-Cas12a system does not need precise temperature control, is low in cost, is simple and quick to operate, and has the advantages of high sensitivity and specificity.

It is to be understood that the invention is not limited in its application to the examples described above, but is capable of modification and variation in light of the above teachings by those skilled in the art, and that all such modifications and variations are intended to be included within the scope of the appended claims.

Claims

1. A method of enriching a low abundance single nucleotide variant comprising the steps of:

designing crrnas of Cas12a protein according to the target sequence;

2. The method of enriching for low abundance single nucleotide variants according to claim 1, wherein the crRNA is a guide RNA of the Cas12a protein, the guide RNA comprising a universal sequence and a spacer sequence.

3. The method of enriching a low abundance single nucleotide variant according to claim 2, wherein the universal sequence autonomously forms a hairpin structure; the spacer sequence is fully complementary to wild-type DNA in the sample to be tested, and the spacer sequence has a mismatch to the single nucleotide variant in the sample to be tested.

4. The method of enriching a low abundance single nucleotide variant according to claim 2, wherein the universal sequence is 5'-UAAUUUCUACUAAGUGUAGAU-3' and the spacer sequence is at least 18 base X linked to the 3' end of the universal sequence; wherein each base X is independently selected from one of A, G, C or T.

5. The method of enriching a low abundance single nucleotide variant according to claim 1, wherein the reaction system comprises an RPA reaction system and a CRISPR-Cas12a reaction system; the RPA reaction system comprises the forward primer, the reverse primer, recombinase, polymerase, single-stranded binding protein and buffer solution; the CRISPR-Cas12a reaction system comprises the Cas12a protein, the crRNA.

6. The method of enriching a low abundance single nucleotide variant according to claim 1, wherein the predetermined temperature is 37-42 ℃; the predetermined time is greater than 20 minutes.

7. The method of claim 1, wherein the sample comprises wild-type DNA and single nucleotide variants.

8. The method for enriching a low-abundance single nucleotide variant according to claim 1, wherein a fluorescence detection DNA single-stranded probe is added into the reaction system, and the trans-cleavage activity of the Cas12a protein is utilized to cleave the fluorescence detection DNA single-stranded probe to generate a fluorescence signal, so as to perform preliminary determination on the SNV abundance of the sample to be detected;

fluorescent groups and quenching groups are respectively modified at two ends of the fluorescent detection DNA single-chain probe.

9. The method of enriching a low abundance single nucleotide variant according to claim 1, wherein the Cas12a protein comprises one or more of LbCas12a, fnCas12a, asCas12 a; the Cas12a protein is obtained by recombinant expression or protein purification.

10. The method of claim 1, wherein the sample to be tested is selected from one of bacteria, tissue, and body fluid.