CN116083393A

CN116083393A - DNA assembly molecular machine and application thereof

Info

Publication number: CN116083393A
Application number: CN202310140791.7A
Authority: CN
Inventors: 李毅; 刘荣辉; 王卓飞; 戴菁
Original assignee: Southern University of Science and Technology
Current assignee: Southern University of Science and Technology
Priority date: 2023-02-14
Filing date: 2023-02-14
Publication date: 2023-05-09
Also published as: WO2024168961A1

Abstract

The invention discloses a DNA assembly molecular machine and application thereof, and relates to the technical field of molecular biology. The DNA assembly molecule machine comprises a palm domain, 2 terminal insertion domains, thumb domain, finger domain, and exonuclease activity domain. The DNA assembly molecule has good stability and is suitable for isothermal amplification. In addition, the DNA assembly molecule and the mutant thereof have DNA assembly functions under various metal ions and different temperatures, and can be applied to nanopore sequencing, single molecule sequencing, RCA library establishment, environment detection and in-vitro diagnosis.

Description

DNA assembly molecular machine and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a DNA assembly molecular machine and application thereof.

Background

The development of DNA sequencing technology has important significance for modern biological exploration, disease diagnosis and human tracing. With the progress of sequencing technology, the progress from indirect sequencing after amplification to in-situ single molecule sequencing has been advanced. Whether Pacbio tSMS single-molecule fluorescence sequencing technology or ONT electrophysiological sequencing technology, sequencing length, accuracy and efficiency are severely dependent on the molecular motor that controls DNA movement and assembly. Among them, pacbio is mainly utilized and the DNB-SEQ technology of Hua Dazhi relies on rolling circle amplification of phi29 polymerase, in which technology the phi29 polymerase is required to have higher thermostability and activity. In nanopore sequencing, the activity of the existing polymerase is too high, so that the DNA translocation through hole speed is too high, the DNA translocation perforation time is difficult to be increased from 10us to 100us, and the requirement on a DNA assembly molecular machine is that the DNA assembly molecular machine has higher salt tolerance and needs to bear the salt concentration of more than 300 mM.

The heat resistance and salt tolerance of the existing phi29 polymerase are respectively modified, for example, the heat stability of the commercial phi29 polymerase is improved through 73 point mutations in the patent WO2021248757A1, wherein the heat stability Tm value of the mutation combination M97T, Y K and E515S is improved from 48.5 ℃ to 50.8 ℃, so that the modification of the commercial phi29 polymerase is difficult, and the characteristics of the enzyme are difficult to change obviously. In patent CN201910778360 a novel salt tolerant polymerase is disclosed, which is resistant to sodium chloride at 300mM and becomes inactive after more than 500mM, compared to phi29 polymerase and Taq DNA polymerase, and which is prone to deactivation under calcium, zinc and lithium ion conditions. Therefore, further designing a novel DNA assembly molecular machine to improve salt tolerance, thermal stability, and tolerance to heavy metal ions is a technical bottleneck in the art to be solved.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide a DNA assembly molecular machine and application thereof to solve the technical problems.

The invention is realized in the following way:

in a first aspect, the present invention provides a DNA assembly molecule machine consisting of 500-1000 amino acids comprising a palm domain, 2 terminal insertion domains, thumb domain, finger domain and exonuclease activity domain; wherein the palm domain consists of 150-220 amino acids, the thumb domain consists of 40-70 amino acids, the finger domain consists of 30-45 amino acids to form an alpha helix structure, and the exonuclease activity domain consists of 150-220 amino acids; the 2 terminal insertion domains comprise a terminal insertion domain 1 and a terminal insertion domain 2, wherein the terminal insertion domain 1 consists of 50-150 amino acids, and the terminal insertion domain 2 consists of 20-70 amino acids;

the DNA assembly molecular machine has the following functions:

the ability to interact with nucleotides through amino acid side chains; and the DNA assembly molecule machine has the ability to load and/or ligate DNA molecules.

The DNA assembly molecule may interact with the base of the free nucleotide through the amino acid side chain or with the phosphate backbone. In an alternative embodiment, the DNA assembly molecule has the function of loading and/or ligating primer strands, template strands.

The DNA assembly molecular machine consisting of the palm domain, the 2 terminal insertion domains, the thumb domain, the finger domain and the exonuclease activity domain has good stability and can be used for isothermal amplification. The DNA assembly molecule and the mutant thereof provided by the invention have the DNA assembly function under various metal ions and different temperatures, and can be applied to nanopore sequencing, single molecule sequencing, RCA library building, environment detection and in-vitro diagnosis. Particularly, the method has the amplification activity far superior to that of the existing DNA polymerase under the condition of high salt concentration, and can prolong the DNA translocation and perforation time by improving the salt concentration, thereby improving the accuracy of single-molecule sequencing and greatly reducing the loss of key sequencing information.

In an alternative embodiment, the palm domain consists of 150 to 200 amino acids, or 160 to 220 amino acids, or 180 to 220 amino acids.

In an alternative embodiment, the thumb domain consists of 40, 45, 50, 55, 60, 65 or 70 amino acids, forming a 30-45 angstrom long domain between the exonuclease active domain and the palm domain that prevents dissociation of enzyme from DNA during DNA assembly.

In an alternative embodiment, the finger domain is an alpha helix structure of 30, 32, 36, 38, 40 or 45 amino acids, the primary function of the segment being to bind DNA and assist in the function of exonuclease activity.

In an alternative embodiment, the exonuclease activity domain consists of 150, 160, 170, 180, 190, 200, 210 or 220 amino acids.

The terminal insertion domain comprises a terminal insertion domain 1 and a terminal insertion domain 2, wherein the terminal insertion domain 1 is composed of 50-150 amino acids, the terminal insertion domain 2 is composed of 20-70 amino acids, so that the template strand and the non-template strand are effectively separated, and effective strand displacement and continuity are facilitated.

In a preferred embodiment of the invention, the amino acid type of each domain of the DNA-assembling molecular machine is selected from at least one of the following: natural amino acids, unnatural amino acids, modified natural amino acids, modified unnatural amino acids.

The natural amino acid is selected from glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, serine, threonine, histidine, tryptophan, cysteine, asparagine, aspartic acid, glutamic acid, glutamine, lysine, tyrosine, methionine, arginine, cystine, or C1-C4 alkyl esters of the above amino acids.

The unnatural amino acid is selected from the group consisting of p-acetyl-phenylalanine, p-ethynyl-phenylalanine, p-propargyloxyphenylalanine, p-azido-phenylalanine, beta-alanine (beta Ala), 6-aminocaproic acid (Aca), and tetraethylene glycol (Teg, NH) with an amino group at one end and a carboxyl group at one end ₂ -CH ₂ CH ₂ -O-CH ₂ CH ₂ -O-CH ₂ CH ₂ -O-CH ₂ CH ₂ -COOH), NAEK, lys-azido, or other containing one, two or three of biazidine, azide structures.

The above-mentioned modifications are selected from: at least one of glycosylation, phosphorylation, ubiquitination, S-nitrosylation, methylation, N-acetylation, succinylation, hydroxylation, lipidation, and polyisoprene.

In an alternative embodiment, the methylation is selected from N-methylation or O-methylation;

in an alternative embodiment, the glycosylation is selected from ADP ribosylation.

In a preferred embodiment of the invention, the palm domain has two amino acid sequences forming a β -sheet.

The two amino acid sequences forming the beta sheet are respectively: EWKFKMV and ATAT;

deletion of the amino acid sequence of the β -sheet (EWKFKMV) (βdel) results in reduced assembly activity.

In an alternative embodiment, the thumb domain has an amino acid sequence that forms an alpha helix: DPNDFTEEEIKRKNI.

In some embodiments, the DNA assembly molecules provided herein include sequences on the thumb domain that form an alpha helix that is particularly critical for DNA assembly, as compared to existing DNA polymerases, and deletion of the sequences on the thumb domain that form the alpha helix results in loss of DNA amplification activity of the DNA assembly molecule. This structure belongs to the key sequence of the DNA assembly molecule.

The inventors found that: the formation of an alpha helix structure on the thumb domain plays a key role in enhancing the DNA amplification activity of DNA assembly molecules by: this structure increases the binding capacity of the DNA to the enzyme. As set forth in SEQ ID NO:1-7 forms an alpha helix structure on the thumb domain, as set forth in any one of SEQ ID NOs: 8-9 does not form an alpha helix structure on the thumb domain.

In a preferred embodiment of the invention, the DNA assembly machine comprises:

(a) The method comprises the following steps A mutant obtained by mutating the amino acid sequence shown in SEQ ID NO.1, wherein at least one amino acid at the site of interaction between the mutant and DNA is substituted or modified;

and/or, SEQ ID NO:1, inserting one or more amino acids into the amino acid sequence shown in figure 1;

and/or, SEQ ID NO:1, deleting one or more amino acids in the amino acid sequence shown in figure 1;

and/or, SEQ ID NO:1, carrying out side chain modification on the amino acid sequence shown in the formula 1;

or (b): a mutant obtained by mutating the amino acid sequence shown in SEQ ID No.2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6,SEQ ID NO:7,SEQ ID NO:8 or SEQ ID No. 9, wherein the mutation position of the mutant is determined by: the mutant was compared with SEQ ID NO:1, the mutation position of the mutant corresponds to the sequence shown in SEQ ID NO:1, and a functional site of the sequence shown in 1; the mutant is substituted, deleted, inserted or modified with at least one of the amino acids at the mutation position.

The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.

It should be noted that, from SEQ ID NO:2-9, and the mutation position of the mutant obtained by mutating the sequence shown in any one of SEQ ID NO:1, or may be identical or different (e.g., SEQ ID NOS: 2,3 and 5), the specific location of the mutation being determined from the alignment of the sequences described above, provided that it corresponds to the sequence of SEQ ID NO:1 is the mutation site of the invention.

SEQ ID NO:1 is derived from Bacillus phage (Bacillus nage), and has a length of 606aa and a sequence similarity of 58% with phi29. The UniProt database is numbered A0A1X9SGT8.

SEQ ID NO:2-9 with reference to table 1.

TABLE 1 Gene list

In a preferred embodiment of the invention, the process of (a): the amino acid substituted or modified in the amino acid sequence shown in SEQ ID NO.1 is at least one of D12, E14, T15, Y60, H62, N63, F66, D67, F70, V94, S123, L124, D146, Y149, D170, D257, V258, S260, Y262, T365, I372, W374, K378, K379, R338, K392, L393, N396, S397, Y399, G400, F402, K428, E429, T443, D465, D467, K507, Y509 and K547;

(b) The method comprises the following steps The functional site is SEQ ID NO:1, D12, E14, T15, Y60, H62, N63, F66, D67, F70, V94, S123, L124, D146, Y149, D170, D257, V258, S260, Y262, T365, I372, W374, K378, K379, R338, K392, L393, N396, S397, Y399, G400, F402, K428, E429, T443, D465, D467, K507, Y509, and K547.

SEQ ID NO:1, and the functions of the functional sites of the sequence shown in Table 2 are as follows:

TABLE 2 Key functional site of SEQ ID NO:1 (A0A 1X9SGT 8)

The inventors found that mutation of D12 protein resulted in a decrease in protein assembly activity, while simultaneous mutation of D12A and D67A resulted in a loss of protein assembly activity. This is quite different from the effect of the existing phi29 protein on the enhancement of DNA amplification activity after D12 and D67 site mutation.

In an alternative embodiment, at least one of the following positions shown in SEQ ID NO.2 is mutated: d27 E29, T30, Y77, H79, F83, D84, F87, L113, S138, L139, D161, Y164, D185, D265, V266, S268, Y270, S372, I379, K381, V385, K386, R394, K398, L399, N402, A403, Y405, G406, F408, E435, E436, T450, R455, D472, D474, K512, Y514, and K550;

in an alternative embodiment, at least one of the following positions shown in SEQ ID NO.3 is mutated: d9 E11, T12, Y56, H58, F62, D63, F66, T93, S122, L123, E145, Y148, D169, D249, V250, S252, Y254, V357, I364, R366, I370, K371, V381, K385, L386, N389, S390, Y392, G393, F395, K421, E423, T436, R440, D458, D460, K500, Y502 and K532;

in an alternative embodiment, at least one of the following positions shown in SEQ ID NO.5 is mutated: d272 E274, T275, Y322, H324, F328, D329, F332, S371, S395, L396, D418, Y421, D442, D532, V533, S535, Y537, V667, K676, I680, K681, R689, K693, L694, N697, N698, Y700, G701, M703, R728, A729, T744, R748, D771, D773, K812, Y814 and K834.

The corresponding sites for the four typical key functional sites of the polymerase are shown in Table 3:

in a preferred embodiment of the invention, the DNA assembly machine comprises:

and SEQ ID NO:1-9, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.9% homologous.

The DNA assembly molecule machinery of the present invention is modulated by agonists, which may be used include: co 0.01-100mM ²⁺ ，Ni ²⁺ ，Cu ²⁺ ，Mn ²⁺ ，Zn ²⁺ ，Ca ²⁺ At least one ion of (a) and (b). In particular, under the condition of calcium ion concentration, the DNA assembly molecule provided by the invention shows higher DNA amplification activity than other proteins (phi 29).

In a second aspect, the invention also provides a nucleic acid molecule encoding a DNA assembly molecule machine as described above.

In a third aspect, the invention also provides a vector or recombinant cell comprising the nucleic acid molecule described above.

The term "vector" is used herein in its most general sense and includes any intermediate vector for a nucleic acid that enables the nucleic acid to be introduced, for example, into a prokaryotic and/or eukaryotic cell, and where appropriate, integrated into the genome. Vectors of this type are preferably replicated and/or expressed in cells. The vector comprises a plasmid, phagemid, phage or viral genome. The term "plasmid" as used herein generally refers to a construct of extrachromosomal genetic material, typically circular DNA duplex, that can replicate independently of chromosomal DNA.

The term "recombinant cell" refers to any cell that can be transformed or transfected with an exogenous nucleic acid. The term "recombinant cell" according to the invention comprises prokaryotic (e.g. E.coli) or eukaryotic cells (e.g. mammalian cells, in particular human cells, yeast cells and insect cells). Mammalian cells, such as cells from humans, mice, hamsters, pigs, goats or primates, are particularly preferred. Cells may be derived from a plurality of tissue types and comprise primary cells and cell lines. The nucleic acid may be present in the host cell in a single copy or in two or more copies, and in one embodiment is expressed in a recombinant cell.

In an alternative embodiment, the recombinant cell is a eukaryotic cell;

in an alternative embodiment, the recombinant cell is a mammalian cell;

in an alternative embodiment, the recombinant cell is HEK293.

In a fourth aspect, the present invention also provides a method of DNA replication or amplification comprising replicating or amplifying DNA using the DNA assembly molecule machine described above as a DNA polymerase.

In a fifth aspect, the invention also provides the use of a DNA-assembling molecule machine in any one of the following applications:

1) As a DNA polymerase;

2) As RNA polymerase;

3) Controlling the movement of the DNA or RNA;

4) Preparing a single molecule sequencing reagent or a kit;

5) Preparing a nanopore sequencing reagent or a kit;

6) Assembling a molecular machine chain reaction;

7) Catalyzing DNA replication and/or catalyzing DNA amplification;

8) Catalytic rolling circle amplification and/or catalytic multiplex strand displacement amplification;

9) Performing DNA sequencing or RNA sequencing or whole genome sequencing;

10 RCA library construction;

11 Genome amplification coverage detection;

12 Preparing a kit product for catalyzing DNA replication and/or catalyzing DNA amplification;

13 Preparing a product for catalytic rolling circle amplification and/or catalytic multiplex strand displacement amplification;

14 Preparing a product for DNA sequencing or RNA sequencing or whole genome sequencing;

15 Preparing a product for RCA banking;

16 Preparation of a product for genome amplification coverage detection.

In a sixth aspect, the present invention also provides a method for assembling a DNA molecule using the DNA assembling molecular machine described above, comprising performing a reaction in a reaction system; the reaction system comprises 0.3M-1.5M salt ions.

The activity of the DNA assembly molecular machine provided by the invention is higher than phi29 when the salt ion concentration is higher than 300 nM. The DNA assembly molecular machine provided by the invention can be suitable for high-salt concentration environments, such as nanopore sequencing.

In an alternative embodiment, the salt ion is sodium, potassium, calcium, magnesium, manganese, nickel, cobalt, copper, or zinc.

In an alternative embodiment, the reaction system further comprises calcium ions.

The invention has the following beneficial effects:

compared with the existing DNA polymerase, the DNA assembly molecule provided by the invention has a sequence capable of forming an alpha helix structure on the thumb domain, and the alpha helix structure is particularly critical for improving the DNA amplification activity of the DNA assembly molecule. The DNA assembly molecule has good stability and is suitable for isothermal amplification.

In addition, the DNA assembly molecule and the mutant thereof provided by the invention have the DNA assembly function under various metal ions and different temperatures, and can be applied to nanopore sequencing, single molecule sequencing, RCA library building, environment detection and in-vitro diagnosis. Particularly, the method has the amplification activity far superior to that of the existing DNA polymerase under the condition of high salt concentration, and can prolong the DNA translocation and perforation time by improving the salt concentration, thereby improving the accuracy of single-molecule sequencing and greatly reducing the loss of key sequencing information.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the structure prediction of a protein having the amino acid sequence shown in SEQ ID NO. 1;

FIG. 2 is a diagram showing the structure prediction of a protein having the amino acid sequence shown in SEQ ID NO. 2;

FIG. 3 is a diagram showing the structure prediction of a protein having the amino acid sequence shown in SEQ ID NO. 3;

FIG. 4 is a diagram showing the structure prediction of a protein having the amino acid sequence shown in SEQ ID NO. 4;

FIG. 5 is a diagram showing the comparison of the structure of a protein having the amino acid sequence shown in SEQ ID NO.1 with that of the existing DNA assembling molecule machine phi 29;

FIG. 6 is a diagram showing the result of SDS-PAGE of proteins;

FIG. 7 is a graph showing the detection results of rolling circle amplification by each DNA assembly molecule machine;

FIG. 8 is a graph of the effect of heavy metal ions on amplification;

FIG. 9 is a graph showing the effect of NaCl concentration on amplification;

FIG. 10 is a graph showing the results of activity detection of each mutant.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless otherwise indicated, practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of a person skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); animal cell culture (Animal Cell Culture) (r.i. freshney, 1987); methods of enzymology (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M.Weir and C.C.Blackwell, inc.), gene transfer vectors for mammalian cells (Gene Transfer Vectors for Mammalian Cells) (J.M.Miller and M.P.calos, inc., 1987), methods of contemporary molecular biology (Current Protocols in Molecular Biology) (F.M.Ausubel et al, inc., 1987), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction, inc., 1994), and methods of contemporary immunology (Current Protocols in Immunology) (J.E.Coligan et al, 1991), each of which is expressly incorporated herein by reference.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The features and capabilities of the present invention are described in further detail below in connection with the examples.

Example 1

The present example provides a DNA assembly molecular machine, the structure of which is analyzed.

The amino acid sequence of the DNA assembly molecular machine of this example is shown in SEQ ID NO.1, and structural analysis is performed by structure prediction software to obtain the structure shown in FIG. 1. Wherein amino acids 1-192 constitute the exonuclease active domain, amino acids 192-268 and 437-549 constitute the palm domain, amino acids 269-367 constitute the terminal insertion domain 1, 368-404 constitute the finger domain, 405-436 constitute the terminal insertion domain 2, and amino acids 550-606 constitute the thumb structure.

This structure is longer than the structure of the existing DNA assembly molecular machine phi29 (PDB ID:1 xhx) (see FIG. 5), in which the structure is one more alpha helix on the thumb structure and the beta sheet structure on the palm structure.

Example 2

The amino acid sequence of the DNA assembly molecular machine of this example is shown in SEQ ID NO.2, and structural analysis is performed by structure prediction software to obtain the structure shown in FIG. 2. Wherein amino acids 1-205 constitute the exonuclease active domain, amino acids 206-276 and 443-551 constitute the palm domain, amino acids 277-375 constitute the terminal insertion domain 1, amino acids 376-409 constitute the finger domain, amino acids 410-442 constitute the terminal insertion domain 2, and amino acids 552-598 constitute the thumb structure.

Example 3

The amino acid sequence of the DNA assembly molecular machine of this example is shown in SEQ ID NO.3, and the structure shown in FIG. 3 is obtained by structural analysis by the structure prediction software. Wherein amino acids 1-189 constitute the exonuclease active domain, amino acids 190-260 and 429-537 constitute the palm domain, amino acids 261-360 constitute the terminal insertion domain 1, amino acids 361-396 constitute the finger domain, amino acids 397-428 constitute the terminal insertion domain 2, and amino acids 538-578 constitute the thumb structure.

Example 4

The amino acid sequence of the DNA assembly molecular machine of this example is shown in SEQ ID NO.5, and structural analysis is performed by structure prediction software to obtain the structure shown in FIG. 4. Wherein amino acids 265-462 constitute the exonuclease active domain, amino acids 463-545 and 737-839 constitute the palm domain, amino acids 546-670 constitute the terminal insertion domain 1, amino acids 671-703 constitute the finger domain, amino acids 704-736 constitute the terminal insertion domain 2, and amino acids 840-915 constitute the thumb structure.

Example 5

Expression of the proteins of this example.

The synthesis of the sequence SEQ ID No:1,2,3,5, 6. Transferring the obtained sequence into a pET30a vector to obtain an expression vector of the DNA assembly molecular machine. The expression vector was transformed into E.coli competent cell BL21 (DE 3) (Beijing full gold biotechnology Co., ltd.) and the ampicillin resistant medium was cultured and sequenced. After confirming successful transformation, picking a monoclonal colony, and inoculating the monoclonal colony into 5mL of LB liquid medium for overnight culture; then transferring the culture medium into 1L of LB liquid medium, culturing for 4 hours until the OD value is 0.6, adding IPTG until the final concentration of IPTG is 500uM, and continuing shaking culture overnight. Centrifuging the culture solution, collecting thalli, and lysing cells by an ultrasonic cell grinder, wherein the power of ultrasonic waves is 80W, the ultrasonic waves are 1s, and the interval is 2s, and the total duration is 20min. Then His-tag column affinity chromatography is used for purification to obtain protein (namely DNA assembly molecular machine).

The resulting DNA assembly molecule machine was subjected to SDS-PAGE protein electrophoresis to verify the size of the DNA assembly molecule machine protein. The molecular weight of the DNA assembly molecule machine is 76kD.

SDS-PAGE of proteins shows the results of FIG. 6. In FIG. 6, lane 1 is the phi29 protein and lane 2 is the protein SEQ ID NO:1, lane 3 is SEQ ID NO:2, lane 4 is SEQ ID NO:3, lane 5 is SEQ ID NO:5, lane 6 is SEQ ID NO:6, the protein size is about 70 kDa.

Example 6

This example uses rolling circle amplification to detect the function of the DNA assembly molecule machine.

Rolling circle amplification was performed using each of the histones, phi29 and control groups prepared in example 5 as a DNA assembly molecule machine. Specifically, 200nM DNA assembly molecule machine, 500nM hairpin template and reaction buffer solution are mixed to obtain a reaction system. Wherein: the reaction buffer consists of 50mM Tris-HCl,10 mM MgCl ₂ 10mM (NH) ₄ ) ₂ SO ₄ 4mM DTT and 200uM dNTPs, the pH of the reaction buffer at 25℃being 7.5; the nucleotide sequence of the hairpin template is as follows:

a sequence:

5’-p-TTGGCATATCGTACGATATGCCACCACCACCACCACAACCACCACCACCAAGCGATACGCGT ATCGCTTA-3’；

b sequence:

5-AAAAAAACCTTCCTTTT-ATATGCCAATAAGCGATACG-3’。

and (3) placing the reaction system at the temperature of 30 ℃ for reaction for 2 hours to obtain a reaction product.

As shown in FIG. 7, the DNA assembly activity of the DNA assembly molecular machine prepared in example 7 was found to be lower than that of phi29 polymerase under the test conditions, although the DNA assembly activity was able to be extended to form a product strand using a template strand as a template.

Experimental example 1

An influence factor experiment was performed according to example 6.

The reaction system for detecting heavy metal ions comprises: 50mM Tris-HCl,100uM metal ion, 10mM (NH) ₄ ) ₂ SO ₄ ,4mM DTT，0.25mM dNTP,1uM DNA,0.8uM protein.

Referring to FIG. 8, heavy metal ion impact analysis showed that A0A1X9SGT8 exhibited higher activity than other proteins at calcium ion concentration.

Further, the activity of various salt concentrations on A0A1X9SGT8 was measured as in example 6 and was inferior to commercial phi29 at concentrations below 300mM NaCl as shown in FIG. 9.

And when the salt ion concentration is higher than 300nM, the activity is stronger than that of Phi29 (namely, phi29 shown in the figure).

This illustrates that the DNA assembly molecule machine of the present invention can be adapted for use in high salt concentration environments.

Experimental example 2

The activity of the mutant of SEQ ID NO.1 was verified.

Each mutant of A0A1X9SGT8 was assayed for activity using the assay format of example 6. The results are shown in FIG. 10:

deletion of amino acids 571-585 (DPNDFTEEEIKRKNI), i.e., alpha del, respectively, the DNA assembly molecule machine loses DNA amplification activity, indicating that this domain is essential for DNA assembly in the DNA assembly molecule machine and is a critical sequence provided by the present invention.

The importance of this domain was also demonstrated by reduced assembly activity for deletion of amino acids 525-532 (EWKFKMV) (. Beta.del). After mutation at positions D12 and D67, activity was likewise lost. However, the phi29 protein in the prior patent has the activity enhanced after mutation at the two sites. This demonstrates the significant variability of the DNA molecule assembly machine of the present invention from the prior patent proteins.

In FIG. 10, DD refers to the simultaneous mutations D12 and D67.Control 100mM EDTA was added to the WT group.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A DNA assembly molecule machine comprising a palm domain, a 2 terminal insertion domain, a thumb domain, a finger domain, and an exonuclease activity domain; wherein the palm domain consists of 150-220 amino acids, the thumb domain consists of 40-70 amino acids, the finger domain consists of 30-45 amino acids to form an alpha-helix structure, and the exonuclease activity domain consists of 150-220 amino acids; the 2 terminal insertion domains include a terminal insertion domain 1 and a terminal insertion domain 2, the terminal insertion domain 1 consisting of 50-150 amino acids, the terminal insertion domain 2 consisting of 20-70 amino acids;

the DNA assembly molecular machine has the following functions:

2. The DNA-assembling molecular machine of claim 1, wherein the amino acid type of each domain of the DNA-assembling molecular machine is selected from at least one of the following: natural amino acids, unnatural amino acids, modified natural amino acids, modified unnatural amino acids;

wherein the modification is selected from: at least one of glycosylation, phosphorylation, ubiquitination, S-nitrosylation, methylation, N-acetylation, succinylation, hydroxylation, lipidation, and polyisoprene;

preferably, the methylation is selected from N-methylation or O-methylation;

preferably, the glycosylation is selected from ADP ribosylation.

3. The DNA-assembling molecular machine of any one of claims 1-2, wherein the palm domain has two amino acid sequences that form a β -sheet;

preferably, the two β -sheet forming amino acid sequences are:

EWKFKMV and ATAT;

preferably, the thumb domain comprises a sequence forming an alpha helix, and the amino acid sequence forming an alpha helix on the thumb domain is as follows: DPNDFTEEEIKRKNI.

4. The DNA assembly molecular machine of claim 1 or 2, wherein the DNA assembly molecular machine comprises:

or (b): a mutant obtained by mutating the amino acid sequence shown in SEQ ID No.2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5,SEQ ID NO:6,SEQ ID NO:7,SEQ ID NO:8 or SEQ ID No. 9, wherein the mutation position of the mutant is determined by: comparing the mutant with SEQ ID NO:1, the mutation position of the mutant corresponds to the sequence shown in SEQ ID NO:1, and a functional site of the sequence shown in 1; the mutant is substituted, deleted, inserted or modified with at least one of the amino acids at the mutation position.

5. The DNA-assembling molecular machine of claim 4, wherein the (a): the amino acid substituted or modified in the amino acid sequence shown in SEQ ID NO.1 is at least one of D12, E14, T15, Y60, H62, N63, F66, D67, F70, V94, S123, L124, D146, Y149, D170, D257, V258, S260, Y262, T365, I372, W374, K378, K379, R338, K392, L393, N396, S397, Y399, G400, F402, K428, E429, T443, D465, D467, K507, Y509 and K547;

the (b): the functional site is SEQ ID NO:1, D12, E14, T15, Y60, H62, N63, F66, D67, F70, V94, S123, L124, D146, Y149, D170, D257, V258, S260, Y262, T365, I372, W374, K378, K379, R338, K392, L393, N396, S397, Y399, G400, F402, K428, E429, T443, D465, D467, K507, Y509, and K547;

preferably, at least one of the following positions shown in SEQ ID NO.2 is mutated: d27 E29, T30, Y77, H79, F83, D84, F87, L113, S138, L139, D161, Y164, D185, D265, V266, S268, Y270, S372, I379, K381, V385, K386, R394, K398, L399, N402, A403, Y405, G406, F408, E435, E436, T450, R455, D472, D474, K512, Y514, and K550;

preferably, at least one of the following positions shown in SEQ ID NO.3 is mutated: d9 E11, T12, Y56, H58, F62, D63, F66, T93, S122, L123, E145, Y148, D169, D249, V250, S252, Y254, V357, I364, R366, I370, K371, V381, K385, L386, N389, S390, Y392, G393, F395, K421, E423, T436, R440, D458, D460, K500, Y502 and K532;

preferably, at least one of the following positions shown in SEQ ID NO.5 is mutated: d272 E274, T275, Y322, H324, F328, D329, F332, S371, S395, L396, D418, Y421, D442, D532, V533, S535, Y537, V667, K676, I680, K681, R689, K693, L694, N697, N698, Y700, G701, M703, R728, A729, T744, R748, D771, D773, K812, Y814 and K834.

6. The DNA assembly molecular machine of claim 1 or 2, wherein the DNA assembly molecular machine comprises:

7. A nucleic acid molecule encoding the DNA assembly molecule machine of any one of claims 1-6.

8. A vector or recombinant cell comprising the nucleic acid molecule of claim 7.

A method of dna replication or amplification, characterized by: comprising replicating or amplifying DNA using the DNA assembly molecule machine of any one of claims 1-6 as a DNA polymerase.

10. Use of the DNA-assembling molecule machine of any one of claims 1-6 in any one of the following applications: