CN116083254B - Abnormal Wikiham yeast ZB425 and application thereof - Google Patents

Abstract

The application discloses an abnormal Wilkham yeast ZB425 and application thereof. The abnormal Wikiham yeast strain ZB425 has been deposited in the microorganism strain collection of Guangdong province at 6.16.2022, and the deposit number is GDMCCNo 62549. The yellow wine brewing is carried out by utilizing the abnormal Wick ham yeast ZB425, the types and the contents of aroma substances of the obtained yellow wine are increased, the aroma of the yellow wine is obviously improved, the total content of esters substances is improved, wherein the contents of key aroma substances such as ethyl acetate, ethyl octoate, diethyl succinate and phenethyl acetate are obviously improved, the contents of other aldehyde key aroma substances such as phenylacetaldehyde are also obviously improved, the contents of 1-octene-3-ol and diacetyl are obviously reduced, and the peculiar smell of the yellow wine is reduced. Meanwhile, the content of the higher alcohol is reduced, so that the unpleasant taste caused by the excessively high content of the higher alcohol can be reduced, and the yellow wine has more harmonious and mellow taste.

Description

Abnormal Wikiham yeast ZB425 and application thereof

Technical Field

The application relates to the technical field of microorganisms, in particular to an abnormal Wilkham yeast ZB425 and application thereof.

Background

The main components of the yellow wine are water, ethanol and sugar, accounting for 96-97% of the total amount, and other trace components such as flavor substances account for 3-4%. The proportion of the yellow wine is very small, but the flavor substance composition of the yellow wine is very complex. The method is applied to yellow wine flavor substance analysis by using a full two-dimensional gas chromatography-time of flight mass spectrometry (GC×GC-TOFMS), and 975 substances are detected, wherein 93 organic acids, 149 esters, 61 alcohols, 52 aldehydes, 55 acetals, 98 furans and lactones, 42 sulfides, 154 nitrogen compounds, 73 ketones, 46 phenols and 152 other compounds. The flavor substances greatly influence the fragrance of the yellow wine, improve the fragrance producing capability in the fermentation process of the yellow wine, and have important significance for improving the quality of the yellow wine.

The flavor substances which are fragrant in the yellow rice wine mainly come from three aspects: firstly, the raw materials are carried in, secondly, the raw materials are produced in saccharification and fermentation processes, and thirdly, the raw materials are produced in ageing processes. Among them, various microorganisms such as mold and yeast in distiller's yeast have an important contribution to the development of yellow wine flavor. In the modern yellow wine production process, enzyme preparations are mostly used for completely or partially replacing distiller's yeast to carry out enzymolysis on raw materials so as to improve saccharification efficiency, but many researches show that the yellow wine brewed by using the compound enzyme preparation has obviously lower volatile component content than the yellow wine brewed by using wheat yeast in the traditional fermentation method, has insufficient flavor and lacks ' Qu Xiang '.

Disclosure of Invention

Based on this, it is necessary to provide a Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425. The abnormal Wilkham yeast (Wickerhamomyces anomalus) ZB425 can obviously improve the fragrance of yellow wine and increase the yellow wine 'Qu Xiang'.

An embodiment of the application provides a Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425.

An abnormal Wikiwim yeast (Wickerhamomyces anomalus) ZB425, said abnormal Wikiwim yeast strain (Wickerhamomyces anomalus) ZB425 having been deposited at the Cantonese province microorganism strain collection at 6.16.2022 under accession number GDMCC No. 62549.

The abnormal Wikipedia (Wickerhamomyces anomalus) ZB425, wherein the abnormal Wikipedia (Wickerhamomyces anomalus) ZB425 is deposited in the microorganism strain collection of Guangdong province at the 6 th month of 2022 with the deposit number of GDMCC No. 62549.

In some of these embodiments, the genomic sequence of the Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425 is set forth in SEQ ID NO. 1.

An embodiment of the present application provides a distiller's yeast.

A distiller's yeast processed from the abnormal wilm yeast (Wickerhamomyces anomalus) ZB425.

An embodiment of the application provides application of Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425 in preparing brewed wine.

In some of these embodiments, the brewed wine comprises yellow wine, rice wine.

In some of these embodiments, the Wilkamella anomala (Wickerhamomyces anomalus) ZB425 is used to increase the aroma content of brewed wine.

In some of these embodiments, the aroma includes ethyl acetate, ethyl octanoate, diethyl succinate, phenethyl acetate, and phenylacetaldehyde.

In some of these embodiments, the Wilkham yeast (Wickerhamomyces anomalus) ZB425 is used to reduce the higher alcohol content of brewed wine.

An embodiment of the application provides yellow wine.

Yellow wine is prepared from the abnormal Wikimann yeast (Wickerhamomyces anomalus) ZB425 or the distiller's yeast.

An embodiment of the application provides a preparation method of yellow wine.

A preparation method of yellow wine comprises the following steps:

soaking rice: weighing rice, and soaking the rice in water for 1 to 1.5 hours;

washing rice: fishing out the soaked rice, and washing with water at least twice until no white rice pulp exists;

steaming rice: placing the drained rice into a rice steamer to steam rice, turning off fire and turning over the rice after the rice is rounded for 10-15 min, uniformly spreading 20-30% hot water, continuing steaming the rice for 20-40 min until the rice is soft and hard outside and has no white core inside, and taking the rice out of the rice steamer for standby;

and (5) spreading and cooling: placing steamed rice at a ventilation position, and naturally cooling to 30-50 ℃;

and (3) can dropping: adding the distiller's yeast of claim 3 into a fermentation barrel in advance, pouring the cooled rice into the fermentation barrel, adding an enzyme preparation, yeast activating solution and water, and uniformly stirring;

fermentation: pre-fermenting for 2-4 d at 20-30 ℃, raking at least twice a day after tank dropping, transferring to post-fermenting for 20-30 d at 15-20 ℃ after 2-4 d;

and (3) squeezing: filtering and collecting to obtain sake;

decocting wine: and (3) keeping the sake at 80-90 ℃ for 20-30 min, and sterilizing to obtain the yellow wine.

The yellow wine brewing is carried out by utilizing the abnormal Wick ham yeast ZB425, all physicochemical indexes (including pH, total acid, amino acid nitrogen, alcohol degree and the like) of the obtained yellow wine meet the related standard requirements, the types and the contents of aroma substances are increased, the aroma of the yellow wine is obviously improved, in particular, the total contents of esters are improved, wherein the contents of key aroma substances such as ethyl acetate, ethyl octanoate, diethyl succinate and phenethyl acetate are obviously improved, the contents of other aldehyde key aroma substances such as phenylacetaldehyde are also obviously improved, the contents of 1-octen-3-ol and diacetyl are obviously reduced, and the peculiar smell of the yellow wine is reduced. Meanwhile, the content of the higher alcohol is reduced, so that the unpleasant taste caused by the excessively high content of the higher alcohol can be reduced, and the yellow wine has more harmonious and mellow taste. The abnormal Wilkham yeast ZB425 is used for starter propagation, is applied to the production of yellow wine, and can obtain yellow wine with rich starter fragrance and coordinated taste.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings that are required to be used in the description of the embodiments will be briefly described below. It is evident that the figures in the following description are only some embodiments of the application, from which other figures can be obtained without inventive effort for a person skilled in the art.

For a more complete understanding of the present application and the advantages thereof, reference is now made to the following descriptions taken in conjunction with the accompanying drawings. Wherein like reference numerals refer to like parts throughout the following description.

FIG. 1 is a schematic diagram showing the microscopic morphology of a yeast, saccharomyces cerevisiae (Wickerhamomyces anomalus) ZB425 cells of one embodiment of the present application;

FIG. 2 is a schematic representation of a single colony morphology of Saccharomyces cerevisiae (Wickerhamomyces anomalus) ZB425 according to one embodiment of the present application;

FIG. 3 is a schematic representation of a phylogenetic tree of Saccharomyces cerevisiae (Wickerhamomyces anomalus) ZB425 according to an embodiment of the present application.

The application provides an abnormal Wick yeast named as Wick yeast (Wickerhamomyces anomalus) ZB425, which is preserved in the microorganism strain preservation center of Guangdong province in 2022, 6 months and 16 days, address: building 5 of Guangzhou Mr. first, china, no. 100 university, no. 59, with the preservation number of GDMCC No. 62549; the strain was received from the collection at 16 at 2022, 6 and registered, and was detected as a viable strain by the collection at 16 at 2022, 6.

Detailed Description

In order that the above-recited objects, features and advantages of the present application will become more apparent, a more particular description of the application will be rendered by reference to the appended drawings, which are illustrated in the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. The present application may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit of the application, whereby the application is not limited to the specific embodiments disclosed below.

In the description of the present application, the meaning of a number is one or more, the meaning of a number is two or more, and greater than, less than, exceeding, etc. are understood to exclude the present number, and the meaning of a number is understood to include the present number. The description of the first and second is for the purpose of distinguishing between technical features only and should not be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of the technical features indicated.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

An embodiment of the application provides a Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425.

Wick Han's yeast, exception (Wickerhamomyces anomalus) ZB425, deposited at the Cantonese microorganism strain collection, accession No. GDMCC No. 62549, on day 16 of 2022.

In some of these embodiments, the genomic sequence of the Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425 is set forth in SEQ ID NO. 1.

In some of these embodiments, the fermentation medium of the Wilkinsonii yeast (Wickerhamomyces anomalus) ZB425 is a wort medium.

An embodiment of the present application provides a distiller's yeast.

A distiller's yeast processed from the abnormal wilm yeast (Wickerhamomyces anomalus) ZB425.

In some of these embodiments, the distiller's yeast is prepared by the following preparation method:

preparing a yeast: mixing bran and rice husk, adding water, and mixing well;

and (3) cooking: steaming and boiling the uniformly mixed yeast material for 40-70 min;

and (3) cooling: naturally cooling the yeast material to 30-50 ℃ after the steaming is finished, and supplementing water;

inoculating: inoculating the abnormal Wikihan yeast (Wickerhamomyces anomalus) ZB425 strain into the cooled yeast material, and fully and uniformly stirring;

culturing: placing the inoculated yeast material into a constant temperature and humidity incubator for culturing; the culture conditions are as follows: the temperature is 20-40 ℃, the humidity is 80-95%, and the culture time is 5-9 h;

and (3) drying: and after the culture is finished, drying the yeast material to obtain the distiller's yeast.

In some embodiments, when the yeast material is prepared, the water is added in an amount of 65-85% of the total mass of the bran and the rice husk;

in some embodiments, the inoculum size of the Wilkameter yeast ZB425 is 1% -3% of the mass of the cooled starter at the time of inoculation.

An embodiment of the application provides application of the Wilkameter anomala (Wickerhamomyces anomalus) ZB425 in preparation of brewed wine.

In some of these embodiments, the brewed wine comprises yellow wine, rice wine.

In some of these embodiments, the Wilkamella anomala (Wickerhamomyces anomalus) ZB425 is used to increase the aroma content of brewed wine.

In some of these embodiments, the aroma includes ethyl acetate, ethyl octanoate, diethyl succinate, phenethyl acetate, and phenylacetaldehyde.

In some of these embodiments, the Wilkham yeast (Wickerhamomyces anomalus) ZB425 is used to reduce the higher alcohol content of brewed wine.

In some of these embodiments, the Wilkham yeast (Wickerhamomyces anomalus) ZB425 is used to reduce the content of 1-octen-3-ol and diacetyl in brewed wine.

An embodiment of the application provides yellow wine.

A preparation method of yellow wine comprises the following steps:

soaking rice: weighing rice, and soaking the rice in water for 1 to 1.5 hours;

washing rice: fishing out the soaked rice, and washing with water at least twice until no white rice pulp exists;

steaming rice: placing the drained rice into a rice steamer to steam rice, turning off fire and turning over the rice after the rice is rounded for 10-15 min, uniformly spreading 20-30% hot water, continuing steaming the rice for 20-40 min until the rice is soft and hard outside and has no white core inside, and taking the rice out of the rice steamer for standby;

and (5) spreading and cooling: placing steamed rice at a ventilation position, and naturally cooling to 30-50 ℃;

and (3) can dropping: adding the distiller's yeast prepared from the Wick ham yeast ZB425 into a fermentation barrel in advance, pouring cooled rice into the fermentation barrel, adding an enzyme preparation, yeast activating solution and water, and uniformly stirring;

fermentation: pre-fermenting for 2-4 d at 20-30 ℃, raking at least twice a day after tank dropping, transferring to post-fermenting for 20-30 d at 15-20 ℃ after 2-4 d;

and (3) squeezing: filtering and collecting to obtain sake;

decocting wine: and (3) keeping the sake at 80-90 ℃ for 20-30 min, and sterilizing to obtain the yellow wine.

Embodiments of the present application will be described in detail below with reference to examples. It should be understood that these examples are only for illustrating technical effects of the present application and are not intended to limit the scope of the present application. Unless otherwise indicated, all methods and test conditions used in the examples of the present application are those conventionally used in the art, and all reagents, equipment and media used in the art are those conventionally used in the art, and can be prepared by conventional methods or commercially available. In the examples, the percentages are mass percentages unless otherwise indicated.

Example 1 obtaining Wilkham yeast ZB425

The Wilkameter anomala ZB425 is obtained by separating by the following method:

(1) culturing: a small amount of yellow wine lees are dipped in sterile water by a glass rod in an ultra-clean workbench, inoculated in a wort culture medium and cultivated under proper conditions until bacterial colonies are generated; among these, the above-mentioned suitable culture conditions may be: the temperature is 25-30 ℃ and the culture time is 48-72h.

(2) Separating: selecting colonies with different forms, respectively inoculating the colonies into different culture mediums, separating the colonies by a plate streaking method, and continuously culturing the colonies under proper conditions;

(3) screening: selecting a culture medium with obvious aroma by a sniffing mode, selecting a single colony for culture, transferring the strain to an inclined plane tube for preservation, and using the strain in a subsequent test;

(4) and (3) expanding cultivation: performing secondary expansion culture on the strain preserved on the inclined surface tube to collect a sufficient amount of thalli to obtain a screened strain with the number of ZB425, and preserving the strain for later use;

(5) and (3) strain identification and preservation: the deposited ZB425 strain was subjected to sequencing and identification by Beijing Nostoc source technologies Co., ltd, and the sequence thereof was as follows, SEQ ID NO.1:

TGCGGAAGGATCATTAATGTTATTTGTTTTTAGACCTGCGCTTAACTGCGCGGTTTAATAAACTCTTATACACAGTGTTTTTGTTTGCGAATTTGGTTTAGTTTGTTGGTTTTCATTCGAAAGGATGAAGATTGATTGCTAAATCTTATTCAGCTTTTTAAACTCAGATCTCTTTTTAAGAGAAATGTATTTTTTTAATTACAACTAGTCGATTTTACAAACTAAAAGTTTAAAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTATAGTATTCTATAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCTTTGGGTTTAGTATTGAAGGTTGTGTTAGCTTCTGCTAACTCCTTTGAAATGACTTGGCAATTGATTGAGTTTTCCATATATTTGCTTAAGGATTTAATATTAGGTTCTACCAACTTATTAAATACCCTTTTGCGAAGGACTTACTCGTGTATCAAGGCCTTATAACTTTGTCATTAATTTTGACCTCAAATCAGGTAAGGATACCCGCTGAACTTAAGCATA. Sequencing and identification result shows that the abnormal Wick yeast (Wickerhamomyces anomalus) is named as an abnormal Wick yeast strain ZB425 which is deposited in the Guangdong province microorganism strain collection at 6-month 16 of 2022, and the deposition number is GDMCC No. 62549.

The microscopic morphology of cells of Wikipedia anomala (Wickerhamomyces anomalus) ZB425 is shown in FIG. 1, and the single colony morphology of Wikipedia anomala (Wickerhamomyces anomalus) ZB425 is shown in FIG. 2.

(6) Constructing a phylogenetic tree: and (3) introducing the strain identification sequencing result into an NCBI website (https:// www.ncbi.nlm.nih.gov /) to perform a nucleic acid sequence Blast, selecting strains with the similarity of more than 97% according to the comparison result, and downloading fasta format sequence files. And importing the downloaded sequence file into Mega 11 software for sequence comparison, and constructing a phylogenetic tree according to the comparison result, wherein the result is shown in figure 3.

Example 2 preparation of distiller's yeast by Wilkham's yeast ZB425

(1) Preparing a yeast: mixing bran and rice husk according to a certain proportion, adding water with the total weight of 70%, and uniformly mixing until no obvious dry yeast or agglomerated yeast exists;

(2) and (3) cooking: spreading gauze on the steamer tray, spreading the mixed yeast material to the steamer tray, and covering the upper layer with gauze. After the water is boiled, the water is put into a steamer, holes are inserted in the surface of the curved material, and the looseness is improved. Covering the pot cover after steaming for 60min;

(3) and (3) cooling: naturally cooling the cooked yeast material to 40 ℃, and supplementing three-stage water to target water;

(4) inoculating: placing the glass rod inoculating loop and other instruments into an ultra-clean workbench after sterilization, and turning on an ultraviolet lamp of the sterile room and the ultra-clean workbench to irradiate for 30min for sterilization. Transferring strain and yeast material through a transfer window, weighing the abnormal Wick ham yeast (Wickerhamomyces anomalus) ZB425 strain according to 3% of the yeast material in an ultra-clean workbench, fully and uniformly stirring, and covering the yeast material with a gauze cover;

(5) culturing: the inoculated yeast material is placed in a constant temperature and humidity incubator and is cultivated for 7 hours at the temperature of 30 ℃ and the humidity of 85 percent. The strain is kept loose to grow, and the humidifier is turned off. In the whole culture process, if the temperature of the yeast core exceeds 40 ℃, cooling the incubator;

(6) and (3) drying: and after the hypha grows fully and the temperature of the yeast core is reduced to the temperature of the incubator, drying the yeast material to obtain the distiller's yeast.

Example 3 application of Wilkham's yeast ZB425 in preparing yellow wine

1. Yellow wine is prepared

(1) Soaking rice: weighing a preset amount of rice, adding water, and soaking for 1h;

(2) washing rice: fishing out the soaked rice, and washing with water at least twice until no white rice pulp exists;

(3) steaming rice: placing the drained rice in a rice steamer to steam rice, turning off the fire and turning over the rice after the rice is steamed for 10min, uniformly spreading 25% hot water, continuing steaming rice for 40min until the rice grains are soft and hard, and no white core exists in the rice grains, and taking out of the rice steamer for standby;

(4) and (5) spreading and cooling: placing steamed rice in a ventilation place, and naturally cooling to 40 ℃;

(5) and (3) can dropping: adding distiller's yeast or common malt yeast prepared based on abnormal Wick yeast ZB425 in the embodiment 2 into a fermentation barrel in advance, wherein the distiller's yeast prepared based on abnormal Wick yeast ZB425 is a test group, the common malt yeast is a control group, pouring cooled rice into the fermentation barrel, adding an enzyme preparation and a yeast activating solution, adding water to a predetermined weight, and stirring uniformly;

(6) fermentation: pre-fermenting at 25deg.C for 3d, removing tank, raking at least twice a day, and transferring to post-fermenting at 15deg.C for 25d;

(7) and (3) squeezing: filtering with perlite as filter aid, collecting to obtain clear wine, and filling clear wine into clean glass bottle;

(8) decocting wine: maintaining at 85deg.C for 25min, and sterilizing to obtain yellow wine. Yellow wine obtained by fermenting distiller's yeast prepared by Wick yeast ZB425 is called test group yellow wine, and yellow wine obtained by fermenting common wheat yeast is called control group yellow wine.

2. Physical and chemical index detection

Physical and chemical index measurement is carried out on the test group yellow wine and the control group yellow wine, wherein the physical and chemical index measurement comprises alcohol degree, total acid, amino acid nitrogen and pH, and the results are shown in table 1. As can be seen from Table 1, the test group yellow wine had higher alcohol content and slightly lower total acid level, and the amino acid nitrogen and pH were similar to those of the control group. All physical and chemical indexes of the yellow wine of the test group meet the requirements of related standards.

TABLE 1

3. Aroma analysis

Aiming at the yellow wine of the test group and the yellow wine of the control group, the volatile substance component composition of the yellow wine is detected by adopting a headspace solid-phase microextraction-gas chromatography-mass spectrometry (SPME-GC-MS), and the specific detection method is as follows:

(1) SPME extraction conditions:

extracting with DVB/CAR/PDMS three-phase extraction head, taking 5mL sample in 20mL headspace bottle, shaking at 40deg.C and 300RPM for incubation for 10min, extracting for 30min, and thermally analyzing and desorbing at 250deg.C for 10min for sample injection;

(2) GC-MS conditions: column HP-inowax (60 m 0.25mm 0.25 um); the temperature of the sample inlet is 250 ℃; constant flow mode, column flow rate 1.2mL/min; the temperature of the mass spectrum interface is 250 ℃; ion source 250 ℃, quadrupole 150 ℃; full scan mode acquisition signal (29-550 da);

heating program: maintaining at 40deg.C for 5min; heating to 250 ℃ at 5 ℃/min, and keeping for 10min.

The detection results are shown in Table 2 below.

TABLE 2

Note that: increase= (test group yellow wine-control group yellow wine)/test group yellow wine × 100%.

As can be seen from Table 2, in the aspect of aroma substances, compared with the yellow wine of the control group, the content of the ester substances is improved by 15.0%, and the increase of the ester substances can enable the aroma of the yellow wine to be thicker, and particularly, the contents of key aroma substances such as ethyl acetate, ethyl octoate, diethyl succinate and phenethyl acetate in the ester substances are obviously improved, and the aroma substances are fruity, floral or bouquet, so that the yellow wine has pleasant flower and fruit aroma and bouquet. Meanwhile, the content of phenylacetaldehyde which is another aldehyde key aroma substance is obviously improved to 20.6%, the aroma of the phenylacetaldehyde is floral, and the phenylacetaldehyde is combined into coordinated and fine aroma in the yellow wine, so that pleasant, soft and elegant feeling is given to people, and the method has very important contribution to the aroma of the yellow wine. Meanwhile, the content of 1-octene-3-ol and 2, 3-butanedione is reduced, wherein the 1-octene-3-ol is also known as mushroom alcohol and has mushroom flavor, and the 2, 3-butanedione (also known as diacetyl) has meal sour flavor when the concentration is high, both components can influence the flavor of the yellow wine, and the reduction of the content can help to lighten the peculiar smell of the yellow wine.

In addition, the content of higher alcohol in the yellow wine of the test group is reduced by 23.3%, the higher alcohol refers to the general name of alcohols containing more than 3 carbon atoms, commonly called fusel oil, and the content of the higher alcohol is too high, so that the yellow wine not only can cause spicy and bitter taste, but also can generate foreign flavor and cause 'top' of drinking (the conditions of dizziness, headache, regurgitation and the like after drinking). As shown in Table 2, the main higher alcohol substances in yellow wine, i.e. isobutanol and isoamyl alcohol, are obviously reduced by 10.7% and 26.9% respectively. The content of the higher alcohol is reduced, so that the foreign flavor caused by the excessively high content of the higher alcohol can be reduced, and the yellow wine has more coordinated and mellow taste.

In conclusion, the yellow wine brewing is carried out by adopting the abnormal Wick yeast (Wickerhamomyces anomalus) ZB425, and all physicochemical indexes (including pH, total acid, amino acid nitrogen, alcohol degree and the like) of the obtained yellow wine meet the requirements of relevant standards; the distiller's yeast is prepared by using the Wilkham yeast (Wickerhamomyces anomalus) ZB425, and is used for brewing the yellow wine, so that the types and the contents of fragrance substances of the yellow wine can be increased, and the fragrance of the yellow wine is enriched. Compared with the yellow wine prepared from the traditional wheat starter, the yellow wine has the advantages that the fragrance is obviously improved, specifically, the total content of ester substances is improved, wherein the contents of key fragrance substances such as ethyl acetate, ethyl octanoate, diethyl succinate and phenethyl acetate are obviously improved, the contents of other aldehyde key fragrance substances such as phenylacetaldehyde are also obviously improved, the contents of 1-octene-3-ol and diacetyl are obviously reduced, and the peculiar smell of the yellow wine is reduced. Meanwhile, the content of the higher alcohol is reduced, so that the unpleasant taste caused by the excessively high content of the higher alcohol can be reduced, and the yellow wine has more harmonious and mellow taste. The abnormal Wilkham yeast ZB425 is used for starter propagation, and further applied to the production of yellow wine, so that yellow wine with rich 'starter aroma' and coordinated taste can be obtained.

In the foregoing embodiments, the descriptions of the embodiments are emphasized, and for parts of one embodiment that are not described in detail, reference may be made to related descriptions of other embodiments.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims.

Claims (8)

1. The Wickettsia anomala (Wickettsia anomala) ZB425 is characterized in that the Wickettsia anomala (Wickettsia anomala) ZB425 is deposited with the microorganism strain collection of Guangdong province at 6 months of 2022 with the deposit number GDMCCNo of 62549.

2. A distiller's yeast, characterized in that the distiller's yeast is processed from the abnormal wikeham yeast ZB425 of claim 1.

3. Use of the yeast wilcoxham (wilkerhamycesanomalus) ZB425 of claim 1 in the preparation of yellow wine.

4. Use according to claim 3, wherein the abnormal wilhelminth yeast (wickerhamycesanomalus) ZB425 is used to increase the aroma content of yellow wine.

5. The use according to claim 4, wherein the aroma comprises ethyl acetate, ethyl octanoate, diethyl succinate, phenethyl acetate and phenylacetaldehyde.

6. Use according to claim 3, wherein the abnormal wilhelminth yeast (wickerhamycesanomalus) ZB425 is used to reduce the higher alcohol content of yellow wine.

7. Yellow wine prepared by using Wicke Han's yeast (Wickerhamnomycesanomalus) ZB425 according to claim 1 or distiller's yeast according to claim 2.

8. The preparation method of the yellow wine is characterized by comprising the following steps:

soaking rice: weighing rice, and soaking the rice in water for 1 to 1.5 hours;

washing rice: fishing out the soaked rice, and washing with water at least twice until no white rice pulp exists;

steaming rice: placing the drained rice into a rice steamer to steam rice, turning off fire and turning over the rice after the rice is rounded for 10-15 min, uniformly spreading 20-30% hot water, continuing steaming the rice for 20-40 min until the rice is soft and hard outside and has no white core inside, and taking the rice out of the rice steamer for standby;

and (5) spreading and cooling: placing steamed rice at a ventilation position, and naturally cooling to 30-50 ℃;

and (3) can dropping: adding the distiller's yeast according to claim 2 into a fermentation barrel in advance, pouring the cooled rice into the fermentation barrel, adding an enzyme preparation, yeast activating solution and water, and uniformly stirring;

fermentation: pre-fermenting for 2-4 d at 20-30 ℃, raking at least twice a day after tank dropping, transferring to post-fermenting for 20-30 d at 15-20 ℃ after 2-4 d;

and (3) squeezing: filtering and collecting to obtain sake;

decocting wine: and (3) keeping the sake at 80-90 ℃ for 20-30 min, and sterilizing to obtain the yellow wine.