CN116064888A - Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain - Google Patents
Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain Download PDFInfo
- Publication number
- CN116064888A CN116064888A CN202210832841.3A CN202210832841A CN116064888A CN 116064888 A CN116064888 A CN 116064888A CN 202210832841 A CN202210832841 A CN 202210832841A CN 116064888 A CN116064888 A CN 116064888A
- Authority
- CN
- China
- Prior art keywords
- mon87403
- strain
- probe
- primer
- digital pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a specific primer pair and a fluorescent labeling probe for detecting a specific gene component of a transgenic corn Mon87403 strain by a digital PCR method, wherein the specific primer pair consists of an upstream primer and a downstream primer, the sequence of the upstream primer is shown as SEQ ID No.1, the sequence of the downstream primer is shown as SEQ ID No.2, and the sequence of the fluorescent labeling probe is shown as SEQ ID No. 3. The method can be used for accurate quantification and low-content sensitive qualitative detection of the transgenic maize strain Mon87403, and has the advantages of accurate quantification result, high detection sensitivity, strong specificity, stable and reliable result and prevention of false positive caused by cross contamination.
Description
Technical Field
The invention relates to the field of biological detection, in particular to a quantitative detection method of a transgenic corn Mon87403 strain.
Background
At present, about 50 countries and regions sequentially issue and implement a transgene identification system, and identification and management are carried out on transgenic organisms and processed products thereof. In recent years, with the establishment and improvement of GMO (Genetically Modified organism) labeling methods in various countries, a lower limit of GMO content in foods has been defined. Many countries require not only qualitative detection of transgenic foods, but also quantitative detection of GMO content in foods for identification, with a threshold value of typically between 0.9% and 5%. The establishment of a detection technical standard, particularly an accurate quantitative detection technology, of the transgenic product is a technical premise for implementing the identification of the transgenic product. Therefore, precise quantitative technology of transgenic components is becoming important with the perfection and development of worldwide identification systems. It is urgent to establish a scientific transgenic quantification, in particular a low content component quantification method and to formulate corresponding technical trade measures.
The digital PCR technique (digital polymerase chain reaction, dPCR) is a technique in which a trace sample is classified into a large number of dilutions and subdivisions until the number of molecules to be detected contained in each subdivision sample does not exceed 1, and then all subdivision samples are simultaneously subjected to PCR amplification under the same conditions, and counted one by one according to the poisson distribution principle.
dPCR is used as a new technology for more accurate and sensitive DNA quantitative detection, realizes absolute quantification of single-molecule DNA, solves the problem that a standard curve used by common digital PCR has influence on a measurement result and the like, and can reduce the matrix effect brought by the standard curve. The use of the dPCR technology to improve the accuracy and practical value of the quantitative detection method becomes an important direction of the development of the precise quantitative detection technology of the transgenes. The dPCR has the characteristics of measurement independence and no need of any calibrator, and opens up a new path for quantitative detection of corn transgenic components, so that quantitative analysis and tracing of the corn transgenic components in food become possible.
Therefore, a quantitative detection method for transgenic corn Mon87403 strain with high sensitivity, strong specificity, accurate and reliable results, and rapid and simple operation is needed.
Disclosure of Invention
The invention aims to provide a specific primer pair for accurately and quantitatively detecting a specific gene component of a transgenic corn Mon87403 strain, a fluorescent marker probe, a kit comprising the specific primer pair and the fluorescent marker probe and application thereof.
Aiming at the purpose of the invention, the invention provides the following technical scheme:
the inventor designs an oligonucleotide primer pair and a probe capable of specifically identifying specific gene components of transgenic corn Mon87403 strain according to the junction of the exogenous insertion site of the transgenic corn Mon87403 and the corn genome, and can efficiently and specifically amplify a short transgenic corn specific gene fragment from sample DNA.
Specifically, the first aspect of the invention provides a specific primer pair for detecting a specific gene component of a transgenic corn Mon87403 strain by a digital PCR method, wherein the specific primer pair consists of an upstream primer and a downstream primer, and the upstream primer is 87403-F1: CTTTCTTTTTCTCCATATTGACCATCATAC (SEQ ID No. 1), the downstream primer being 87403-R1: TACTCCGGAATGAGTGCTCTGTATC (SEQ ID No. 2).
The second aspect of the invention provides a fluorescent marker probe for detecting specific gene components of transgenic corn Mon87403 strain by a digital PCR method, wherein the fluorescent marker probe is 87403-P1: TCATTGCGATCCACATTTCCCTACATGG (SEQ ID No. 3), wherein a fluorescence quenching group BHQ1 is connected to the 3 'end of the probe, and a fluorescence reporting group FAM is connected to the 5' end.
The third aspect of the invention also provides a kit for detecting the specific gene component of the transgenic corn Mon87403 strain by a digital PCR method, which comprises the specific primer pair and the fluorescent marked probe.
Preferably, the kit further comprises a reference substance.
More preferably, the control comprises a negative control and a positive control.
More preferably, the negative control is sterile double distilled water.
The fourth aspect of the invention also provides application of the specific primer pair and/or the fluorescent marker probe in detecting specific gene components of transgenic corn Mon87403 strain by a digital PCR method.
The fifth aspect of the invention also provides application of the specific primer pair and/or the fluorescent marked probe in preparation of a reagent for detecting specific gene components of transgenic corn Mon87403 strain by using a digital PCR method.
The sixth aspect of the invention also provides a method for detecting the specific gene component of the transgenic corn Mon87403 strain by a digital PCR method, comprising the following steps:
(1) Extracting nucleic acid in a corn sample to obtain a DNA template;
(2) Performing digital PCR amplification on the DNA template extracted in the step (1) by using the specific primer pair and the fluorescent labeling probe;
(3) And collecting fluorescent signals, and calculating to obtain a detection result according to the yin-yang quantity of the micro-reaction system and the poisson distribution principle.
Preferably, the digital PCR reaction system of the method step (2) includes:
| reaction system | Dosage of |
| Template DNA | 50ng |
| Upstream primer | 10mM，1.0μL |
| Downstream primer | 10mM，1.0μL |
| Probe with a probe tip | 0.5 |
| 2×TaqMan Universal PCR Master Mix(ABI) | 12.5μL |
| Sterile double distilled water | Added to a total volume of 25. Mu.L |
Preferably, the digital PCR amplification in step (2) is performed according to the following amplification procedure: 95℃for 5min (1 ℃/s); 94 ℃ for 15s;60 ℃ for 1min (1 ℃/s) for 50 cycles; 98℃for 10min (1 ℃ C./s).
Preferably, the detection sensitivity of the method is 3 copies/reaction.
The invention has the positive beneficial effects that:
(1) The invention designs a primer by taking the genome of a transgenic corn strain Mon87403 as a reference template according to the characteristic that the specific gene sequence of the strain is different from other transgenic crop genes, and quantitatively detects the specific gene components of the transgenic corn Mon87403 strain in a sample by utilizing digital PCR.
(2) The digital PCR detection method does not depend on the cycle threshold of an amplification curve, does not need housekeeping genes and standard curves, is a DNA absolute quantification method, and has the advantages of reliable, accurate and sensitive results and the like.
(3) The detection method can be used for the accurate quantification and low-content sensitive qualitative detection of the transgenic corn strain Mon87403, has the advantages of accurate quantification result, high detection sensitivity, strong specificity, stable and reliable result and prevention of false positive caused by cross contamination, can reach 3 copies/reaction in quantitative detection limit, and is suitable for the actual quantitative detection requirement of the specific gene component of the transgenic corn strain Mon87403 in rice products in domestic and foreign markets.
Drawings
FIG. 1 is a graph showing the results of screening transgenic corn Mon87403 strain-specific primer probe sets by real-time fluorescence PCR, wherein primer probe set 1F1/R1/P1 and primer probe set 2F2/R2/P2 are arranged above a base line for amplifying transgenic corn Mon87403 strain samples, and primer probe set 3F3/R3/P3 is arranged below the base line for amplifying transgenic corn Mon87403 strain samples, non-transgenic corn and blank (sterile double distilled water);
FIG. 2 is a graph showing the results of amplification of transgenic corn Mon87403 and other transgenic and non-transgenic crops using real-time fluorescent PCR, wherein transgenic corn Mon87403 strain sample amplification curves are above the base line, and transgenic corn NK603, mon88017 transgenic soybean GTS-40-3-2, DP-306043, transgenic rice M12, ke-Ming-rice, and non-transgenic corn, soybean, rice and blank (sterile double distilled water) amplification curves are below the base line;
FIG. 3 is a graph showing the results of quantitative detection of transgenic corn Mon87403 and other transgenic and non-transgenic crops using digital PCR, wherein transgenic corn Mon87403 (F12), NK603 (A07), mon88017 (B07), transgenic rice M12 (C07), ke-Ming-dao (D07), transgenic soybean GTS-40-3-2 (E07), DP-306043 (F07), and non-transgenic corn (G07), soybean (H07), rice (C08), and blank (sterile double distilled water, D08) are sequentially from left to right;
FIG. 4 is a graph of the accurate quantitative results of dPCR amplification of a low content analog sample of Mon87403 with a theoretical content of 3 copies/reaction using digital PCR techniques, with 4 replicates from left to right, each run for 3 replicates.
Detailed Description
The following description of the present invention will be made clearly and fully, and it is apparent that the embodiments described are some, but not all, of the embodiments of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The main equipment used in the embodiment of the invention comprises an eppendorf micropipette, an AB7500 fluorescence qualitative PCR instrument, a high-speed desk-top centrifuge, a DYY C-type electrophoresis instrument and the like. The reagents or apparatus used were conventional reagents or apparatus commercially available without the manufacturer's knowledge. The specific experimental procedures or conditions are not noted in the examples and may be followed by the operations or conditions of conventional experimental procedures described in the literature in this field. Unless otherwise stated, the specific primers and probes used in test examples 2 to 5 of the present application were primer probe set 1F1/R1/P1.
Example 1 screening of specific primer probe set
1. Test method
The specific primer probe group for screening in the test example is 3 groups, and the specific primer probe group is specifically as follows:
Primer probe set 2 upstream primer 87403-F2: GTATCCTCCACCATGTCGTACG (SEQ ID No. 4), downstream primer 87403-R2: TCTCCATATTGACCATCATACTCATGT (SEQ ID No. 5); the probe is 87403-P2: GATCCACATTTCCACGATAC (SEQ ID No. 6).
Primer probe set 3 upstream primer 87403-F3: ACGTAGCTACGTGTACGTACGT (SEQ ID No. 7), downstream primer 87403-R3: GCTAGCATCGTAGCTAGCAGCGCA (SEQ ID No. 8); the probe is 87403-P3: GCTAGCTAGCATGCGGCAGCGGGCATCAC (SEQ ID No. 9).
The transgenic corn Mon87403 strain specific gene is amplified by real-time fluorescent PCR (probe method), and the real-time fluorescent PCR reaction system is as follows:
| reaction system | Dosage of |
| Template DNA | 50ng |
| Upstream primer | 10mM，1.0μL |
| Downstream primer | 10mM，1.0μL |
| Probe with a probe tip | 0.5 |
| 2×TaqMan Universal PCR Master Mix(ABI) | 12.5μL |
| Sterile double distilled water | Added to a total volume of 25. Mu.L |
A corresponding blank control (ultrapure water for preparing a reaction system is used for replacing a DNA template to detect whether the reagent is polluted) is established for each PCR detection.
The real-time fluorescent PCR reaction parameters were as follows: 95 ℃ for 10min;95 ℃ for 15s;60 ℃ for 1min.
2. Test results
As shown in FIG. 1, when the real-time fluorescence PCR is utilized to detect the specific gene of the transgenic corn Mon87403 strain, 3 groups of primer probes are designed for screening, and the result shows that both the primer probe group 1F1/R1/P1 and the primer probe group 2F2/R2/P2 can effectively amplify the target gene, but the fluorescence signal intensity of the primer probe group 2F2/R2/P2 is slightly lower than that of the primer probe group 1F1/R1/P1, and the primer probe group 3 cannot amplify. Therefore, the primer probe group 1F1/R1/P1 is selected for subsequent experiments.
Test example 2 investigation of primer probe set specificity by real-time fluorescence PCR method
The transgenic maize Mon87403 strain-specific gene was amplified by real-time fluorescent PCR (probe method). The specific primers and probes used are probe set 1F1/R1/P1, and the real-time fluorescence PCR reaction system and reaction parameters are the same as those of test example 1.
2. Test results
As shown in FIG. 2, when the real-time fluorescence PCR is used for detecting the specific gene of the strain Mon87403 of the transgenic corn, the sample of the strain Mon87403 can show an amplification curve, and the other strains of transgenic corn NK603, mon88017, transgenic No. Mi Kefeng, ke-Ming-dao, transgenic soybean GTS-40-3-2, DP-306043 and non-transgenic corn, soybean, rice and blank control have no fluorescence curve. The test results show that the probe set 1F1/R1/P1 has specificity to the transgenic corn Mon87403 strain.
Test example 3, digital PCR method for investigating the specificity of primer-probe set
1. Test method
The test example is to quantitatively detect the copy number of the transgenic corn gene by using the sequence of a transgenic corn Mon87403 strain-specific primer probe through digital PCR.
The digital PCR reaction system was the same as in test example 1, and the parameters of the digital PCR reaction were as follows: 95℃for 5min (1 ℃/s); 15s at 94℃and 1min (1 ℃/s) at 60℃for a total of 50 cycles; 98℃for 10min (1 ℃ C./s).
2. Test results
As shown in FIG. 3, when transgenic corn and other samples with the same DNA concentration are precisely and quantitatively detected by digital PCR, 861 copies/reaction of the transgenic corn is successfully detected, and the transgenic corn M12, rice borer, transgenic soybean GTS-40-3-2, DP-306043, transgenic corn NK603, mon88017 and non-transgenic corn, soybean, corn and blank control are not amplified. The test result shows that the method can accurately and specifically detect the transgenic corn Mon87403 component in the sample.
Test example 4 digital PCR method for investigating accuracy and sensitivity of primer-probe set
1. Test method
The same procedure as described in test example 3 was followed except that the genomic DNA of the transgenic maize sample was diluted 2.5-fold, 5-fold and 10-fold respectively as templates, and each dilution gradient was repeated 3 times, and the digital PCR quantitative detection was performed using the transgenic maize Mon87403 amplification primer and probe sequences identical to those in test example 3 to determine the method sensitivity.
2. Test results
As shown in Table 1, the amounts of the genomic DNA stock solutions of the transgenic corn samples with 641 copies/reaction were diluted 2.5 times, 5 times and 10 times, respectively, 211.33 copies/reaction, 135.67 copies/reaction and 74.47 copies/reaction, the deviations from the theoretical values (deviation= (average value-theoretical value)/theoretical value x 100%) were-17.58%, 5.83% and 16.18%, respectively, the theoretical copy values were basically met, and the RSD values of 3 times repeated of each dilution gradient were 0.84%, 0.49% and 3.02%, respectively, which indicates that the accurate quantitative detection method has good accuracy and sensitivity when detecting the strain-specific gene components of the transgenic corn Mon87403 strain, and the strain-specific gene components with different amounts can be accurately quantified.
TABLE 1 accuracy and sensitivity for quantitative detection of Mon87403 strain specific Gene composition by digital PCR
Test example 5 digital PCR method for investigating precision of primer probe set
1. Test method
The dPCR amplification was performed on a low-content mock sample of Mon87403 having a theoretical content of 3 copies/reaction, 3 times each sample, and 4 replicates were set up as described in experimental example 3.
2. Test results
As shown in FIG. 4, when the theoretical concentration of Mon87403 is 3 copies/reaction, the quantitative average result of the 4 parallel samples is 3.23 copies/reaction, 2.38 copies/reaction, 3.68 copies/reaction and 2.80 copies/reaction respectively, and the average deviation from the theoretical content value is between-6.6% and 22.67%, so that the quantitative detection requirement is met.
The test results show that the method has good precision and repeatability when accurately and quantitatively detecting the low-content transgenic corn Mon87403 strain specific gene component.
In summary, since the digital PCR platform is divided into two types, i.e., droplet-type and chip-type, the method established by the present invention is verified to be applicable to both platforms simultaneously by performing the embodiment analysis on different platforms.
Although specific embodiments of the invention have been described, those skilled in the art will recognize that many changes and modifications may be made thereto without departing from the scope or spirit of the invention. Accordingly, the present invention is intended to embrace all such alterations and modifications that fall within the scope of the appended claims and equivalents thereof.
Claims (10)
1. The specific primer pair for detecting the specific gene component of the transgenic corn Mon87403 strain by using a digital PCR method is characterized by comprising an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID No.1, and the sequence of the downstream primer is shown as SEQ ID No. 2.
2. A fluorescent marker probe for detecting a transgenic corn Mon87403 strain specific gene component by a digital PCR method is characterized in that the sequence of the fluorescent marker probe is shown as SEQ ID No. 3.
3. The fluorescently labeled probe of claim 2, wherein the 3 'end of the fluorescently labeled probe is linked to a fluorescence quenching group BHQ1 and the 5' end is linked to a fluorescence reporting group FAM.
4. A kit for detecting a transgenic maize Mon87403 strain specific gene component by digital PCR, comprising the specific primer pair of claim 1 and the fluorescent label probe of claim 2 or 3.
5. The kit of claim 4, further comprising a control.
6. The kit of claim 5, wherein the controls comprise a negative control and a positive control.
7. The kit of claim 6, wherein the negative control is sterile double distilled water.
8. Use of the specific primer pair of claim 1 and/or the fluorescent-labeled probe of claim 2 or 3 for detecting specific gene components of transgenic corn Mon87403 strain by a digital PCR method.
9. Use of a specific primer pair according to claim 1 and/or a fluorescent-labeled probe according to claim 2 or 3 for the preparation of a reagent for detecting a specific gene component of transgenic maize Mon87403 line by a digital PCR method.
10. The method for detecting the specific gene component of the transgenic corn Mon87403 strain by using the digital PCR method is characterized by comprising the following steps:
(1) Extracting nucleic acid in a corn sample to obtain a DNA template;
(2) Performing digital PCR amplification on the DNA template extracted in step (1) using the specific primer pair of claim 1 and the fluorescent-labeled probe of claim 2 or 3;
(3) And collecting fluorescent signals, and calculating to obtain a detection result according to the yin-yang quantity of the micro-reaction system and the poisson distribution principle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210832841.3A CN116064888A (en) | 2022-07-14 | 2022-07-14 | Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210832841.3A CN116064888A (en) | 2022-07-14 | 2022-07-14 | Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116064888A true CN116064888A (en) | 2023-05-05 |
Family
ID=86173728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210832841.3A Pending CN116064888A (en) | 2022-07-14 | 2022-07-14 | Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116064888A (en) |
-
2022
- 2022-07-14 CN CN202210832841.3A patent/CN116064888A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| US7537889B2 (en) | Assay for quantitation of human DNA using Alu elements | |
| CN111647649B (en) | Method for assisted selection of cattle growth traits based on CCDC39 gene CNV detection | |
| CN115094156A (en) | Development and application of KASP marker of rice high-temperature-resistant gene TT1 | |
| CN114507749A (en) | Primer group, kit and method for accurately detecting corn transgenic components | |
| CN106521018A (en) | Primer and method for high-flux detection of transgenic maize containing NOS terminator | |
| CN111793707B (en) | Gene editing transgenic crop editing site specificity PCR method and application thereof | |
| CN116064888A (en) | Primer, probe, kit and method for quantitative detection of transgenic corn Mon87403 strain | |
| KR20190103934A (en) | Qualitative or quantitative mutant genotyping methods and real-time PCR kits for performing the methods | |
| CN109504749A (en) | The KASP detection primer of transgenic corns L239 and its filial generation homozygote and heterozygote | |
| CN115505648A (en) | Development and application of KASP molecular marker of drought-resistant gene of corn | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN113293231A (en) | Real-time fluorescent PCR primer pair and probe set for identifying different genotypes of porcine pseudorabies virus, kit and method | |
| CN113215287A (en) | Primer, probe, kit and method for detecting lycoris radiata mealybugs based on fluorescent quantitative PCR | |
| CN104830857A (en) | Primer, probe and method for specific quantitative PCR accurate detection of genetically modified corn MON88017 strain | |
| CN116334189B (en) | Internal standard system for monitoring qPCR reaction interference and application thereof | |
| CN104561313A (en) | Endogenous reference gene suitable for detection of sesame exogenous gene copy number and building method and application of endogenous reference gene | |
| CN107312819B (en) | Primer probe, kit and method for accurate quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain | |
| CN109628632A (en) | A kind of primer combination, probe, kit and method for transgenic corns MON87419 event-specific detection | |
| CN117051138B (en) | Kit for detecting 23 food pathogenic bacteria by single tube | |
| Wang et al. | Optimization of 6-carboxy-X-rhodamine concentration for real-time polymerase chain reaction using molecular beacon chemistry | |
| CN117230159A (en) | Method for detecting transgene copy number by utilizing terminator containing fingerprint sequence | |
| CN117327695A (en) | Terminator sequence and method for rapid detection of transgene copy number | |
| CN108118097B (en) | Primer probe, kit and method for quantitatively detecting dysentery amoeba | |
| CN116590390A (en) | Method for rapidly detecting copy number of transgene by inserting DNA fingerprint sequence into terminator |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |