CN116064787A - Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia - Google Patents

Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia Download PDF

Info

Publication number
CN116064787A
CN116064787A CN202210832718.1A CN202210832718A CN116064787A CN 116064787 A CN116064787 A CN 116064787A CN 202210832718 A CN202210832718 A CN 202210832718A CN 116064787 A CN116064787 A CN 116064787A
Authority
CN
China
Prior art keywords
detection
lymphoblastic leukemia
acute lymphoblastic
mercaptopurine
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210832718.1A
Other languages
Chinese (zh)
Inventor
赵维
周岳
郝国祥
杨帆
吴珂梁
郑义
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210832718.1A priority Critical patent/CN116064787A/en
Publication of CN116064787A publication Critical patent/CN116064787A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/04—Preparation or injection of sample to be analysed
    • G01N30/06—Preparation
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/26—Conditioning of the fluid carrier; Flow patterns
    • G01N30/28—Control of physical parameters of the fluid carrier
    • G01N30/30—Control of physical parameters of the fluid carrier of temperature
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/26—Conditioning of the fluid carrier; Flow patterns
    • G01N30/28—Control of physical parameters of the fluid carrier
    • G01N30/32—Control of physical parameters of the fluid carrier of pressure or speed
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/26—Conditioning of the fluid carrier; Flow patterns
    • G01N30/28—Control of physical parameters of the fluid carrier
    • G01N30/34—Control of physical parameters of the fluid carrier of fluid composition, e.g. gradient
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/62—Detectors specially adapted therefor
    • G01N30/74—Optical detectors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/86—Signal analysis
    • G01N30/8675—Evaluation, i.e. decoding of the signal into analytical information
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57426—Specifically defined cancers leukemia
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/26—Conditioning of the fluid carrier; Flow patterns
    • G01N30/28—Control of physical parameters of the fluid carrier
    • G01N30/32—Control of physical parameters of the fluid carrier of pressure or speed
    • G01N2030/324—Control of physical parameters of the fluid carrier of pressure or speed speed, flow rate
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Library & Information Science (AREA)

Abstract

The invention relates to a drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia. 6-mercaptopurine therapy is an important therapeutic drug for infants suffering from ALL, but obvious blood toxicity and liver toxicity occur in the part of the treatment process. In order to ensure the clinical curative effect of 6-MP and reduce the occurrence rate of leukopenia and hepatotoxicity, the invention provides a method for guiding the personalized treatment of mercaptopurine of children suffering from acute lymphoblastic leukemia based on gene polymorphism and blood concentration monitoring and application thereof, and establishes a drug guidance system for patients suffering from acute lymphoblastic leukemia in China based on 6-MP metabolism related markers and 6-TGN content in blood.

Description

Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia
Technical Field
The invention belongs to the technical field of disease diagnosis and treatment products, and particularly relates to a marker combination and application of a detection reagent of the marker combination in preparation of a product for guiding administration of medicines to children suffering from acute lymphoblastic leukemia.
Background
The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.
Acute lymphoblastic leukemia (Acute lymphoblastic leukemia, ALL) is a type of acute leukemia, the most common malignancy in children, with a 3-5/10 ten thousand annual incidence. ALL originates mainly from B-or T-line lymphoprogenitors, leukemic cells proliferate and aggregate abnormally in the bone marrow and inhibit normal hematopoiesis, resulting in anemia, thrombocytopenia, and neutropenia; leukemia cells can also invade extramedullary tissues such as meninges, gonads, thymus, liver, spleen, lymph nodes, bone tissue, etc., causing corresponding lesions. Over the past 30 years, with increased diagnostic, typing levels and improved treatment regimens, the 5-year survival rate of pediatric ALL may reach over 90%. At present, the international treatment principle of ALL of children is similar, and multi-drug combination treatment is adopted and can be roughly divided into induction relief treatment, early strengthening treatment, consolidation treatment, delayed strengthening treatment and maintenance treatment. The Mercaptopurine drugs [ such as 6-Mercaptopurine (6-MP) ] can interfere purine metabolism, obstruct DNA synthesis, continuously kill residual tumor cells to enable the infant to be in a complete remission state ALL the time, and are main chemotherapeutics for the current ALL infant maintenance treatment stage. However, some children are intolerant to 6-MP, are most frequently clinically treated with hematological toxicity (especially leukopenia) and hepatotoxicity, and cause failure of maintenance therapy or interruption of treatment course, and cause recurrence or secondary tumor, thereby adversely affecting long-term alleviation or control of ALL in children.
Pharmacogenomic studies have shown that single nucleotide polymorphisms (Single nucleotide polymorphisms, SNPs) in the whole exon coding region are the basis for substances that lead to differences in individual drug tolerance. Thus, research into diversity of various metabolic enzyme genes, transporter gene receptor-related genes, and disease pathway genes involved in drug metabolism has become key to achieving individualization of drug therapy. However, pharmacogenetics is complex, the metabolic process of the drug in vivo is often regulated and controlled by a plurality of enzymes, and the polymorphism of the drug metabolic enzyme gene determines the activity of the metabolic enzyme, so that the concentration of drug metabolites in the body of an individual is different, and finally, the difference in adverse drug reaction is caused. Therefore, the multi-gene analysis of the patient, the combination of the pharmacogenomic characteristics of the patient, the rapid determination of the more accurate 6-MP dosage, the reduction of the occurrence rate and the severity of leukopenia and hepatotoxicity on the premise of ensuring the curative effect, the improvement of the medication compliance of the children patients, and the continuous solution of the clinical individuation treatment at present are the problems.
Disclosure of Invention
Based on The technical background, the invention takes The Chinese children patients with The acute lymphoblastic leukemia treated by The 6-MP as an access point in The maintenance treatment stage, develops The individuation treatment research of The 6-MP in The Chinese children patients with The acute lymphoblastic leukemia, collects The pharmacogenomic information of The patients, the concentration of 6-TGN and 6-MMPN in erythrocytes after administration and The like, establishes The relation of dose-concentration-response (DCR) between The 6-MP metabolite of The Chinese children patients with The acute lymphoblastic leukemia and adverse events, establishes The relation between The genotype of The Chinese children patients with The adverse reaction risk caused by The 6-MP, reduces The incidence of adverse reactions such as leukopenia and hepatotoxicity, and The like, establishes The individuation administration scheme of The Chinese children using The 6-MP, and ensures The safety and rationality of children administration.
Specifically, the invention provides the following technical scheme:
in a first aspect of the invention, there is provided a marker combination wherein the marker is selected from the group consisting of DROSHA, GSTP1, IMPDH1, NUDT15, MTHFR, SLC19A1, ITPA, TPMT.
In the marker combination according to the first aspect, the number of markers in the combination is 2 to 8, further 3 to 6, and still further 4 to 5; in a specific embodiment, there are 4.
The biochemical index of the marker comprises the expression content of the gene or the protein, such as the protein expression content or the mRNA content, and also comprises SNP loci positioned in the gene sequence; the SNP loci comprise rs639174 in the DROSHA gene, rs1695 in the GSTP1 gene, rs2278293 in the IMPDH1 gene, rs116855232 in the NUDT15 gene, rs1801133 in the MTHFR gene, rs1051266 in the SLC19A1 gene, rs1127354 in the ITPA gene, and rs1142345, rs1800460, rs1800462 or rs1800584 in the TPMT gene.
In the prior art, the pharmacogenomics aiming at the 6-MP adverse reaction has a relatively extensive research, however, the 6-MP pharmacogenomics of different races have relatively large variation, and the 6-MP pharmacogenomics of children suffering from Chinese acute lymphoblastic leukemia has relatively few researches in the prior art. The invention combines clinical sample analysis with the markers with higher correlation with 6-MP metabolites 6-TGN and 6-MMPN, and further confirms that 4 SNPs (ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs 1801133) are closely related to adverse reactions caused by 6-MP.
Thus, in a preferred embodiment of the first aspect described above, the combination of markers is ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133.
In a second aspect of the invention, there is provided a combination of reagents comprising reagents for detecting a marker combination according to the first aspect.
Reagents for detecting marker combinations as described above, including but not limited to detection reagents, instruments and detection platforms involved in detection based on sequencing methods, taqMan probe methods, PCR amplification methods, analytical beacon methods, high resolution melting curve methods, CAPS methods, SNaPshot methods, KASP methods, mass spectrometry methods; specific examples of the detection reagent are detection primers, probes, antibodies, amplification enzymes, amplification systems, dNTPs, and the like; specific examples of such devices are chips or dipsticks.
In a specific embodiment of the invention, a primer combination for detection of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 is provided, wherein the primer combination comprises an amplification primer and an extension primer, and the specific sequences are as follows:
amplification primer sequence:
Figure BDA0003749042450000031
extension primer sequence:
rs2278293 GGCTCGGCCCCAAGGCTC SEQ ID NO:9
rs116855232 TCATAGCCTTGTTCTTTTAAACAAC SEQ ID NO:10
rs1801133 GAAGGTGTCTGCGGGAG SEQ ID NO:11
rs1127354 TCGTTCAGATTCTAGGAGATAAGTTT SEQ ID NO:12
preferably, the reagent combination further comprises a reagent for detecting the content of the 6-MP metabolite in blood.
Further, the 6-MP metabolites are 6-TGN, 6-MMPN, or 6-TG and 6-MeMP.
Further, the reagent for detecting the content of the 6-MP metabolite is a reagent involved in detection based on a chromatographic method, and comprises a reagent for treating a blood sample and chromatographic detection flow equality.
In a third aspect, the invention provides a detection reagent of the marker combination in the first aspect and application of the reagent combination in the second aspect in preparation of a product for guiding administration of children suffering from acute lymphoblastic leukemia.
Preferably, the infant suffering from acute lymphoblastic leukemia is a Chinese Han child, the age is <18 years, and the sex is unlimited; further, the infant is an infant suffering from acute lymphoblastic leukemia, which is treated by 6-MP.
Preferably, the product for guiding the administration of the acute lymphoblastic leukemia infant comprises, but is not limited to, a detection kit, a detection chip, a detection test paper or a detection platform for guiding the administration of the acute lymphoblastic leukemia infant 6-MP.
In a specific embodiment, the detection kit comprises the detection primers of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 and further comprises a 6-TGN content detection reagent in blood.
In a specific embodiment, the detection chip or the detection test paper is loaded with a biochemical reagent capable of hybridizing with the above marker combination, wherein the marker combination is ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133.
According to a fourth aspect of the present invention, there is provided a monitoring system for administration of mercaptopurine to an infant suffering from acute lymphoblastic leukemia, the monitoring system comprising a detection means for detecting an expression level of the marker combination of the first aspect and/or a content of a 6-MP metabolite in a biological sample of a subject, and a result interpretation means for outputting a administration mode of mercaptopurine to the infant suffering from acute lymphoblastic leukemia based on a detection result of the detection means.
Preferably, the detection means detects the expression profile and/or the 6-TGN content of a marker combination in a biological sample of a subject based on the reagent combination of the second aspect; the biological sample is one of serum, plasma, whole blood, blood cells, focal tissue, sputum, pus and urine; in a specific example, the biological sample is peripheral whole blood.
Preferably, the sampling time of the detection means is 3 weeks after the subject has been treated with 6-MP.
Preferably, the result interpretation component comprises an input module, an analysis module and an output module; the input module is used for inputting the expression condition and/or the 6-TGN content of the marker combination; the analysis module is used for analyzing the medication risk of the mercaptopurine of the children suffering from the acute lymphoblastic leukemia, and the output module is used for outputting the judgment result of the analysis module.
The invention provides a monitoring system or a monitoring method for the medication of mercaptopurine of children suffering from acute lymphoblastic leukemia, which specifically comprises any one of the following modes:
(1) Based on the gene polymorphism of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133, predicting the risk of 6-MP hematotoxicity of the children suffering from acute lymphoblastic leukemia;
(2) Predicting the risk of developing 6-MP hematological toxicity in the infant based on the concentration of 6-TGN in the blood of the infant suffering from acute lymphoblastic leukemia;
(3) The risk of occurrence of 6-MP poor metabolism is predicted by combining the gene polymorphism of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 and the concentration of 6-TGN in blood of children patients.
Further, the analysis module analyzes the risk of the mercaptopurine medication as follows: detecting the gene polymorphism of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 by PCR and HPLC respectively, and analyzing the SNP mutation number;
and/or detecting the 6-TGN concentration and comparing with a threshold concentration.
Further, the output module outputs the following results: one or more mutations in the gene polymorphisms ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133, and/or 6-TGN concentrations exceeding 197.5 pmol/8X10 8 Above RBCs, the risk of adverse reactions of 6-MP in ALL children of Chinese Han nationality is increased obviously.
In a fifth aspect of the invention, a method for the personalized treatment of the mercaptopurine of the acute lymphoblastic leukemia patient based on gene polymorphism and blood concentration monitoring is provided, and the treatment method comprises the steps of collecting peripheral blood of the patient taking the mercaptopurine of the acute lymphoblastic leukemia patient, and detecting the expression condition of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293, MTHFR rs1801133 and/or the content of 6-TGN in the peripheral blood.
Preferably, the occurrence of mutation in the four SNP sites means that the risk of adverse reaction of 6-MP is increased, and the more the mutation sites are, the greater the risk of adverse reaction is.
Preferably, when the content of 6-TGN in the peripheral blood reaches 197.5pmol/8×10 8 Above RBCs, meaning a higher risk of developing hematological toxicity, the dosage should be appropriately reduced.
The beneficial effects of one or more of the technical schemes are as follows:
the method and the system for the personalized treatment of the mercaptopurine of the children suffering from the acute lymphoblastic leukemia based on the gene polymorphism and the blood concentration monitoring are a medication guidance system established for patients suffering from the acute lymphoblastic leukemia in China, and compared with the traditional scheme, the scheme of the invention has the advantages of stronger pertinence to target groups, accurate treatment, remarkable effect and the like.
The invention establishes the 6-TGN concentration threshold for predicting the 6-MP hematotoxicity in the ALL children patients in China, clearly determines the gene polymorphism related to the 6-MP adverse reaction and metabolism, and is beneficial to predicting the risk of the 6-MP adverse reaction early by carrying out type screening on the related genes of the children patients before the 6-MP treatment is given and carrying out concentration monitoring on the 6-MP metabolite in the treatment, thereby reducing or avoiding the occurrence of the adverse reaction.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.
FIG. 1 is a 6-TG and 6-MeMP standard curves described in example 1;
wherein FIG. 1A is a typical operating curve for 6-TG;
FIG. 1B is a typical operating curve for 6-MeMP;
FIG. 2 is a graph showing the threshold concentration and validation of 6-TGN predictive 6-MP hematological toxicity in children with ALL in China as described in example 1;
wherein FIG. 2A shows the results of 6-TGN concentration detection in peripheral blood of a patient;
FIG. 2B is a graph showing the correlation of the dose of ALL pediatric 6-MP with the concentration of 6-TGN.
Detailed Description
It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.
In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.
EXAMPLE 1 establishment of Gene polymorphism detection System
1. Polymorphic site selection:
the invention comprehensively considers the genotype characteristics of Asian population and selects the corresponding polymorphic sites. The 6-MP tolerance dose of the Asian population is obviously lower than that of the European african region, the occurrence rate of adverse reactions is not low, but the mutation frequency of the TPMT is far less than 5% -10% of that of the European african region, and the like, which means that other genes closely related to the 6-MP metabolism possibly exist in the Asian population. NUDT15 (c.415 c)>The mutation frequency of the T) gene in Asian population is 8.5% -16% and far higher than that of TPMT, and the poor tolerance of the Asian population to 6-MP is probably related to the T). Research in Taiwan region shows that NUDT15 wild type and heterozygous and homozygous mutant ALL infants can tolerate 6-MP doses of (44.1+ -15.3) mg/m respectively 2 、(30.7±11.7)mg/m 2 、(9.4±5.7)mg/m 2 (P<0.001 Individuals with homozygous mutations tolerate less than the standard dose (60 mg/m) 2 ) The dose of heterozygous mutations was around 50%. The results of the Japanese, thailand, india and other studies are similar. NUDT15 gene mutation carriers are more prone to granulocyte deficiency, and the occurrence risk tends to increase with the use time of mercaptopurine. In addition, TPMT and NUDT15 may have synergistic effect in affecting mercaptopurine tolerance, and the sensitivity of any heterozygous mutant of the gene to mercaptopurine is improved, and the dosage needs to be reduced by more than 50%; the mercaptopurine tolerance dose of individuals who have both TPMT, NUDT15 heterozygous mutations is lower than those who have only one mutation. Inosine triphosphate pyrophosphatase (inosine triphosphate pyrophosphatase, ITPA) is widely available to various tissue organ functions in the body, and hydrolyzable inosine triphosphate (inosine triphosphate, ITP) is inosine monophosphate (inosine monophosphate, IMP). During the metabolic process of mercaptopurine, ITPA can hydrolyze 6-TITP to 6-TIMP, and accumulation of toxic product 6-TITP is avoided. ITPA gene is located on chromosome 20, its variation is more common in Asian population,the frequency is 11% -19%, and the white seed is only 1% -2%. The ITPA gene mutation has mainly 4 sites: c.94C>A、IVS2+21A>C、c.138G>A、IVS3+101G>A, all can cause the activity of ITPA enzyme to be reduced, especially c.94C>The heterozygous mutant of A had only 22.5% residual enzyme activity, and pure and mutant had almost no enzyme activity. Individuals with low ITPA enzyme activity are more prone to granulocytopenia, liver damage, or influenza-like symptoms, rashes, fever, and the like. Even if the mercaptopurine administration is regulated according to TPMT, the risk of occurrence of neutropenia with fever in persons lacking ITPA enzymatic activity is still relatively high. On the other hand, impaired liver function due to low ITPA activity may be associated with an increase in the methylated metabolite 6-MMPN. In contrast, the studies showed that the wild type of TPMT with ITPA had the highest concentration of 6-MMPN, and the wild type of TPMT had the lowest concentration. It is suggested that liver damage may occur as a result of decreased ITPA activity leading to accumulation of the metabolite 6-TITP, which in turn is able to produce 6-MMPN, which in turn affects liver function. Methylene tetrahydrofolate reductase (MTHFR) reduces 5, 10-methylene tetrahydrofolate to 5-methyl tetrahydrofolate, which forms methionine and SAM together with homocysteine. Reduced MTHFR enzyme activity can lead to reduced SAM production, thereby affecting TPMT activity and stability. MTHFR is located on chromosome 1 and is associated with mercaptopurine metabolism primarily by two mutations: c.677C>T (Ala 222 Val) and c.1298A>C (Glu 429 Ala), carrying c.677C>T-changers are more susceptible to cytopenia and interruption of medication, but the dose of mercaptopurine tolerance is not significantly different for different gene mutants.
Based on the above comprehensive consideration, the genes with allele mutation frequencies <0.01 in the Chinese population or the east Asia population are simultaneously excluded, and the following 11 sites are finally selected for preparing a polymorphism detection system for subsequent experiments in the embodiment, and the following table is detailed below:
TABLE 1 Gene loci selected from the group consisting of those associated with adverse 6-MP reactions and metabolism
Figure BDA0003749042450000081
2. Primer sequence design optimization:
in view of the fact that Massary detection is a multiplex PCR amplification-based reaction, primer combinations must avoid problems such as cross amplification, preferential amplification, and non-specificity, and therefore, primer design of the reaction system needs to be obtained through a large number of optimization experiments.
According to the invention, related parameters are adjusted through primer design software (Assay Design Suite) of a Massary ARRAY website, the primary design of PCR primers and UEP primers of 11 sites is completed, and the primer set is further optimized and screened through performance test. After screening and optimizing, the optimal PCR primer combination finally determined by the invention is shown in the following table 2:
TABLE 2
Figure BDA0003749042450000082
/>
Figure BDA0003749042450000091
Detailed UEP primer information is given in table 3 below:
TABLE 3 Table 3
Figure BDA0003749042450000092
/>
Figure BDA0003749042450000101
3. The primer MIX formulation was as follows:
2000g of dry powder of PCR primer (PAGE pure) and UEP primer (PAGE pure) is centrifuged for 5min; adding water for full dissolution, wherein the working concentration of the PCR primer is 100 mu M, and the working concentration of the UEP primer is 500 mu M; PCR primer Mix was prepared as follows in table 4:
TABLE 4 Table 4
Figure BDA0003749042450000102
UEP primer mix was formulated as follows in table 5:
TABLE 5
Figure BDA0003749042450000103
/>
Figure BDA0003749042450000111
Evenly mixing the 5-6 grades of the Vortext instrument for 30 seconds; storing at 4deg.C for 2 weeks, and storing at over 2 weeks-20deg.C; if the preparation amount is large at one time, the primer can be stored after subpackaging, and the freezing and thawing of each primer should not exceed 3 times.
4. The detection method comprises the following steps:
4.1 sample extraction and quantification
4.1.1 preparation before experiment: proteinase K: adding the protein solution into a tube of protease lyophilized powder, shaking, mixing, and storing at 2-8deg.C in refrigerator for 12 months.
4.1.2 sample extraction: a1.5 ml centrifuge tube was prepared and labeled as the number of samples. Mu.l of proteinase K was added to each 1.5ml centrifuge tube, 200. Mu.l of whole blood samples were added in the corresponding order and vortexed. Then 200. Mu.l AL was added to the homogenized centrifuge tube and incubated by vortexing. The sample was removed from the metal bath, the droplets on the tube cap were recovered by instantaneous centrifugation, then 200 μl absolute ethanol was added, vortexed, and centrifuged instantaneously. Transferring the mixed solution obtained in the above steps into an adsorption column in a 2ml collecting pipe, marking, centrifuging in a centrifuge at 12000g for 1min, and discarding the filtrate and the collecting pipe. The column was transferred to a fresh collection tube, 500. Mu.l AW1 was added, and the mixture was placed in a centrifuge for 1min with 12000 g. The waste liquid was discarded. 500 μl AW2 was added, and the mixture was centrifuged at 17000g for 3min in a centrifuge, and the collection tube containing the waste liquid was discarded. The column was transferred to a fresh collection tube and placed in a centrifuge for 1min at 17000g, taking care that all wash liquid had entered the collection tube. The adsorption was transferred to a labeled 1.5ml low adsorption centrifuge tube. 60 μl of enzyme-free water was suspended in the center of the filter membrane, incubated at room temperature for 1min, placed in a centrifuge, and centrifuged at 12000g for 1min at room temperature to collect 60 μl of DNA solution.
4.1.3 sample quantification: the DNA solution was quantified according to the Nanodrop instrument instructions.
4.2 amplification, digestion and extension:
4.2.1 amplification: primers, amplification enzymes, dNTP Mix and MgCl are added between reagent storage and preparation 2 The PCR amplification reagent is prepared by mixing water according to a certain proportion, the preparation method of a single sample PCR amplification system is as follows, and the specific preparation amount can be correspondingly enlarged according to the detection sample amount. The details are given in table 6 below:
TABLE 6
Figure BDA0003749042450000121
The corresponding template was added to the sample preparation chamber, 2. Mu.L of DNA per well, and centrifuged at 2272g for 1min using a plate-type cryocentrifuge. The PCR plates were placed in a PCR instrument for PCR amplification according to the amplification procedure of table 7 below:
TABLE 7
Figure BDA0003749042450000122
4.2.2 shrimp alkaline phosphatase digestion reaction (SAP) the shrimp alkaline phosphatase digestion reagent is prepared from SAP Buffer, SAP Enzyme and water in a certain proportion between reagent storage and preparation, and the preparation method is a single sample shrimp alkaline phosphatase digestion reagent preparation method, and the specific preparation amount can be correspondingly enlarged according to the detection sample amount. The details are given in table 8 below:
TABLE 8
Figure BDA0003749042450000123
Figure BDA0003749042450000131
And (3) uniformly mixing 5-6 grades of the Vortext instrument for 15-30 seconds, performing instantaneous separation, and transferring to a PCR amplification room. After the PCR reaction is completed, taking out the PCR plate, and centrifuging 2272g of the plate-type low-temperature centrifuge for 1 minute; the corresponding shrimp alkaline phosphatase digestion reagent was added between PCR amplifications at 2. Mu.L per well using a plate seal membrane seal, plate type cryocentrifuge 2272g was centrifuged for 1min. Between PCR amplifications, the PCR plate was placed in a PCR instrument for the following reactions:
TABLE 9
Figure BDA0003749042450000132
4.2.3 Single base extension reactions
The preparation method of the single-sample single-base extension reaction system comprises the steps of preparing the single-base extension reaction system from the iPLEX Buffer, iPLEX Termination mix, extend Primer Mix, the iPLEX Enzyme and water according to a certain proportion, wherein the specific preparation amount can be correspondingly enlarged according to the detection sample amount. The details are given in table 10 below:
table 10
Figure BDA0003749042450000133
After the SAP reaction is completed, taking out the PCR plate, and centrifuging 2272g of the plate-type low-temperature centrifuge for 1 minute; a corresponding single base extension reaction system was added between PCR amplifications, 2. Mu.L per well, and the plate was centrifuged at 2272g for 1min using a plate seal membrane seal. The PCR plate was placed into a PCR instrument for the following thermal cycles:
TABLE 11
Figure BDA0003749042450000141
4.3 Mass Spectrometry detection
Detection was performed using massarray nucleic acid mass spectrometry.
EXAMPLE 2 establishment of blood concentration detection System
1. Method for analyzing drug concentration of 6-TGN and 6-MMPN of 6-MP metabolite in erythrocytes
The 6-TGN and 6-MMPN drug concentrations of the 6-MP metabolites in erythrocytes were determined by High performance liquid chromatography (High-performance liquid chromatography, HPLC). The 6-TGN comprises 6-TGMP, 6-TGDP and 6-TGTP, the 6-MMPN comprises 6-meTIMP, 6-meTIDP and 6-meTITP, and the 6-TGN and 6-MMPN are heated and hydrolyzed under the acidic condition at 100 ℃ to respectively generate 6-TG and 6-MeMP, so that the 6-TG and 6-MeMP concentration can be directly converted into the 6-TGN and 6-MMPN concentration by HPLC detection. 2. Preparation of standard curve and quality control sample
1) Preparation of stock solution
a. 10.4mg of 6-methyl mercaptopurine (6-MeMP) is precisely weighed into a 10mL volumetric flask, 3-5 drops of 32% sodium bicarbonate are added dropwise, a stock solution with the concentration of 1mg/mL is prepared by using a methanol solvent, and the stock solution is stored at the temperature of-20 ℃ for standby. b. 10.2mg of 6-thioguanine (6-TG) is precisely weighed into a 10mL volumetric flask, 3 to 5 drops of 32 percent sodium bicarbonate are added dropwise, a stock solution with the concentration of 1mg/mL is prepared by using a methanol solvent, and the stock solution is stored at the temperature of minus 20 ℃ for standby.
2) Preparation of standard series solutions
Precisely measuring a proper amount of 6-MeMP and 6-TG stock solution, and diluting the stock solution with deionized water to obtain a series of working solutions. mu.L of 6-MeMP (1 mg/mL) was diluted to 10. Mu.g/L (MP 1) with 1980. Mu.L of deionized water, and 100. Mu.L of MP1 (10. Mu.g/L) was diluted to 1. Mu.g/L (MP 2) with 900. Mu.L of deionized water. mu.L of 6-TG (1 mg/mL) was diluted to 10. Mu.g/L (TG 1) with 1980. Mu.L of deionized water, and 100. Mu.L of TG1 (10. Mu.g/L) was diluted to 1. Mu.g/L (TG 2) with 900. Mu.L of deionized water. MP2 was formulated as standard solutions at concentrations of 100, 200, 500, 1000, 2000 and 4000ng/mL, and TG2 was formulated as standard solutions at concentrations of 25, 50, 100, 250, 500 and 1000 ng/mL. Standard solutions and quality controls were prepared as in table 12 below.
Table 12 standard solution formulation table
Figure BDA0003749042450000151
Table 13 quality control sample point formulation table
Figure BDA0003749042450000152
3) Standard curve and quality control sample processing
Adding standard starter 1-6 and quality control QC into the above materials in the order of table, sufficiently swirling, centrifuging at 4,000rpm for 10min, collecting supernatant, heating in water bath at 100deg.C for 90min, collecting supernatant, centrifuging at 4,000rpm for 5min, and collecting supernatant in sample injection bottle.
3. Clinical sample processing
1. Blood sample processing
1) mu.L of whole blood was aspirated, 980. Mu.L of physiological saline was added, and the mixture was homogenized, 50. Mu.L of physiological saline was aspirated, 950. Mu.L of physiological saline was added, and red blood cells were counted. 2) The remaining samples were split into two halves, centrifuged at 4,000rpm for 10min, the supernatant was aspirated, and one frozen. The other part was added with an equal volume of physiological saline, mixed well, centrifuged at 4,000rpm for 5min, and repeated 2 times. 3) 100. Mu.L of blood cells were aspirated, 65. Mu.L of DTT was added, and vortexed for 1min. 735 μl of water was added and vortexed for 1min. Adding 100 μl of perchloric acid, sufficiently swirling, centrifuging at 4,000rpm for 10min, collecting supernatant, heating at 100deg.C for 90min, collecting supernatant, centrifuging at 4,000rpm for 5min, and collecting supernatant in sample bottle.
2. Preparation of mobile phases
Weigh 2.72g KH 2 PO 4 Dissolving in 1000mL of water to obtain 0.02M KH solution 2 PO 4 Adding phosphoric acid to adjust the pH to 3.50.
3. Chromatographic conditions
Chromatographic column: shimadzu C18 mm x 4.6mm x 5um
Pre-column: shimadzu C18, cartridge Guard Pre-column 10mm x 4.6mm x 5um
Column temperature: 20 DEG C
Wavelength: 304. 342nm
Sample injection volume: 50uL
Injector temperature: room temperature
Run time: 30min
Flow rate: 1.1mL/min
Mobile phase gradient conditions:
TABLE 14
Figure BDA0003749042450000161
Phase A: 0.02M KH 2 PO 4 The method comprises the steps of carrying out a first treatment on the surface of the And B phase: methanol
4. Standard curve and linear range
Taking 20 mu L of blank red blood cells, preparing standard solution according to the above, and operating according to the item of clinical sample treatment to establish a working curve. And (3) taking the concentration of the object to be detected as an abscissa, taking the peak area of the chromatogram of the object to be detected as an ordinate, and carrying out regression operation by using a least square method to obtain a linear regression equation, namely a working curve. Typical working curves for 6-TG and 6-MeMP are y=111.2xx-1328 (R 2 = 0.9991) and y=163.7 x-392.7 (R 2 =0.9998) (fig. 1). Standard curves of 6-TG and 6-MeMP are in the range of 25.0-1000.0ng/mL and 1000.0-4000.0ng/mL, respectively, and the coefficients of variation between day and day are<10％。
5. Sample measurement
A working curve was prepared for each analytical batch (same sample tested in one day) and quality control samples (40/300, 400/180, 750/3000 ng/mL) were prepared at three concentrations of low, medium, and high 6-MeMP/6-TG, operating under the "clinical sample handling" protocol. The quality control sample amount is not less than 5% of the total amount of samples in each analysis batch. Unifying red blood cell units in blood to 8×10 8 The concentration units of 6-MMPN and 6-TGN obtained by analysis are pmol/8×10 8 /L RBCs。
EXAMPLE 3 Single-Point study
This example conducted a single-site study of 6-MP adverse reactions. The study included ALL pediatric patients receiving 6-MP treatment during the period 2016 to 2018. ALL patients were treated with CCCG-ALL 2015 treatment regimen, maintenance treatment included oral 6-MP for more than 4 weeks and completed a treatment cycle of >6 months. Pediatric patients meeting inclusion criteria were screened for participation in the study. The adverse reaction ranking was determined according to guidelines in adverse event general term standard version 4.0. When the patient experiences an adverse effect, the adverse effect disappears after the dose is reduced or 6-MP is disabled.
Example 4 evaluation of Gene polymorphism related to adverse reaction caused by 6-MP or thiopurine metabolism based on nucleic acid Mass Spectrometry
Pharmacogenomics of 6-MP adverse reactions has been widely studied. However, since the Chinese ALL children patients have higher occurrence rate of 6-MP adverse reaction and the 6-MP drug genome has larger variation in different ethnicities, there is a knowledge defect in the research of the 6-MP pharmacogenomics of the Chinese ALL children patients, and it is necessary to determine the influence of the 6-MP drug genome on the Chinese ALL children 6-MP adverse reaction through clinical research.
The present example is based on the gene polymorphism detection system of example 1, evaluating the single-site study clinical sample of example 3, and single-factor analysis of the correlation of gene polymorphism with 6-MP metabolites 6-TGN and 6-MMPN, and the results show that the concentration of 6-TGN in ALL infant erythrocytes carrying ITPA rs1127354 mutation is significantly higher than that of wild-type infant (P=0.035); the concentration of 6-MMPN in ALL infant erythrocytes harboring the MTHFR rs1801133 mutation was significantly higher than that of wild-type infant (p=0.025). In addition, correlation of gene polymorphism and 6-MP adverse reaction was also analyzed, and analysis results showed that 4 SNPs (ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs 1801133) were closely correlated with adverse reaction caused by 6-MP (see Table 15 and Table 16). When one or more of the sites are mutated, the risk of adverse 6-MP reactions will increase significantly.
TABLE 15 single factor analysis of Gene polymorphism associated with 6-MP hematotoxicity
Figure BDA0003749042450000181
Note that: BSA: body surface area; 6-TGN: 6-thioguanine nucleotide; 6-MMPN: 6-methyl mercaptopurine nucleotide; TPMT: thiopurine S-methyltransferase; NUDT15: nucleoside diphosphate linker moiety X motif 15; ITPA: inosine triphosphate pyrophosphatase; IMPDH1: inosine monophosphate dehydrogenase 1.
TABLE 16 single factor analysis of Gene polymorphism associated with 6-MP hepatotoxicity
Figure BDA0003749042450000182
/>
Figure BDA0003749042450000191
Note that: BSA: body surface area; 6-TGN: 6-thioguanine nucleotide; 6-MMPN: 6-methyl mercaptopurine nucleotide; TPMT: thiopurine S-methyltransferase; NUDT15: nucleoside diphosphate linker moiety X motif 15; ITPA: inosine triphosphate pyrophosphatase; IMPDH1: inosine monophosphate dehydrogenase 1; MTHFR: methylene tetrahydrofolate reductase.
Example 5 evaluation of adverse reactions caused by 6-MP based on blood concentration detection System
The 6-MP reached a steady concentration within 2-4 weeks in the patient, so that samples were taken after the patient had been continuously treated with the same dose of 6-MP for at least 3 weeks, and if the dose of 6-MP was adjusted according to clinical need within 3 weeks, the duration of treatment was recalculated from the dose adjustment day.
This example is based on a single-site study of 6-MP adverse effects described in example 3, and the concentration of 6-MP metabolite 6-TGN was detected in collected peripheral blood of patients using HPLC detection method. ROC curve analysis is performed on the detected concentration data and the clinical outcome of the adverse reaction of the patient, and a 6-TGN concentration threshold for predicting the occurrence risk of the adverse reaction of 6-MP is determined in children patients with ALL in China. The 6-TGN concentration threshold of children patients with Chinese ALL is 175.0-245.1 pmol/8X10 8 In RBCs, the most preferred range is 197.50 pmol/8X10 8 In RBCs, the sensitivity for predicting the risk of leukopenia was 66.67%, the specificity was 72.73%, and the area under the curve AUC was 0.68 (fig. 2A). Based on the obtained 6-TGN concentration threshold, the accuracy of predicting the positive and negative rates of hematologic toxicity in children patients in ALL in china was 82.35% and 69.23%.
Based on the results, the invention adjusts the initial administration dose of 6-MP according to the gene polymorphism by multi-center clinical random control study, and under the condition of ensuring curative effect, the incidence rate of 6-MP blood toxicity of Chinese ALL children is reduced from 52.3% to 25.0%, and 197.5pm in Chinese ALL childrenol/8×10 8 The 6-TGN threshold of RBC could better predict the risk of 6-MP hematotoxicity occurrence (FIG. 2B).
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A marker combination for a mercaptopurine medication monitoring system of an infant suffering from acute lymphoblastic leukemia, wherein the marker is selected from the group consisting of DROSHA, GSTP1, IMPDH1, NUDT15, MTHFR, SLC19A1, ITPA, TPMT; the number of the markers in the combination is 2-8, further 3-6, and still further 4-5; specifically, the number is 4.
2. The marker combination according to claim 1, wherein the biochemical marker comprises the expression level of the gene or protein and the expression level of the SNP site located in the gene sequence; the SNP loci comprise rs639174 in a DROSHA gene, rs1695 in a GSTP1 gene, rs2278293 in an IMPDH1 gene, rs116855232 in a NUDT15 gene, rs1801133 in an MTHFR gene, rs1051266 in an SLC19A1 gene, rs1127354 in an ITPA gene, rs1142345, rs1800460, rs1800462 or rs1800584 in a TPMT gene;
further, the marker combinations are ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133.
3. A combination of reagents for use in a monitoring system for the administration of mercaptopurine to infants suffering from acute lymphoblastic leukemia, said combination of reagents comprising a detection reagent for detecting a marker combination according to claim 1 or 2.
4. The reagent combination according to claim 3, wherein the reagents for detecting the marker combination include, but are not limited to, detection reagents, instruments and detection platforms involved in detection based on sequencing methods, taqMan probe methods, PCR amplification methods, analytical beacon methods, high resolution melting curve methods, CAPS methods, SNaPshot methods, KASP methods, mass spectrometry methods; specific examples of the detection reagent are detection primers, probes, antibodies, amplification enzymes, amplification systems, dNTPs; specific examples of such devices are chips or dipsticks;
in a specific embodiment of the invention, a primer combination for detecting ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 is provided, wherein the primer combination comprises an amplification primer and an extension primer, the sequence of the amplification primer is shown as SEQ ID NO. 1-8, and the sequence of the extension primer is shown as SEQ ID NO. 9-12.
5. The combination of reagents according to claim 3, further comprising reagents for detecting the level of 6-MP metabolites in blood;
preferably, the 6-MP metabolites are 6-TGN, 6-MMPN, or 6-TG and 6-MeMP;
preferably, the reagent for detecting the content of the 6-MP metabolite is a reagent related to detection based on a chromatographic method, and comprises a reagent for treating a blood sample and a chromatographic detection mobile phase.
6. Use of the detection reagent of the marker combination according to claim 1 or 2, or the reagent combination according to any one of claims 3 to 5 for the preparation of a product for guiding administration of a drug to an infant suffering from acute lymphoblastic leukemia or a monitoring system for administration of mercaptopurine to an infant suffering from acute lymphoblastic leukemia.
7. The detection reagent of the marker combination according to claim 6, and the application of the reagent combination in preparing a product for guiding the administration of the acute lymphoblastic leukemia patient, wherein the acute lymphoblastic leukemia patient is a Chinese Han child, and the age is <18 years, and the sex is unlimited; further, the method is used for treating the children suffering from acute lymphoblastic leukemia by adopting 6-MP;
preferably, the product for guiding the administration of the acute lymphoblastic leukemia infant comprises, but is not limited to, a detection kit, a detection chip, a detection test paper or a detection platform for guiding the administration of the acute lymphoblastic leukemia infant 6-MP;
further, the detection kit comprises detection primers of SEQ ID NO. 1-12 and a 6-TGN content detection reagent in blood;
furthermore, the detection chip or the detection test paper is loaded with a biochemical reagent capable of hybridizing with the marker combination, wherein the marker combination is ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133.
8. The monitoring system is characterized by comprising a detection component and a result interpretation component, wherein the detection component is used for detecting the expression level of the marker combination of claim 1 or 2 and/or the content of 6-MP metabolites in a biological sample of a subject, and the result interpretation component outputs the mercaptopurine administration mode of the infant suffering from the acute lymphoblastic leukemia according to the detection result of the detection component.
9. The medication monitoring system for mercaptopurine for children suffering from acute lymphoblastic leukemia according to claim 8, wherein said detection means detects the expression of a marker combination and/or the 6-TGN content in a biological sample of a subject based on the combination of reagents according to any one of claims 3 to 5; the biological sample is one of serum, plasma, whole blood, blood cells, focal tissue, sputum, pus and urine; in a specific example, the biological sample is peripheral whole blood;
preferably, the sampling time of the detection member is 3 weeks after the subject is continuously treated with 6-MP;
preferably, the result interpretation component comprises an input module, an analysis module and an output module; the input module is used for inputting the expression condition and/or the 6-TGN content of the marker combination; the analysis module is used for analyzing the medication risk of the mercaptopurine of the children suffering from the acute lymphoblastic leukemia, and the output module is used for outputting the judgment result of the analysis module;
preferably, in the monitoring system or the monitoring method for the medication of the mercaptopurine of the children suffering from the acute lymphoblastic leukemia, the monitoring system or the monitoring method specifically comprises any one of the following modes:
(1) Based on the gene polymorphism of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133, predicting the risk of 6-MP hematotoxicity of the children suffering from acute lymphoblastic leukemia;
(2) Predicting the risk of developing 6-MP hematological toxicity in the infant based on the concentration of 6-TGN in the blood of the infant suffering from acute lymphoblastic leukemia;
(3) The risk of occurrence of 6-MP poor metabolism is predicted by combining the gene polymorphism of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293 and MTHFR rs1801133 and the concentration of 6-TGN in blood of children.
10. The method for personalized treatment of the mercaptopurine of the children patients suffering from the acute lymphoblastic leukemia based on gene polymorphism and blood concentration monitoring is characterized by comprising the steps of collecting peripheral blood of the patients taking the mercaptopurine of the children patients suffering from the acute lymphoblastic leukemia, and detecting the expression conditions of ITPA rs1127354, NUDT15 rs116855232, IMPDH1 rs2278293, MTHFR rs1801133 and/or the content of 6-TGN in the peripheral blood;
preferably, the occurrence of mutation in the four SNP sites means that the risk of adverse reaction of 6-MP is increased, and the more the mutation sites are, the greater the risk of adverse reaction is;
preferably, the 6-TGN content in the peripheral blood is up to 197.5 pmol/8X10 8 Above RBCs, meaning a higher risk of developing hematological toxicity, the dosage should be appropriately reduced.
CN202210832718.1A 2022-07-15 2022-07-15 Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia Pending CN116064787A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210832718.1A CN116064787A (en) 2022-07-15 2022-07-15 Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210832718.1A CN116064787A (en) 2022-07-15 2022-07-15 Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia

Publications (1)

Publication Number Publication Date
CN116064787A true CN116064787A (en) 2023-05-05

Family

ID=86179211

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210832718.1A Pending CN116064787A (en) 2022-07-15 2022-07-15 Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia

Country Status (1)

Country Link
CN (1) CN116064787A (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YUE ZHOU ETAL.: "Precision therapy of 6-mercaptopurine in Chinese children with acute lymphoblastic leukaemia", 《BR J CLIN PHARMACOL》, vol. 86, no. 8, pages 2 *

Similar Documents

Publication Publication Date Title
Yen et al. Should DPD analysis be required prior to prescribing fluoropyrimidines?
Amstutz et al. Dihydropyrimidine dehydrogenase gene as a major predictor of severe 5-fluorouracil toxicity
Ganz et al. Genetic impairments in folate enzymes increase dependence on dietary choline for phosphatidylcholine production at the expense of betaine synthesis
CN110093413A (en) Detect the primer sets and kit of beta Thalassemia
Armstrong et al. Analytic aspects of monitoring therapy with thiopurine medications
Burgis A disease spectrum for ITPA variation: advances in biochemical and clinical research
Lv et al. Genetic polymorphisms of TYMS, MTHFR, ATIC, MTR, and MTRR are related to the outcome of methotrexate therapy for rheumatoid arthritis in a Chinese population
CN108504730A (en) MMACHC, MTHFR gene mutation detection kit
Suriyaprom et al. Associations of resistin levels with resistin gene polymorphism and metabolic syndrome in Thais
JP4803942B2 (en) Method for detecting thiopurine methyltransferase activity
Etienne-Grimaldi et al. Current diagnostic and clinical issues of screening for dihydropyrimidine dehydrogenase deficiency
Li et al. Expression of the C677T polymorphism of the 5, 10-Methylenetetrahydrofolate Reductase (MTHFR) gene in patients with carotid artery atherosclerosis
CN111235264B (en) Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene
Wong et al. A novel mutation in the mitochondrial tRNASer (AGY) gene associated with mitochondrial myopathy, encephalopathy, and complex I deficiency
EP3101142B1 (en) Method and device for assisting diagnosis of efficacy of methotrexate in patient with rheumatoid arthritis
CN116064787A (en) Drug monitoring system for mercaptopurine of children suffering from acute lymphoblastic leukemia
Cooke et al. Evidence for attenuated cellular 8-oxo-7, 8-dihydro-2′-deoxyguanosine removal in cancer patients
Tesarova et al. Mitochondrial DNA depletion in Alpers syndrome
Jacomelli et al. Simple non-radiochemical HPLC-linked method for screening for purine metabolism disorders using dried blood spot
Peng et al. A molecular‐beacon‐based asymmetric PCR assay for detecting polymorphisms related to folate metabolism
CN112831556A (en) Kit for detecting MYD88L265P mutation based on AS-PCR and application thereof
CN113528509A (en) Construction method of tumor microenvironment scoring system for predicting gastric cancer immunotherapy and molecular probe
CN112662751A (en) Primer combination, kit and detection method for detecting MTHFR gene polymorphism
Zhang et al. Rapid detection of PAH gene mutations in Chinese people
Bierau et al. Erythrocyte inosine triphosphatase activity is decreased in HIV-seropositive individuals

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination