CN116064651A - Application of rice promoter expressed under regulation of external salt - Google Patents

Abstract

The invention discloses application of a rice promoter regulated and expressed by external salt, belonging to the field of plant genetic engineering. The rice promoter expressed under the control of external salt is the promoter of the OsANT1 gene, and the sequence of the promoter is shown as SEQ ID NO. 1. The invention is found by constructing a promoter-GUS transgenic plant and detecting GUS expression activity, the promoter can be strongly induced by external sodium chloride, and the high expression of downstream genes in rice roots and leaves is promoted. The promoter of the OsANT1 gene is applied to transgenic engineering, can enable plants to resist salt and grow by promoting the absorption and transportation of amino acids, can enable the expression products of target genes to be specifically accumulated in roots and leaves and increase local expression quantity, and therefore has good application prospects in the transgenic engineering.

Description

Application of rice promoter expressed under regulation of external salt

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice promoter regulated and expressed by external salt and application thereof.

Background

Amino acids play a very important role in the plant growth and development process, since amino acids are essential elements of various enzymes and protein synthesis and are precursors of important substances for plant development or nitrogen donors. Amino acids play an important role in stress resistance of plants such as biotic stress and abiotic stress. Aspartic acid is an important center for metabolite biosynthesis and is able to respond to abiotic stress and defenses (Han M, zhang C, suglo P, sun S, wang M, su T.L-Aspartate: an essential metabolite for plant growth and stress interactions, molecules,2021, 26:1887.). Glutamate is able to respond to environmental stresses such as salt, cold, heat, drought, and pathogen stress (Qiu XM, sun YY, ye xy.li zg.signaling role of glutamate in plants, front in plant science,2020, 10:1743.). Altered expression of amino acid transport genes can enhance stress tolerance in plants. Such as increased proline accumulation following increased AtAAP1 expression, helps to improve salt tolerance of Arabidopsis seedlings (Wang T, chen Y, zhang M, chen J, liu J, han H, hua X.Arabidopsis AMINO ACID PERMEASE1 contributes to salt stress-induced proline uptake from exogenous sources. Front in Plant Science,2017, 8:2182.). Knocking out AtAAP3 and AtAAP6 significantly reduced the level of infection of arabidopsis thaliana root-knot nematode (Pariyar SR, nakarmi J, answer MA, siddiique S, ilyas M, elastry a, grundler fm.amino acid permerase 6modulates host response to cyst nematodes in wheat and Arabidopsis.Nematology,2018,20:737-750). Knock-out of the AtLHT1 gene increases resistance of Arabidopsis to a broad spectrum of pathogens (Liu G, ji Y, bhuiyan NH, pilot G, selvaraj G, zou J, wei, Y.Amino acid homeostasis modulates salicylic acid-associated redox status and defense responses in Arabidopsis plant Cell,2010, 22:3845-3863.).

Amino acid transport genes are divided into two families according to their encoded amino acid sequence similarity and amino acid absorption properties: an amino acid/auxin permease (AAAP) family and an amino acid polyamine organic cation (APC) family. AAAP can be further divided into Amino Acid Permeases (AAPs), lysine and Histidine Transporters (LHTs), gamma-aminobutyric acid transporters (GATs), proline transporters (ProTs), indole-3-acetic acid transporters (AUXs), aromatic and neutral amino acid transporters (ANTs) and similar amino acid transporters (ats). The APC family has cationic amino acid transporters (CATs), amino acid/choline transporters (ACTs) and L-amino acid transporters (LATs) (Zhao H, ma H, yu L, wang X, zhao J.genome-wide survey and expression analysis of amino acid transporter gene family in rice (Oryza sativa L.). PLoS One,2012,7 (11): e 49210.). In Arabidopsis, atANT1 mainly transports aromatic and neutral amino acids (Chen L, ortiz-Lopez A, jung A, bush DR.ANT1, an aromatic and neutral amino acid transporter in Arabidopsis plant Physiology,2001,125 (4): 1813-1820.).

More than 80 amino acid transport genes exist in rice, and the research shows that OsAAP6 is expressed in seeds and positively correlated with the protein content of seeds, and influences the rice quality (Peng B, kong H, li Y, wang L, zhong M, sun L, he Y.OsAAP6functions as an important regulator of grain protein content and nutritional quality in rice communication, 2014, 5:4847.). OsAAP3 specifically transports basic and aromatic amino acids (Taylor MR, reindex A, ward JM. Transport function of rice Amino Acid Permeases (AAPs). Plant and Cell Physiology,2015,56 (7): 1355-1363.). Decreasing or knocking out OsAAP3 expression, rice tillering bud elongation accelerates formation of more tillers, increases rice yield and nitrogen use efficiency (Lu K, wu B, wang J, zhu W, nie H, qian J, fang, Z.blocking amino acid transporter OsAAP3 improves grain yield by promoting outgrowth buds and increasing tiller number in rice plant Biotechnology Journal,2018,16 (10): 1710-1722.). OsAAP5 mainly regulates the transport of basic amino acids (lysine, arginine) and neutral amino acids (valine, alanine), and decreasing OsAAP5 expression can lead to rice tillering and increased grain yield (Wang J, wu B, lu K, wei Q, qian J, chen Y, fang Z.the amino acid permease 5 (OsAAP 5) regulates tiller number and grain yield in rice plant Physiology,2019,180 (2): 1031-1045.). Two spliceosomes of OsAAP4 positively regulate rice tillering and yield by regulating neutral amino acid partitioning at different concentrations and through nitrogen metabolism and hormonal pathways (Fang Z, wu B, ji y. The amino acid transporter OsAAP4 contributes to rice tillering and grain yield by regulating neutral amino acid allocation through two splicing derivatives. Rice,2021, 14:2.).

The above shows that various amino acids have important regulation and control effects on plant growth and development, but less research on the regulation and control effects of amino acid transport genes in other aspects is carried out. So far, no report is made on the biological effect of the rice OsANT1 gene and its promoter on rice. The invention discovers that the promoter sequence of the OsANT1 gene can be induced by external salt to promote the high expression of the gene in roots and leaves, can increase the local expression quantity of the target gene at the roots and leaves in the application of genetic engineering, and can strengthen the absorption of amino acid substances from the external environment or the accumulation of the amino acid substances at the roots so as to achieve the effect of salt-tolerant growth.

Disclosure of Invention

The invention aims to solve the problems in the prior art and provides application of a promoter of an OsANT1 gene which is a rice amino acid transporter gene family member and is expressed under the regulation of external salt.

The aim of the invention is achieved by the following technical scheme:

the invention takes a promoter (shown as SEQ ID NO. 1) of an ANT gene family member OsANT1 gene of rice as an object, firstly, a constructed promoter-GUS expression vector is transformed into callus induced by mature embryo of rice through agrobacterium mediation to obtain a transgenic plant, then a positive plant is identified, and then a T1 generation transgenic plant is obtained to obtain a T2 generation mature seed. And then carrying out GUS histochemical staining on root and leaf tissues of plants after salt treatment in the seedling stage of the growth of the T2 generation seeds, measuring GUS expression activity, analyzing the time-space expression specificity of the plants, and providing a new idea for exploring how to regulate and control salt tolerance and growth balance in the future. As a result, the promoter activity is strongly induced by external salts, and the downstream gene is promoted to be specifically expressed in roots and leaves of rice. The promoter is applied to transgenic engineering, can promote the absorption and transportation of amino acid under the induction of external salt, promote the salt-tolerant growth of rice, and can also ensure that the expression product of the target gene under the promoter is specifically accumulated at root and leaf positions to increase the local expression quantity. Therefore, the promoter of the OsANT1 gene has good application prospect in transgenic engineering.

An application of the promoter of OsANT1 gene in paddy rice is that the promoter can promote the high expression of downstream gene in root and leaf of paddy rice under the induction of external salt.

The sequence of the promoter is shown as SEQ ID NO.1, or a DNA sequence which is obtained by substituting, adding and/or deleting one or more nucleotides of the sequence shown as SEQ ID NO.1, does not influence the expression of a downstream gene and has the same function.

The method for realizing the application comprises the following steps: constructing a promoter of the OsANT1 gene, namely an expression vector of a target gene, and introducing the expression vector into rice to obtain transgenic rice, wherein the transgenic rice can promote the expression of the target gene in roots and leaves under the induction of external salt.

The skeleton vector of the expression vector is preferably pCAMBIA-1391Z vector.

The salt induction is NaCl induction, and the concentration of NaCl is preferably 100mM.

The invention discovers that the promoter activity of the OsANT1 gene is induced by external salt, and the promoter can enable the downstream gene to be specifically expressed in roots and leaves of rice under the induction of the salt when being used in transgenic rice, and has good application prospect in transgenic engineering. The invention is of great significance for later exploration of how to promote salt tolerance and growth of rice by absorbing and transporting amino acids.

Drawings

FIG. 1 is a diagram of the identification of transgenic plants with promoter-GUS expression vectors. M in the figure is a DNA size indicator band; 1 is a positive control; lane 2 no band, negative control; each lane 3-17 was tested for T0 promoter-GUS positive plants. It was demonstrated that the promoter-GUS vector had been transferred into the transgenic line in lanes 3-17.

FIG. 2 is a graph showing the promotion of GUS expression activity in roots and leaves of transgenic plants by salt treatment, wherein A is the result of staining before salt treatment of the roots, and B is the result of staining the roots after 2 hours of salt treatment (100 mM NaCl); c is the staining result before salt treatment of the leaf, D is the staining result after salt (100 mM NaCl) treatment for 2 hours. The blue color depth indicates that GUS expression activity is high, and the OsANT1 gene expression amount in 11 flowers and leaves after salt treatment is high. The promoter is expressed under the induction of salt.

FIG. 3 is a graph of microscopic observations of paraffin sections of salt treated transgenic plants after root and leaf staining. A is the slicing result of root staining before salt treatment, and B is the slicing result of root staining after salt treatment; c is the result of the section of the leaf stain before salt treatment, and D is the result of the section of the root leaf stain after salt treatment. Further described is a promoter which is inducible by external salts.

FIG. 4 shows the expression of OsANT1 in roots after salt treatment of 11 seedlings of medium flowers for 2 hours. The gene expression amount of OsANT1 in 11 flowers after salt treatment is high. The promoter is expressed under the induction of salt.

FIG. 5 shows the expression of OsANT1 in leaves after 2h treatment of young flowers of China flowers 11. The gene expression amount of OsANT1 in the leaves of flowers 11 after salt treatment is high. The promoter is expressed under the induction of salt.

Detailed Description

The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated; the experimental methods used are all conventional and can be carried out according to the described recombinant techniques (see molecular cloning, laboratory manual, 2 nd edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.); the materials, reagents, and the like used are all commercially available.

Example 1 construction of promoter-GUS transgenic plant of OsANT1 Gene

DNA of flower 11 in rice was extracted, and after amplifying the promoter sequence (1957 bp) of OsANT1 gene by PCR using amplification primer F (TTAAGCTTATCTTGGCATGGTTCTTT) and amplification primer R (TAGGATCCTTCCAGGGAGGGAGTTAG), the DNA was ligated into pCAMBIA-1391Z vector using BamHI and HindIII cleavage sites to construct promoter-GUS expression vector pOsANT1-p1391Z. The agrobacterium EHA105 mediated genetic transformation method is adopted, and the promoter-GUS expression vector is introduced into the flower 11 in the normal rice variety by transforming the callus induced by the mature embryo of the rice.

Transplanting all transgenic seedlings into a soil-bearing frame, watering periodically, fertilizing, planting in a field when the seedlings grow to about 10cm in height, and detecting T1 generation transgenic plants through PCR after the seedlings grow up. The detection primer pair is as follows:

detection primer F: TTCTTCGCTCCCTTCACC the number of the individual pieces of the plastic,

detection primer R: CGCCAGAGTTTGGGTTGT.

If 433bp fragment is amplified, the transgenic plant is a positive plant. And (5) collecting and planting the single positive plants until the homozygous transgenic plants are identified in the T2 generation.

Example 2 detection of salt-treated promoter-GUS expression Activity of seedlings of transgenic plants

After T2 generation homozygous transgenic plants were treated with salt (100 mM NaCl) during the young seedling period, roots and leaves were GUS stained as follows:

after the successfully identified T2 generation seeds were harvested, they were immersed in water and cultured in a 37 ℃ incubator. And (3) sowing the seeds into a 96-well plate when the buds grow to about 2cm in the seed germination stage, carrying out illumination water culture in a greenhouse, and culturing by replacing rice nutrient solution in the seedling stage, wherein the formula of the rice nutrient solution adopts the components of the conventional nutrient solution of the International research institute. After the seedlings grow to about 10cm, 100mM NaCl is added into the nutrient solution for 2 hours, GUS staining is carried out on the seedlings leaves and roots before and after salt treatment.

The above materials were soaked in GUS staining solution and incubated at 37℃overnight. Then, after 3 times decolorization with 75% alcohol, it was stored at 4 ℃. The materials decolorized by alcohol are observed under a microscope, and the blue part is GUS active expression site. The results are shown in FIG. 2, and GUS activity was found to be blue in roots and leaves after salt treatment. The stained materials are sent to a company for paraffin section and are observed under a microscope for photographing, the result is shown in figure 3, and after the section is found, the cell tissue is more deeply stained after salt treatment, so that the GUS activity is further expressed by salt induction on roots and leaves.

EXAMPLE 3 identification of OsANT1 in flower 11 seedlings of wild japonica variety under salt treatment

Flowers 11 in synchronization with GUS seedlings were subjected to salt treatment and salt (100 mM NaCl) treatment, respectively, to leaf and root extraction of RNA, and reverse transcription into cDNA, and fluorescent quantitative PCR (qRT-PCR) was performed using cDNA as a template, using Taq Pro Universal SYBR qPCR Master Mix fluorescent quantitative enzyme from Norpraise (Beijing). The reaction procedure was as follows: 40 cycles, pre-denaturation at 95℃for 30s, denaturation at 95℃for 10s, annealing at 60℃for 10s, and fluorescence detection. 3 replicates were made for each gene. The quantitative primers for the genes used in this experiment were:

OsActin-F：CGGTGTCATGGTCGGAAT，

OsActin-R：GCTCGTTGTAGAAGGTGT，

used for amplifying the reference gene ACTIN;

q-OsANT1-F：TGATGCACCCAATCCACG，

q-OsANT1-R：CCCGAACGCAGGTATGAA，

is used for amplifying the OsANT1 gene.

As a result, as shown in FIGS. 4 and 5, the amount of OsANT1 gene expression in the roots and leaves of the young flowers 11 before salt treatment was 1, and when salt treatment was carried out for 2 hours, the amount of OsANT1 gene expression in the roots and leaves was increased. In particular, the OsANT1 gene expression amount of medium flower 11 after salt treatment was 63 times that before treatment, indicating that under salt treatment conditions, the expression of the OsANT1 gene was induced.

The result shows that the expression of the promoter of the OsANT1 gene is induced by external salt, and the expression product of the target gene can be specifically accumulated in roots and leaves through the promoter of the OsANT1 gene to increase the local expression quantity, so that the promoter of the OsANT1 gene has good application prospect in transgenic engineering.

It should be understood that the embodiments of the present invention are not limited to the examples described above, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principles of the present invention should be made and all equivalent substitutions are intended to be included in the scope of the present invention.

Claims (6)

1. An application of a promoter of an OsANT1 gene in rice is characterized in that: the application is that the promoter can start the downstream gene to be expressed in the rice root and leaf under the induction of external salt; the sequence of the promoter is shown as SEQ ID NO. 1.

2. The use according to claim 1, characterized in that: the promoter sequence is a DNA sequence which is obtained by substituting, adding and/or deleting one or more nucleotides of the sequence shown in SEQ ID NO.1, does not influence the expression of a downstream gene and has the same function.

3. The use according to claim 1, characterized in that: the method comprises the following steps: constructing a promoter of the OsANT1 gene, namely an expression vector of a target gene, and introducing the expression vector into rice to obtain transgenic rice, wherein the transgenic rice can promote the expression of the target gene in roots and leaves under the induction of external salt.

4. The use according to claim 1, characterized in that: the skeleton carrier of the expression carrier is pCAMBIA-1391Z carrier.

5. The use according to claim 1, characterized in that: the external salt induction is NaCl induction.

6. The use according to claim 5, characterized in that: the concentration of NaCl is 100mM.

Images