CN116064587A

CN116064587A - Rice salt tolerance related OsWRKY18 gene and application thereof in regulation and control of salt tolerance stress

Info

Publication number: CN116064587A
Application number: CN202211397690.XA
Authority: CN
Inventors: 夏继星; 付珊; 李龙英; 刘福航; 彭丽云
Original assignee: Guangxi University
Current assignee: Guangxi University
Priority date: 2022-11-09
Filing date: 2022-11-09
Publication date: 2023-05-05

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an OsWRKY18 gene related to salt tolerance of rice and application thereof in regulation and control of salt tolerance stress. The invention provides a rice salt tolerance related OsWRKY18 gene, and the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1. The OsWRKY18 gene is positioned in a cell nucleus, is mainly expressed in roots and is highly induced by salt, naCl treatment is carried out after a knockout gene mutant is constructed, and the mutant plant is more sensitive to salt stress under the salt treatment condition. After salt treatment, the mutant plants are on the groundNa in partial and xylem sap ⁺ The content is obviously increased, and the OsWRKY18 regulates and controls the Na of the overground part ⁺ Ion transport and expression of related stress genes are involved in tolerance of rice to salt stress.

Description

Rice salt tolerance related OsWRKY18 gene and application thereof in regulation and control of salt tolerance stress

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an OsWRKY18 gene related to salt tolerance of rice and application thereof in regulation and control of salt tolerance stress.

Background

Soil salinization refers to the process of continuously accumulating salt in soil to gradually form salination, and is one of the main environmental constraint factors which endanger soil quality and agricultural productivity. Soil secondary salinization caused by human activities is a major driving factor for the current problem of soil salinization to be continuously aggravated. At present, at least 100 countries in the world have the problem of soil salinization, and the total coverage area of the global salinized soil is 9.322 multiplied by 10 ¹⁴ hm ² . Therefore, how to improve the land utilization rate of the saline-alkali area and the quality and yield of crops becomes one of the problems of high attention of vast expert scholars at home and abroad.

Many genes and different regulatory mechanisms play an important role in the response of plants to abiotic stress. The family of transcription factors such as plant NAC, MYB, WRKY accommodates abiotic stress by regulating the expression of genes downstream thereof. The WRKY transcription factor family has received great attention for its role in dealing with abiotic stresses such as drought, salt and heat stress. In general, the N-terminal proteins of the WRKY family commonly have the highly conserved sequence WRKYGQK, often containing 2 atypical zinc finger domains at the C-terminal, CX4-5CX22-23HXH (C2-H2) or CX7-CX23-HXC (C2 HC). WRKY transcription factors can be divided into three groups (I, II and III) based on the structure of the zinc finger motif and the number of WRKY domains. The WRKY protein family can be further divided into six groups I, IIa, IIb, IIc, IId, IIe and III according to the far-near relationship of the phylogenetic system. WRKY transcription factors have the potential to activate or inhibit downstream gene expression by specifically binding to the W-box motif (TTGACC/T) within their promoters.

WRKY transcription factors play an important role in the salt stress response of different plants. For example, overexpression of AtWRKY74 significantly increases salt stress tolerance in Arabidopsis. In tomato, overexpression of SlWRKY8 enhances plant tolerance to drought and salt stress. Heterologous overexpression of ZmWRKY17 reduced salt stress tolerance and increased sensitivity to ABA in arabidopsis plants, suggesting that ZmWRKY17 may negatively regulate salt stress response through ABA signaling pathways. In wheat, salt and polyethylene glycol (PEG) treatments strongly induce expression of TaWRKY 75-A. In rice, osWRKY50 upregulates salt stress responses through ABA signaling pathways. A recent study shows that OsWRKY87 can improve drought and salt tolerance of rice by directly regulating and controlling the expression of OsABF 1. However, the role of WRKY transcription factors in regulating rice salt stress is still far from clear.

Disclosure of Invention

The invention aims to provide an OsWRKY18 gene related to rice salt tolerance and application thereof in regulation and control of salt tolerance stress, which not only provide new theoretical evidence for research on molecular mechanisms of rice stress resistance, but also provide new target genes or new materials for cultivating new varieties of high-quality salt-tolerant rice (crops).

The invention provides a rice salt tolerance related OsWRKY18 gene, and the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

The invention also provides a rice salt tolerance related OsWRKY18 protein, and the amino acid sequence of the OsWRKY18 protein is shown as SEQ ID NO. 2.

The invention also provides a method for changing the sensitivity of rice to salt stress, and the expression level of the OsWRKY18 gene in the rice genome is regulated, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

Preferably, the adjustment comprises an increase or decrease.

The invention also provides a method for improving salt stress tolerance of rice, which is used for expressing or overexpressing the expression level of the OsWRKY18 gene in a target rice germplasm genome, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

The invention also provides a method for improving sensitivity of rice to salt stress, which reduces the expression level of an OsWRKY18 gene in a target rice germplasm genome, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

The beneficial effects are that: the invention provides a rice salt tolerance related OsWRKY18 gene, and the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1. The OsWRKY18 gene is localized in the nucleus, expressed mainly in roots, and highly induced by salt. In the embodiment of the invention, a CRISPR-Cas9 technology is used for constructing a gene editing mutant plant, two homozygous mutant plants with different mutation sites are screened for carrying out a plant experiment, and the mutant plant is found to be more sensitive to salt stress than the wild type plant under the salt treatment condition by carrying out a NaCl treatment experiment. After salt treatment, the mutant plant has overground part and Na in xylem juice ⁺ Compared with the wild type, the content of the rice gene OsWRKY18 is obviously increased, and the rice gene OsWRKY18 participates in the tolerance of rice to salt stress by regulating the expression of ABA reaction and salt tolerance related genes (OsLEA 3-1, RAB21, SALP1, osHOX22, rePPR2.1 and OsHKT1; 5), thus being a novel gene participating in salt tolerance.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the drawings that are needed in the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a representation of a phylogenetic tree analysis of WRKY transporter proteins in rice and Arabidopsis;

FIG. 2 is a diagram of the OsWRKY18 gene structure and homozygous mutant plant type;

FIG. 3 is a graph showing the expression level of OsWRKY18 in various tissues;

FIG. 4 is a graph showing the effect of treatment time and salt concentration on OsWRKY18 expression level;

FIG. 5 shows the subcellular localization results of OsWRKY18 in rice protoplasts;

FIG. 6 is a graph showing the salt tolerance phenotype and dry weight measurement results of OsWRKY18 mutant plants;

FIG. 7 shows Na under salt stress of OsWRKY18 mutant plants ⁺ And K ⁺ Ion content measurement result diagram;

FIG. 8 is an analysis of the expression of salt stress related genes in wild type and oswrky18-2 (MT) mutants.

Detailed Description

The invention provides a rice salt tolerance related OsWRKY18 gene, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1: ATGGCGTCGCCGCGGCTGAAGAGGGAGCAGTCGTTCGACTTCGAGGAGGCGAGCGCGCAGGAAGCCGTGGGATCCGCGTCGGCGTCGTACAGCCCTCCCGGGGGCGGCGGCGTCTTTGGCATCTCGCCGCCGGAGTCCTCGCCGCGCGACGGCCGGAAGAGAAGGAAGGATAGACCATCATTGGTGAAACATACGTTCACACCTCATTTTGATGGTCATTTGTGGAGGAAGTATGGCCAGAAGAACATCAAGGACTCTGCTTTCCCTAGGTTATATTACAGATGCTCTTACCGTGAGGACAGACAGtgccttgcctccaagctggtgcagcaggagaacgacgacgacccgccactgtacagggtcacctacacgtacgagcacacctgcaacaccaCGCCCGTCCCGACCCCCGACGTCGTGGCCGAGCAGCCGCCGCCGGGCGCCGCCGGCGACGCGTACCTCCTCAGGTTCGGCTCCTCCGCTGGCGGCGGCGGCGGCGGCGCTCATCAGCAGCAGACCGAGCGAGAACGACAGCAGCAAAATACAGCGAGAAGAAGGCCATTCATGATGCTGAGCTTCGATTCTAGTAGCAGCCATCAGCTGCACGAGCAGCCGCACGCGTTCCCTCCCGACGGCCAGCTGCCGGCCACGGCCGCGGCCGCGTCGCCGTCGTCGTTCACGGCAGCCGAGGCGTTGGCGGCGCCGCCGCTCACGACGACGATGAACGACGGAGGCGACCTGTTCTCGACGTGGGACGCGCTCAGGTATGGTTTGGACTATGACCACGGGCACCTTGGTAACCATGTTTATCTCCCTGATGACTGTAATGGTGGTGATGATAATTACTGA.

The amino acid sequence of the OsWRKY18 protein is shown as SEQ ID NO. 2: MASPRLKREQSFDFEEASAQEAVGSASASYSPPGGGGVFGISPPESSPRDGRKRRKDRPSLVKHTFTPHFDGHLWRKYGQKNIKDSAFPRLYYRCSYREDRQCLASKLVQQENDDDPPLYRVTYTYEHTCNTTPVPTPDVVAEQPPPGAAGDAYLLRFGSSAGGGGGGAHQQQTERERQQQNTARRRPFMMLSFDSSSSHQLHEQPHAFPPDGQLPATAAAASPSSFTAAEALAAPPLTTTMNDGGDLFSTWDALRYGLDYDHGHLGNHVYLPDDCNGGDDNY.

In the present invention, subcellular localization analysis showed that OsWRKY18 was localized to the nucleus, the CDS of OsWRKY18 was 852bp in total length, and had 3 exons and 2 introns, and the gene structure diagram thereof was shown in FIG. 2.

The modulation of the present invention preferably includes an increase or decrease, the method of which is not particularly limited by the present invention, and may be performed using methods conventional in the art, such as in the examples by CRISPR-Cas9 technology to construct a knockout mutant.

In the embodiment of the invention, two target targets are selected in an exon region of OsWRKY18, the sequences are TCAAGGACTCTGCTTTCCCT (SEQ ID NO. 3) and ACACGTACGAGCACACCTG (SEQ ID NO. 4) respectively, a pCRISPR-OsWRKY18 plasmid with two specific targets of OsWRKY18 is constructed, a genetic transformation method is utilized to construct a rice gene knockout mutant, and the observation of the characters proves that the OsWRKY18 participates in the salt stress response process of rice.

In order to further illustrate the present invention, the following is a detailed description of OsWRKY18 gene related to rice salt tolerance and application thereof in regulating salt tolerance stress, which are provided by the present invention, with reference to the accompanying drawings and examples, but they are not to be construed as limiting the scope of the present invention.

Example 1

1. Plant material and growth conditions

The materials used in this example were wild type Nippon Rice and two OsWRKY18 mutant plants.

Soaking rice seeds in tap water, germinating in dark at 28deg.C in incubator for 2 days, placing the seeds on a filter screen, and placing the seeds in a culture medium containing 0.5mM CaCl ₂ In a 4L plastic container of deionized waterCulturing was continued at 28℃for 2d. And (5) after the root grows to 2-3 cm, the root is used for subsequent related experiments.

Obtaining the complete sequence of OsWRKY18 gene and constructing the evolutionary tree

To obtain the CDS sequence of OsWRKY18, total RNA was extracted from rice roots using Trizol kit (Life technologies) according to the instructions of the product. 1 μg of total RNA was used to synthesize the first strand of cDNA using the Hiscript II Q RT SuperMix Kit (Vazyme) synthesis kit. The obtained cDNA was used as a template to obtain the full sequence of OsWRKY18 in the following different experiments.

The phylogenetic tree of WRKY family proteins in rice and Arabidopsis is mainly downloaded with the full-length amino acid sequences of this family via TAIR (https:// www.arabidopsis.org /) and NCBI (www.ncbi.nlm.nih.gov). Then, the construction of the phylogenetic tree was performed by the proximity method using MEGA6 software (fig. 1).

OsWRKY18 mutant plant construction

The total length of CDS of OsWRKY18 gene (SEQ ID NO. 1) is 852bp, which has 3 exons and 2 introns, and the gene structure diagram is shown in FIG. 2.

Mutant plants of the OsWRKY18 gene were constructed using the CRISPR-Cas9 genome editing system. Firstly, two target targets are selected in an exon region of OsWRKY18, the sequences of target 1 and target 2 are SEQ ID NO.3 and SEQ ID NO.4 respectively, two expression cassettes Pu6 a-target 1-sgRNA and Pu6 b-target 2-sgRNA connected with sgRNA are obtained through overlapping PCR, and the two expression cassettes are connected onto a pYLCRISPR/Cas9Pubi-H vector by utilizing the characteristic that cleavage sites and recognition sites of Bsa I enzyme are not overlapped, so that a pCRISPR-OsWRKY18 vector containing OsWRKY18 specific target 1 and target 2 is generated and transformed into DH5 alpha competent cells. The positive clone is sent to a company for sequencing after plasmid extraction, pCRISPR-OsWRKY18 plasmid with correct result is selected, and a genetic transformation method mediated by agrobacterium tumefaciens is used for infecting wild type Nippon rice to construct mutant plants. Finally, corresponding primer 1 (SEQ ID NO.5:5'-ATGGGCAAATCAATTGCATGA-3' and SEQ ID NO.6: 5'-TGTTGTTTGACTCCTGGTAGC-3') and primer 2 (SEQ ID NO.7:5'-AACCGCGCGGCGAGATCCTAATC-3' and SEQ ID NO.8: 5'-TCAGTAATTATCATCACCACCAT-3') were designed, the sequences at the target 1 and target 2 positions were amplified by PCR techniques, and after sequencing verification, two independent homozygous mutant plants (oswrky 18-1 and oswrky 18-2) were selected for the following experiments, the results of which are shown in FIG. 2.

Extraction of RNA and analysis of Gene expression level

To analyze the OsWRKY18 expression pattern, roots, stems, leaves, leaf sheaths and ears were sampled from wild-type plants during the heading stage, respectively, and immediately after sampling, placed in liquid nitrogen. Total RNA of the samples was extracted using Trizol kit (Life technologies). Then, synthesis of the first strand of cDNA was performed using Hiscript II Q RT SuperMix Kit (Vazyme). And use ChanQ ^TM SYBR Color qPCR Master Mix (Vazyme) kit and the StepOneGlus Real-Time PCR System (Analytikjena) were subjected to qRT-PCR experimental analysis.

Primer sequences used for OsWRKY18 gene expression are (SEQ ID NO. 9) 5'-GGCCGGAAGAGAAGGAAGGAT-3' and (SEQ ID NO. 10) 5'-CAAGGCACTGTCTGTCCTCAC-3'; the internal reference was histone H3, whose primer sequences were (SEQ ID NO. 11) 5'-GGTCAACTTGTTGATTCCCCTCT-3' and (SEQ ID NO. 12) 5'-AACCGCAAAATCCAAAGAACG-3', and the results are shown in FIG. 3.

As shown in FIG. 3, the OsWRKY18 gene of the present invention is mainly expressed in the roots of rice.

In order to analyze the detailed response of the expression level of OsWRKY18 to salt, firstly, 5d large wild rice seedlings are respectively treated with 100mM NaCl for 0,1,3,6, 12 and 24 hours, and then a main root sample is taken and RNA is extracted; secondly, after treatment for 12 hours by using 0, 25, 50, 75 and 100mM NaCl, taking a main root sample to extract RNA; and qRT-PCR analysis was performed using the method described above, with 4 replicates per set of experiments, the results being shown in fig. 4.

As is clear from A in FIG. 4, the expression level of OsWRKY18 gene increases in sequence with the increase of time. As is clear from FIG. 4B, the expression of the OsWRKY18 gene was induced by NaCl, and the expression level was increased in sequence with increasing NaCl concentration, and when the NaCl concentration was 75, 100, 150mM, there was no significant difference in the OsWRKY18 expression level relative to the 50mM treatment group.

Subcellular localization analysis of OsWRKY18

In order to analyze subcellular localization of OsWRKY18, an OsWRKY18-GFP fusion expression vector is constructed.

The full length sequence of OsWRKY18 (SEQ ID NO. 1) (terminator removal) was amplified using PCR with primers SEQ ID NO.13 (5'-GGCAAGCTTCGATGGCGTCGCCGCGGCTGAAG-3') and SEQ ID NO.14 (5'-AATGTCGACTCAGTAATTATCATCACCACCAT-3') specific for OsWRKY 18. The amplified fragment was then cloned in front of the GFP coding region on the pYL-GFP vector, resulting in an OsWRKY18-GFP recombinant plasmid.

The obtained plasmid OsWRKY18-GFP recombinant plasmid or GFP empty vector is respectively transformed into rice protoplast cells together with a nucleus marked plasmid Ghd7 by using a PEG mediated transformation method, and after incubation at room temperature, a laser confocal scanning microscope (TCS SP8; leica) is used for photographing, and the result is shown in figure 5.

As shown by A-D in FIG. 5, GFP empty vector (green fluorescence) was located in cytoplasmic and nuclear etc., while nuclear marker protein Ghd7 (red fluorescence) was located only in the nucleus. However, as shown by E-H in FIG. 5, the co-localization result of OsWRKY18-GFP recombinant plasmid and Ghd7 revealed that green fluorescence and red fluorescence could be fused, indicating that OsWRKY18 was localized to the nucleus.

Phenotypic analysis and ion content analysis of OsWRKY18 mutant plants

To study the tolerance of OsWRKY18 mutant plants to salt, 15 d-old seedlings of wild-type and 2 OsWRKY18 mutant plants were transferred to 1/2Kimura B nutrient solutions containing 0 and 75mM NaCl, respectively, and cultured for 14d, with nutrient solution changed every 3 days. After the treatment is finished, photographing and sampling are carried out. Then, after the sample was dried in an oven at 70 ℃ for 5 days, the dry weight was weighed. After adding an appropriate amount of concentrated nitric acid and digesting with a graphite digestion instrument, the ion concentration was measured by ICP-MS (Plasma Quant MS; analytik JenaAG) and the result is shown in FIG. 6.

As can be seen from a in fig. 6, under normal conditions, the growth vigor of the mutant plant and the wild type sunny plant are substantially identical, and the dry weights of the roots and aerial parts of the mutant are not significantly different from those of the wild type sunny plant. When treated with 100mM NaCl for 14D, the mutant plants showed that the mutants were much shorter in length and even yellow in leaf wilting (FIG. 6B), the roots of the oswrky18-1 mutant had no significant difference in dry weight from the wild type, but the aerial parts had significantly lower dry weight than the wild type (FIG. 6D); the dry weight of the roots and aerial parts of the oswrky18-2 mutant plants was significantly lower than that of wild type japanese (D in fig. 6). This result further demonstrates that OsWRKY18 is involved in the salt stress response process of rice.

The analysis of the ion content reveals that, under normal conditions, the mutant Na ⁺ K is as follows ⁺ The content of (2) is the same as that of wild type plants. Na of mutant root under salt treatment conditions ⁺ K is as follows ⁺ The content of (A) is not greatly different from that of the wild type (A, B in FIG. 7); however, under 100mM NaCl treatment conditions, na was present in the aerial part of the mutant ⁺ The content is significantly increased compared with the wild type, and K ⁺ The content was not significantly different from the wild type (C, D in fig. 7). The results indicate that the expression of the salt stress sensitive phenotype of the oswrky18 mutant may be due to the accumulation of more Na in the aerial parts of the mutant ⁺ Caused by the method.

Sodium ions were transported from root to aerial parts mainly through xylem, and after treating 35d large wild type and two mutant plants with 30mM NaCl nutrient solution for 6 hours, xylem sap was collected. Determination of Na ⁺ And K ⁺ Concentration display: na in xylem sap of two mutant plants ⁺ Concentration was significantly increased relative to wild type (E in fig. 7); and K is ⁺ There was no significant difference in concentration between wild type and mutant (F in fig. 7). The above results indicate that mutation of OsWRKY18 significantly enhances Na ⁺ Transport from root to aerial parts, thereby causing more Na ⁺ Accumulation in the aerial parts of the plants results in inhibition of mutant growth.

Meanwhile, under normal culture and salt stress conditions containing 100mM NaCl, the transcriptome data of the roots of wild type plants and o swrky18-2 mutant plants are compared to find that OsWRKY18 regulates the expression of a plurality of stress related genes. Real-time fluorescent quantitative PCR verification results show that OsLEA3-1 (SEQ ID NO.15: AATGA TTTCCCTTTGGGTC and SEQ ID NO.16: CATCAGTACACATCACCCA), RA B21 (SEQ ID NO.17: CACACCACAGCAAGAGCTAAGTG and SEQ ID NO.18: TTAGGCTTGGGATCTGCTGG), SALP1 (SEQ ID NO.19: CGCAATCCCTT GCTCATTCG and SEQ ID NO.20: GGCACGTAAGCCATCTCCTC), osHOX22 (SEQ ID NO.21: GTGTCGGTGGAGTCGGATCA and SEQ ID NO.22: CAA GCCACCGCATTCCACTC), rePPR2.1 (SEQ ID NO.23: GTGACAACGAGA TGAGGAGATC and SEQ ID NO.24: TTAGGCTTGGGATCTGCTGG), and OsHKT1;5 (SEQ ID NO.25: CGTCGAGGTTATCAGTGCGT and SEQ ID NO.26: GCT TCCCTTGTTTGCTCCAC) were significantly reduced in the oswrky18-2 mutant plants relative to the wild type plants (FIG. 8). It is suggested that under salt stress conditions, expression of these genes may be directly or indirectly regulated by OsWRKY 18.

From the above examples, osWRKY18 is a nuclear-localized transcription factor protein by controlling Na in the aerial part ⁺ Ion transport and expression of related stress genes are involved in tolerance of rice to salt stress.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. The rice salt tolerance related OsWRKY18 gene is characterized in that the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

2. The rice salt tolerance related OsWRKY18 protein is characterized in that the amino acid sequence of the OsWRKY18 protein is shown as SEQ ID NO. 2.

3. A method for changing sensitivity of rice to salt stress is characterized by regulating expression level of OsWRKY18 gene in rice genome, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

4. A method according to claim 3, wherein said adjusting comprises increasing or decreasing.

5. A method for improving salt stress tolerance of rice is characterized in that the expression level of an OsWRKY18 gene is expressed or overexpressed in a target rice germplasm genome, and the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.

6. A method for improving sensitivity of rice to salt stress is characterized by reducing the expression level of an OsWRKY18 gene in a target rice germplasm genome, wherein the nucleotide sequence of the OsWRKY18 gene is shown as SEQ ID NO. 1.