CN116064574A

CN116064574A - Application of pea TUB gene as reference gene

Info

Publication number: CN116064574A
Application number: CN202210999808.XA
Authority: CN
Inventors: 刘敏敏; 喻敏; 潘婷; 张涵; 杨垚
Original assignee: Foshan University
Current assignee: Foshan University
Priority date: 2022-08-12
Filing date: 2022-08-19
Publication date: 2023-05-05

Abstract

The invention discloses application of a pea TUB gene as an internal reference gene, wherein the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1. In the invention, the inventor finds that pea TUB gene can be stably expressed under low temperature, high temperature, salt or drought stress, and can be used as an internal reference gene for researching the expression of the related genes under low temperature, high temperature, salt or drought stress of peas; and the specific primer of the real-time fluorescent quantitative PCR is designed according to the reference gene, so that the fluorescent quantitative PCR has high specificity, the repeatability of a fluorescent quantitative PCR amplification curve is good, and the stability, the reliability and the repeatability of research can be improved.

Description

Application of pea TUB gene as reference gene

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to application of a pea TUB gene as an internal reference gene for detecting or screening pea related genes under low temperature, high temperature, salt or drought stress.

Background

Pea (Pisum sativum L.) is a spring-sown annual or autumn-winter-sown perennial herb, is suitable for cold-loving climate, is barren-resistant, is cold-resistant and drought-resistant in seedling stage, and has wide geographical distribution. The peas are rich in protein, carbohydrate and various vitamins, have balanced nutrition, can be used as grains, vegetables and feeds, and are important economic crops for increasing income of peasants.

The real-time fluorescent quantitative PCR (qRT-PCR) has the characteristics of high sensitivity, strong specificity, good repeatability and the like, and has been widely applied to gene expression research. The research finds that the stability of reference genes between different species and different samples has certain difference. 18S was identified as a rice (Oryza sativa l.) and poplar stable reference gene, but 18S was the least stable gene in peach (amygdalusperica); UBQ is stable in expression at different developmental stages of peach and banana (Musa nana) fruits, but unstable in expression at different developmental stages of grape fruits. Chlorella (Chlorophyta) shows stable TUB2 expression under salt stress and UV treatment, whereas Histone2 is the most suitable reference gene under different temperature and drying stress treatments. If the incorrect selection of the reference gene can seriously affect the experimental result, even an incorrect conclusion is obtained, when the appropriate reference genes APT1, UBQ5 and EF1a are selected to calibrate the arabidopsis target gene At5g02840, the expression quantity of At5g02840 is basically consistent in the whole pod development stage, and when the inappropriate reference gene TUB6 is selected to calibrate the At5g02840, 100 times of deviation occurs in the expression quantity of At5g 02840. Therefore, it is necessary to select an appropriate reference gene before expression analysis using qRT-PCR.

At present, peas do not have a relatively stable reference gene under low temperature, high temperature, salt or drought stress, so that it is necessary to screen the stable reference gene of peas for researching gene expression of peas under low temperature, high temperature, salt or drought stress.

Disclosure of Invention

Based on this, it is an object of the present invention to provide the use of TUB as a pea reference gene, which TUB can be used as a reference gene for detecting, or screening, genes related to pea low temperature, high temperature, salt or drought stress.

The specific technical scheme for realizing the aim of the invention comprises the following steps:

the pea TUB gene is used as an internal reference gene for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress, and the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1.

The invention also provides application of the pea TUB gene in qRT-PCR detection for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress, wherein the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1.

The invention also provides application of the pea TUB gene in preparing a qRT-PCR detection kit for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress, wherein the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1.

The invention also provides a specific primer for amplifying the pea TUB gene, which comprises a forward primer with a nucleotide sequence shown as SEQ ID No.2 and a reverse primer with a nucleotide sequence shown as SEQ ID No. 3.

The invention also provides application of the specific primer of the pea TUB gene in a qRT-PCR amplification system for detecting or screening the related genes of peas under low temperature, high temperature, salt or drought stress.

The invention also provides application of the specific primer of the pea TUB gene in preparation of a qRT-PCR detection kit for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress.

The invention also provides a qRT-PCR detection kit for the related genes of peas under low temperature, high temperature, salt or drought stress.

The invention also provides a detection method of the related genes of peas under low temperature, high temperature, salt or drought stress, which comprises the following steps: the cDNA of pea seedlings subjected to low temperature, high temperature, salt or drought stress is used as a template, and pea TUB gene is used as an internal reference gene, so that the expression of the related genes is detected.

In some embodiments, the pea TUB gene is used as a reference gene, including primers specific to the above as reference genes.

In some of these embodiments, the low temperature treatment is from 3 ℃ to 5 ℃ for 24 hours to 26 hours; the high temperature treatment is carried out for 22 to 26 hours at 36 to 40 ℃; the salt stress treatment is carried out for 22 to 26 hours by 95mM NaCl solution to 105mM NaCl solution; the drought stress treatment is performed by a 6000PEG solution with the concentration of 8-12% w/v for 22-26 hours.

Compared with the prior art, the invention has the following beneficial effects:

in the invention, the inventor finds that pea TUB gene can be stably expressed under low temperature, high temperature, salt or drought stress, and can be used as an internal reference gene for researching the expression of the related genes under low temperature, high temperature, salt or drought stress of peas; and the specific primer of the real-time fluorescent quantitative PCR is designed according to the reference gene, so that the fluorescent quantitative PCR has high specificity, the repeatability of a fluorescent quantitative PCR amplification curve is good, and the stability, the reliability and the repeatability of research can be improved.

Drawings

FIG. 1 is an agarose gel electrophoresis chart in example 2 of the present invention.

FIG. 2 is a graph showing the dissolution profile of qRT-PCR in example 2 of the present invention.

FIG. 3 shows the results of analysis of the stability of candidate internal reference genes by delta-Ct method in example 3 of the present invention.

FIG. 4 shows the results of analysis of stability of candidate internal reference genes by GeNorm method in example 3 of the present invention.

FIG. 5 shows the results of analysis of the stability of candidate internal reference genes by the NormFinder method in example 3 of the present invention.

FIG. 6 shows the results of comprehensive evaluation of stability of candidate internal reference genes using RefFinder in example 3 of the present invention.

FIG. 7 shows the results of analysis of the stability of candidate internal reference genes by delta-Ct method in example 4 of the present invention.

FIG. 8 shows the results of analysis of stability of candidate internal reference genes by GeNorm method in example 4 of the present invention.

FIG. 9 shows the results of analysis of the stability of candidate internal reference genes by the NormFinder method in example 4 of the present invention.

FIG. 10 shows the results of comprehensive evaluation of candidate reference gene stability using RefFinder in example 4 of the present invention.

FIG. 11 shows the results of analysis of the stability of candidate internal reference genes by delta-Ct method in example 5 of the present invention.

FIG. 12 shows the results of analysis of stability of candidate internal reference genes by GeNorm method in example 5 of the present invention.

FIG. 13 shows the results of analysis of the stability of candidate internal reference genes by the NormFinder method in example 5 of the present invention.

FIG. 14 shows the results of comprehensive evaluation of stability of candidate internal reference genes using RefFinder in example 5 of the present invention.

FIG. 15 shows the results of analysis of the stability of candidate internal reference genes by delta-Ct method in example 6 of the present invention.

FIG. 16 shows the results of analysis of stability of candidate internal reference genes by the GeNorm method in example 6 of the present invention.

FIG. 17 shows the results of analysis of the stability of candidate internal reference genes by the NormFinder method in example 6 of the present invention.

FIG. 18 shows the results of comprehensive evaluation of stability of candidate internal reference genes using RefFinder in example 6 of the present invention.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

The invention will be described in further detail with reference to the drawings and the specific examples.

Example 1 pea reference gene TUB and primers therefor

1. Pea reference gene TUB

The nucleotide sequence is shown as SEQ ID No. 1.

SEQ ID No.1

ATGCGTCAAATCCTCCACATCCAGGGTGGTCAATGCGGCAACCAAATCGGTGCCAAATTCTGGGAAGTCGTTTGCGCCGAACACGGAATCGATCCAACCGGACGCTACACCGGCGACTCAGATCTTCAACTAGAGAGGATCGATGTTTACTACAACGAAGCAAGTGGTGGCCGCTTCGTTCCCAGAGCGGTTCTCATGGATCTTGAACCGGGAACCATGGACAGTATCCGGTCTGGACCGTACGGTCAGATCTTTAGACCGGATAACTTTGTGTTTGGTCAGAGTGGTGCTGGAAATAACTGGGCTAAAGGTCACTATACTGAAGGCGCGGAACTCATTGATTCTGTTCTTGACGTTGTTCGTAAGGAAGCTGAAAACTGTGATTGCTTGCAGGGTTTTCAAGTGTGTCATTCACTTGGTGGAGGAACTGGATCTGGAATGGGAACCCTTCTGATTTCAAAGATTAGGGAGGAATACCCTGACAGGATGATGCTTACTTTCTCTGTTTTCCCTTCTCCTAAAGTTTCTGACACTGTGGTGGAACCCTACAATGCTACTCTATCTGTTCACCAGCTTGTTGAAAATGCAGATGAGGTTATGGTTCTTGACAATGAAGCCTTGTATGACATTTGCTTCCGTATTCTGAAGCTTAGTAACCCAAGCTTTGGTGATCTGAATCATTTGATATCAGCAACTATGTCTGGTGTAACATGTTGTTTGAGGTTCCCTGGTCAGTTAACAAGAACTCGTCATACTTTGTGGAATGGATTCCAAAACATGTCCAAATCCACTGTGTGTGATATTCCCCCAACTGGTTTGAAGATGGCTTCAACATTTATTGGAAACTCGACCTCAATTCAAGAAATGTTCCGCAGGGTAAGTGAACAGTTTACTGCTATGTTCAGGAGGAAGGCTTTCTTGCATTGGTACACAGGTGAAGGAATGGACGAGATGGAATTCACTGAGGCTGAGAGCAATATGAATGATTTGGTTGCAGAGTATCAACAGTATCAAGATGCGACTGCTGATGAAGATGAGTATGGAGAGGAGGAAGGCGATGAGGAAGAGTATGGTCAACATGACATTTGA

2. Designing primer for pea reference gene TUB

Based on the nucleotide sequence of the reference gene TUB, primerPremier5.0 software is utilized to design specific primers, including a forward primer with the nucleotide sequence shown as SEQ ID No.2 and a reverse primer with the nucleotide sequence shown as SEQ ID No. 3. The specific sequence is as follows:

forward primer F

5'-CAGAACAAGAACTCGTCATACT-3'(SEQ ID No.2)

Reverse primer R

5'-AGCCTTCCTCCTGAACATA-3'(SEQ ID No.3)

Example 2 specific detection of primers for the pea reference gene TUB

1. Specificity of conventional PCR detection primers

(1) Extracting total RNA of pea seedlings, and utilizing

One-Step gDNA Removal and cDNA Synthesis SuperMix (full gold, china), cDNA was synthesized by reverse transcription;

(2) The specificity of the primers was detected by performing a conventional PCR amplification reaction using the cDNA obtained in step (1) as a template and the primers of example 1.

PCR reaction system: the total reaction volume was 25. Mu.L, including 12.5. Mu.L of T3 Super PCR Mix, 1. Mu.L of forward primer (0.4. Mu. Mol/L), 1. Mu.L of reverse primer (0.4. Mu. Mol/L), 2. Mu.L of template cDNA (100 ng) and ddH ₂ O 8.5μL。

The PCR reaction procedure was: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55℃for 30s, elongation at 72℃for 20s,33 cycles; finally, the extension is carried out for 5min at 72 ℃.

The PCR amplified product is detected by 1% agarose gel electrophoresis, and the detection result is shown in figure 1; as can be seen from FIG. 1, the PCR amplification gives a single band, no primer dimer and no non-specific amplification are found, and the sequencing size is 181bp, which accords with the expected size, thus indicating that the primer has better specificity and high reliability and can be used for qRT-PCR analysis.

2. Specificity of qRT-PCR detection primer

The specificity of the primers was detected by qRT-PCR amplification using the cDNA obtained in the above step as a template and the primers of example 1.

qRT-PCR was performed using Quantum studio 6Flex (ABI, USA) in 10. Mu.l reaction system.

Reaction system for qRT-PCR amplification: 0.5. Mu.l of cDNA, 5. Mu. l SYBR Premix Ex Taq II (Takara, japan), 0.2. Mu.l of forward primer (10. Mu.M), 0.2. Mu.l of reverse primer (10. Mu.M) and 4.1. Mu.l of ddH ₂ O。

Reaction procedure for qRT-PCR amplification: 95 ℃ for 30 seconds; 95 ℃,10 seconds, 40 cycles; 60℃for 30 seconds. The specific reaction was verified by collecting a dissolution profile fluorescence signal at 65℃to 95℃and performing a dissolution profile analysis.

As shown in FIG. 2, it is clear from FIG. 2 that the reference gene TUB shows a single-peak melting curve, which indicates that the primer has high specificity, and the amplification curve has good repeatability, and the qRT-PCR result is accurate and reliable, and can be used for expression stability analysis (wherein DeltaRn refers to fluorescence intensity).

Example 3 screening of reference genes in pea under Low temperature stress

The method comprises the following steps:

(1) Selecting strong pea seedlings with the same growth vigor, performing low-temperature treatment at 4 ℃ for 24 hours, picking up roots, stems and leaves of the seedlings after the treatment, immediately quick-freezing the seedlings by liquid nitrogen, and placing the seedlings in an ultralow-temperature refrigerator at-80 ℃.

(2) Extracting total RNA of pea tissue, and utilizing

One-Step gDNA Removal and cDNA Synthesis SuperMix (full gold), cDNA was synthesized by reverse transcription;

(3) The qRT-PCR amplification was performed using the cDNA of step (2) as a template, and 4 pairs of fluorescent quantitative primers (Table 1) of candidate genes TUB (. Beta. -tubulin, psat7g 244040.1), ACT (actin, psat3g 166680.1), H3 (history H3, psat 1184g 0040.1) and PP2A (phosphoprotein phosphatase A, psat1g 039040.1).

Table 1 fluorescent quantitative primer pair for candidate genes

Reaction system for PCR amplification: 0.5. Mu.l of cDNA, 5. Mu. l SYBR Premix Ex Taq II (Takara, japan), 0.2. Mu.l of forward primer (10. Mu.M), 0.2. Mu.l of reverse primer (10. Mu.M) and 4.1. Mu.l of ddH ₂ O。

Reaction procedure for PCR amplification: 95 ℃ for 30 seconds; 95 ℃,10 seconds, 40 cycles; 60℃for 30 seconds.

(2) Stability of the 4 candidate reference genes was assessed using BestKeeper, geNorm, normFinder and Delta Ct methods and refFinder analysis software.

The stability evaluation steps were as follows:

(1) As a result of the delta-Ct method, the gene with a lower SD value showed higher expression stability, and as shown in FIG. 3, TUB was the most stable gene among all candidate genes, and its average STDEV value was 0.651 at the minimum, and H3 was 1.009 at the maximum.

(2) Bestdeeper was ranked according to standard deviation SD and coefficient of variation CV values, and the analysis results are shown in table 2, table 2 shows that the lowest cv±sd is 0.79 for TUB and ACT, indicating that the gene is the most stable gene, and the highest cv±sd for H3 is 1.33, the least stable gene.

TABLE 2 BEST KEEPER evaluation of candidate internal reference genes

(3) The stability of the reference gene was evaluated according to the variation between genes using the NormFinder program, and the stability value of the most stable reference gene was the lowest. As a result, as shown in FIG. 4, TUB was considered as the most suitable reference gene, and the stability value was 0.224 at the minimum, as shown in FIG. 4.

(4) GeNorm evaluates the stability of candidate reference genes by calculating the stability value (M), the gene with the lowest M value being considered the most stable. As a result, as shown in FIG. 5, it is understood from FIG. 5 that GeNorm uses TUB and PP2A as the optimal reference gene pair, and that M value is 0.357, while H3 is the most unstable reference gene, and that M value is 0.792.

(5) Finally, the results of the comprehensive ranking of candidate reference genes based on the four procedures using reffilter are shown in fig. 6 and table 3, and the results of fig. 6 and table 3 show that TUB is the most stable reference gene, stability value is the lowest 1, H3 is the least stable reference gene, and stability value is the highest 4.

TABLE 3 stability analysis of candidate genes under Low temperature stress

In conclusion, the TUB gene is determined to be the most stable under low temperature stress, and can be used as an internal reference gene of peas under low temperature stress.

Example 4 screening of reference genes in peas under high temperature stress

In this example, the procedure was the same as in example 3, except that the pea seedlings were subjected to the high temperature treatment of 38℃for 24 hours in the step (1).

Stability of the 4 candidate reference genes was assessed using BestKeeper, geNorm, normFinder and Delta Ct methods and refFinder analysis software.

The stability evaluation steps were as follows:

(1) As shown in FIG. 7, TUB is the most stable gene among all candidate genes, and has the minimum STDEV value of 0.759, the minimum H3 stability and the maximum STDEV value of 0.955.

(2) BestKeeper was ranked according to standard deviation SD and coefficient of variation CV, the analysis results are shown in Table 4, and the results of Table 4 show that CV.+ -. SD is the lowest where ACT is 2.04, indicating that the gene is the most stable gene.

TABLE 4 BEST KEEPER evaluation of candidate internal reference genes

(3) The stability of the reference gene was evaluated according to the variation between genes using the NormFinder program, and the stability value of the most stable reference gene was the lowest. As a result, as shown in FIG. 8, it is understood from FIG. 8 that ACT is considered as the most suitable reference gene, the stability value is at least 0.349, and H3 is the most unstable reference gene, and the stability value is 0.827.

(4) GeNorm evaluates the stability of candidate reference genes by calculating the stability value (M), the gene with the lowest M value being considered the most stable. As a result, as shown in FIG. 9, geNorm uses TUB and PP2A as the optimal reference gene pair, and the M value is 0.576.

(5) Finally, as shown in fig. 10 and table 5, the results of the comprehensive ranking of candidate reference genes based on the above four procedures using reffilter, and as can be seen from fig. 10 and table 5, TUB is the most stable reference gene, the stability value is the lowest 1.662, H3 is the least stable reference gene, and the stability value is the highest 4.

TABLE 5 stability analysis of candidate genes under high temperature stress

In conclusion, the TUB gene is determined to be the most stable under high temperature stress, and can be used as an internal reference gene under pea high temperature stress.

Example 5 screening of reference genes under pea salt stress

In this example, the procedure was the same as in example 3, except that pea seedlings were treated with 100mM NaCl solution for 24 hours in step (1).

The stability evaluation steps were as follows:

(1) As shown in FIG. 11, TUB is the most stable gene among all candidate genes, and has the minimum STDEV value of 0.821 and the minimum H3 stability, and the maximum STDEV value of 1.128.

(2) BestKeeper was ranked according to standard deviation SD and coefficient of variation CV, and the analysis results are shown in Table 6, with CV.+ -. SD being the lowest TUB of 0.51, indicating that the gene is the most stable gene.

TABLE 6 BEST KEEPER evaluation of candidate internal reference genes

(3) The stability of the reference gene was evaluated according to the variation between genes using the NormFinder program, and the stability value of the most stable reference gene was the lowest. As a result, as shown in FIG. 12, from FIG. 12, TUB was considered as the most suitable reference gene, the stability value was 0.195 at the minimum, and H3 was the reference gene that was the least stable, and the stability value was 0.932.

(4) GeNorm evaluates the stability of candidate reference genes by calculating the stability value (M), the gene with the lowest M value being considered the most stable. As a result, as shown in FIG. 13, geNorm uses TUB and PP2A as the optimal reference gene pair, and the M value is 0.462.

(5) Finally, the results of the comprehensive ranking of candidate reference genes based on the four procedures using reffilter are shown in fig. 14 and table 7, and the results of fig. 14 and table 7 show that TUB is the most stable reference gene, stability value is the lowest 1, H3 is the least stable reference gene, and stability value is the highest 4.

TABLE 7 stability analysis of candidate genes under high temperature stress

In conclusion, it was determined that the TUB gene was most stable under salt stress and could be used as an internal reference gene under pea salt stress.

Example 6 screening of reference genes under drought stress in peas

In this example, the procedure was the same as in example 3, except that pea seedlings were subjected to simulated drought (10% w/v 6000 PEG) for 24h in step (1).

Stability assessment was performed on the stability of the 4 candidate reference genes using BestKeeper, geNorm, normFinder and Delta Ct methods and refFinder analysis software. The method comprises the following steps:

(1) As shown in FIG. 15, TUB is the most stable gene among all candidate genes, and the average STDEV value is 0.874 at the lowest, the stability of H3 is 1.067 at the highest, as shown in FIG. 15.

(2) BestKeeper was ranked according to standard deviation SD and coefficient of variation CV values, the analysis results are shown in Table 8, and the results in Table 8 show that CV.+ -. SD is 0.58 at the lowest TUB, indicating that the gene is the most stable gene.

TABLE 8 BEST KEEPER evaluation of candidate internal reference genes

(3) The stability of the reference gene was evaluated according to the variation between genes using the NormFinder program, and the stability value of the most stable reference gene was the lowest. As a result, as shown in FIG. 16, from FIG. 16, TUB was considered as the most suitable reference gene, the stability value was 0.48 at the minimum, and H3 was the reference gene which was the least stable, and the stability value was 0.868.

(4) GeNorm evaluates the stability of candidate reference genes by calculating the stability value (M), the gene with the lowest M value being considered the most stable. As a result, as shown in FIG. 17, from FIG. 17, geNorm uses TUB and PP2A as the optimal reference gene pair, and the M value is 0.694.

(5) Finally, the results of the comprehensive ranking of candidate reference genes based on the four procedures using reffilter are shown in fig. 18 and table 9, and the results of fig. 18 and table 9 show that TUB is the most stable reference gene, stability value is the lowest 1, H3 is the least stable reference gene, and stability value is the highest 4.

TABLE 9 stability analysis of candidate genes under high temperature stress

In conclusion, the TUB gene is determined to be the most stable under salt stress, and can be used as an internal reference gene under pea drought stress.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. The application of the pea TUB gene as an internal reference gene for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress is characterized in that the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1.

2. The application of pea TUB gene in qRT-PCR detection for detecting or screening pea related genes under low temperature, high temperature, salt or drought stress is provided, and the nucleotide sequence of pea TUB gene is shown as SEQ ID No. 1.

3. The application of the pea TUB gene in preparing a qRT-PCR detection kit for detecting or screening related genes of peas under low temperature, high temperature, salt or drought stress is provided, and the nucleotide sequence of the pea TUB gene is shown as SEQ ID No. 1.

4. The specific primer for amplifying the pea TUB gene is characterized by comprising a forward primer with a nucleotide sequence shown as SEQ ID No.2 and a reverse primer with a nucleotide sequence shown as SEQ ID No. 3.

5. The use of primers specific for pea TUB gene according to claim 4 for detecting, or screening qRT-PCR amplification systems for genes related to pea low temperature, high temperature, salt or drought stress.

6. The use of a primer specific for pea TUB gene according to claim 4 for the preparation of a qRT-PCR detection kit for detecting, or screening, pea genes related to low temperature, high temperature, salt or drought stress.

7. A qRT-PCR assay kit for detecting, or screening, genes associated with pea at low temperature, high temperature, salt or drought stress, characterized in that the kit comprises the specific primer of claim 4 as a primer for an internal reference gene.

8. The method for detecting the related genes of peas under low temperature, high temperature, salt or drought stress is characterized by comprising the following steps of: the cDNA of pea seedlings treated by low temperature, high temperature, salt or drought stress is used as a template, pea TUB gene is used as an internal reference gene, and the expression of the related genes is detected.

9. The method according to claim 8, wherein the pea TUB gene is used as an internal reference gene, and comprising qRT-PCR detection using the specific primers as defined in claim 4.

10. The method according to claim 8, wherein the low temperature treatment is carried out at3 to 5 ℃ for 24 to 26 hours; the high temperature treatment is carried out for 22 to 26 hours at 36 to 40 ℃; the salt stress treatment is carried out for 22 to 26 hours by 95mM NaCl solution to 105mM NaCl solution; the drought stress treatment is performed by a 6000PEG solution with the concentration of 8-12% w/v for 22-26 hours.