CN116064471B - Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin - Google Patents

Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin Download PDF

Info

Publication number
CN116064471B
CN116064471B CN202211209623.0A CN202211209623A CN116064471B CN 116064471 B CN116064471 B CN 116064471B CN 202211209623 A CN202211209623 A CN 202211209623A CN 116064471 B CN116064471 B CN 116064471B
Authority
CN
China
Prior art keywords
lipase
ouc
lipase17
astaxanthin
hydrolyzing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202211209623.0A
Other languages
Chinese (zh)
Other versions
CN116064471A (en
Inventor
孙建安
余可欣
毛相朝
高坤鹏
闫娇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ocean University of China
Original Assignee
Ocean University of China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ocean University of China filed Critical Ocean University of China
Priority to CN202211209623.0A priority Critical patent/CN116064471B/en
Publication of CN116064471A publication Critical patent/CN116064471A/en
Application granted granted Critical
Publication of CN116064471B publication Critical patent/CN116064471B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a Lipase OUC-Lipase17, the amino acid sequence of which is shown as SEQ ID NO. 1. The nucleotide sequence of the coding gene is shown as SEQ ID NO. 2. The application of the Lipase OUC-Lipase17 in hydrolyzing astaxanthin ester or preparing free astaxanthin. The invention also discloses a method for hydrolyzing astaxanthin ester or preparing free astaxanthin: hydrolyzing astaxanthin ester with Lipase OUC-Lipase17 to obtain free astaxanthin. The invention also discloses a recombinant expression vector and recombinant engineering bacteria containing the coding gene of the Lipase OUC-Lipase 17. The Lipase OUC-Lipase17 belongs to the II family of lipid hydrolases, and can rapidly hydrolyze astaxanthin esters to obtain free astaxanthin.

Description

Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin
Technical Field
The invention relates to Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin, and belongs to the technical field of functional enzymes.
Background
Lipases (EC 3.1.1.3) are widely present in various tissues of microorganisms and animals and plants, are a member of the family of α/β hydrolases, and the catalytic center of the enzyme is composed of a plurality of parallel or antiparallel β -sheets, and the α -helix mediates the connection of two adjacent β -sheets, wherein the number, spatial position distribution, etc. of the α -helix and β -sheet are different depending on the source of the Lipase. The lipase is also called acyl glycerol hydrolase, and can catalyze triacylglycerol to hydrolyze to generate monoglyceride, diglyceride or directly generate glycerol and fatty acid in water phase, and can catalyze transesterification or esterification under non-water phase condition. Different lipases may exhibit different or even diametrically opposed enzymatic properties of activity, specificity, optimum temperature and pH, temperature and acid-base stability, solvent tolerance, etc. Therefore, the promotion of green industrial production of lipases has largely been dependent on screening out novel lipases with good properties.
Astaxanthin (Astaxanthin, 3' -dihydroxy-4, 4' -dione-beta, beta ' -carotene) has a molecular formula of C 40H52O4 and a relative molecular weight of 596.86, and is a ketocarotenoid. Astaxanthin has antioxidant activity, and its antioxidant capacity is far higher than that of natural antioxidants such as vitamin E, beta-carotene, grape seed, lutein, procyanidine, coenzyme Q10, tea polyphenols, lycopene, etc. Studies have shown that astaxanthin in free form has better bioavailability and functional activity than astaxanthin esters, and that free astaxanthin is an important precursor substance for specific esterification modification, so efficient preparation of free astaxanthin is an important direction of the astaxanthin industry development.
Natural astaxanthin is widely found in fish, shrimp, crab, haematococcus pluvialis, but natural astaxanthin often exists in the form of a mixture of various astaxanthin esters linked with different groups, which greatly limits the absorption and utilization of astaxanthin in the body and the preparation of astaxanthin derivatives of specific configurations. At present, free astaxanthin is mainly prepared by chemical methods, artificial synthesis methods, biological enzyme methods and the like, wherein the astaxanthin loss is large in the chemical method preparation process, and the biological activity and stability of the astaxanthin synthesized by the artificial synthesis methods are not similar to those of natural astaxanthin. The biological enzyme method provides a safe, efficient, green and mild method for preparing the free astaxanthin, and has wide application prospect. One of the key factors in the biological enzyme method for preparing free astaxanthin is the development and application of novel lipase with high catalytic activity. Therefore, the development of novel lipase capable of rapidly hydrolyzing to prepare free astaxanthin has important significance for preparing free astaxanthin.
Disclosure of Invention
Aiming at the prior art, the invention discovers and obtains a novel Lipase, namely OUC-Lipase17, which can rapidly hydrolyze astaxanthin ester to obtain free astaxanthin.
The invention is realized by the following technical scheme:
The amino acid sequence of the Lipase OUC-Lipase17 is shown in SEQ ID NO. 1.
The nucleotide sequence of the coding gene of the Lipase OUC-Lipase17 is shown as SEQ ID NO. 2.
The application of the Lipase OUC-Lipase17 in hydrolyzing astaxanthin ester or preparing free astaxanthin.
Further, in specific applications, the hydrolysis conditions are: the temperature is 0 to 45 ℃, preferably 20 to 40 ℃, more preferably 30 ℃; the pH is 6.0 to 10.0, preferably 9.0.
Further, in specific application, astaxanthin ester in haematococcus pluvialis algae oil is hydrolyzed.
A method of hydrolyzing an astaxanthin ester or preparing free astaxanthin: hydrolyzing astaxanthin ester with Lipase OUC-Lipase17 to obtain free astaxanthin.
Further, the specific method comprises the following steps: adding Lipase OUC-Lipase17 into haematococcus pluvialis algae oil or its solution, hydrolyzing at 0-45 deg.C and pH 6.0-10.0 to obtain free astaxanthin.
Further, the time of hydrolysis is 1 to 2 hours, preferably 1.5 hours.
Further, the temperature of the hydrolysis is preferably 20 to 40 ℃, more preferably 30 ℃.
Further, the pH of the hydrolysis is preferably 9.0.
A recombinant expression vector comprising the coding gene of the Lipase OUC-Lipase 17. Further, the vector is a pP43NMK plasmid.
A recombinant engineering bacterium comprising the coding gene of the Lipase OUC-Lipase17 or comprising the recombinant expression vector.
Further, the engineering bacteria of the vector are bacillus subtilis WB800.
The recombinant expression vector and the recombinant engineering bacterium are applied to the preparation of Lipase OUC-Lipase 17.
The Lipase OUC-Lipase17 belongs to the lipid hydrolase II family, and can rapidly hydrolyze astaxanthin ester to obtain free astaxanthin (within 1.5 hours), so that the application potential of the Lipase for hydrolyzing astaxanthin ester to prepare free astaxanthin is reflected.
The various terms and phrases used herein have the ordinary meaning known to those skilled in the art.
Drawings
Fig. 1: optimal pH for Lipase OUC-Lipase 17.
Fig. 2: schematic of the pH stability of Lipase OUC-Lipase 17.
Fig. 3: optimal temperature map of Lipase OUC-Lipase 17.
Fig. 4: schematic of the temperature stability of Lipase OUC-Lipase 17.
Fig. 5: schematic representation of the effect of metal ions on Lipase OUC-Lipase17 enzyme activity.
Fig. 6: free astaxanthin thin layer chromatography chromatogram obtained by hydrolysis reaction of astaxanthin ester catalyzed by Lipase OUC-Lipase 17.
Detailed Description
The invention is further illustrated below with reference to examples. However, the scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications can be made to the invention without departing from the spirit and scope thereof.
The instruments, reagents and materials used in the examples below are conventional instruments, reagents and materials known in the art and are commercially available. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods and detection methods known in the prior art unless otherwise specified.
Example 1 screening and cloning expression of Gene encoding Lipase OUC-Lipase17
From a laboratory-stored Streptomyces bacilus strain (Streptomyces bacillaris ATCC 15855 T, available from Shandong university) having Lipase activity, a gene which may have Lipase activity was selected, as shown in SEQ ID NO.2, and the amino acid sequence of the expressed protein was shown in SEQ ID NO.1, designated as Lipase OUC-Lipase17. The structural domain of the Lipase OUC-Lipase17 was analyzed by using SMART website to construct phylogenetic tree of Lipase OUC-Lipase17 and other members of the lipid hydrolase family, confirming that the Lipase OUC-Lipase17 belongs to the lipid hydrolase family II.
SEQ ID NO.1：
MNTPHEWITTPIGPGILRGALDLERTDRGVLPHRLPAHARAQIPDGQLAMAEAQPSGVRMAFRSRATTVELDVIATKRVYPGAPRRPDGVYELLVDGRHAGRASARDGDTLTIDLASGASHTRPGPVETLRFGGLPDAEKGIEIWLPHDETTQLVALRTDAPVHTQQPGGRPVWLHHGSSISHGSNAATPTGTWPALAAAHSGAELINLGFSGSALLDPFTARTLRNTPADLISIKIGINLVNTDLMRLRAFGPAVHGFLDTIREGHPTTPLLVISPIHCPIHEHTPGPSAYDLGAMSEGRLRFTATGDPAETAAGKLTLTVIRDELARLVDRRTATDPHLHHLDGLDLYGEDDHADLPLPDDLHPDPATHRLIAERFARLAFGRGGPFAGRNR.
SEQ ID NO.2：
5'-ATGAACACCCCGCACGAGTGGATCACCACCCCCATCGGCCCCGGCATCCTGCGCGGCGCCCTCGACCTGGAGCGCACCGACCGCGGCGTACTGCCCCACCGGCTGCCCGCCCACGCCCGGGCCCAGATACCCGACGGGCAACTGGCCATGGCCGAGGCGCAGCCCTCCGGGGTCCGGATGGCCTTCCGCAGCCGGGCCACCACCGTCGAGCTGGACGTGATCGCCACCAAACGCGTCTACCCCGGGGCGCCGCGCCGTCCCGACGGTGTGTACGAACTCCTCGTCGACGGCCGGCACGCGGGCCGGGCCAGTGCGCGCGACGGCGACACCCTCACCATCGACCTGGCCTCGGGCGCCTCGCACACCCGCCCGGGGCCCGTGGAAACCCTCCGCTTCGGCGGCCTGCCCGACGCCGAGAAGGGCATCGAGATCTGGTTGCCGCACGACGAGACCACCCAACTGGTCGCCCTGCGCACCGACGCACCCGTCCACACCCAGCAGCCCGGCGGCCGGCCGGTCTGGCTGCACCACGGCAGCTCCATCAGCCACGGCTCCAACGCCGCCACCCCCACCGGCACCTGGCCCGCCCTGGCCGCCGCTCACAGTGGAGCCGAACTGATCAACCTCGGGTTCAGCGGCAGTGCTCTGCTCGACCCCTTCACCGCCCGCACCCTCCGAAACACTCCCGCCGACCTCATCAGCATCAAGATCGGCATCAACCTGGTGAACACCGACCTCATGCGGCTGCGTGCCTTCGGCCCGGCCGTCCACGGCTTCCTCGACACCATCCGCGAAGGCCACCCCACCACGCCCCTGCTGGTCATCTCACCGATCCACTGCCCCATCCACGAACACACCCCCGGCCCCAGCGCCTACGACCTCGGCGCGATGAGCGAGGGACGGCTGCGGTTCACCGCCACCGGGGATCCGGCCGAGACCGCCGCCGGGAAGCTGACCCTCACCGTCATACGGGACGAACTCGCCCGGCTCGTCGACCGGCGGACCGCCACCGACCCCCACCTCCACCACCTCGACGGCCTCGACCTCTACGGCGAGGACGACCACGCCGACCTGCCGCTCCCCGACGACCTCCACCCCGACCCCGCCACCCACCGCCTCATCGCCGAACGCTTCGCCCGGCTCGCCTTCGGCCGCGGCGGCCCCTTCGCCGGCCGGAACCGC-3'.
Considering that the excavated enzyme is further applied to the food industry, the bacillus subtilis WB800 strain with good stability, poor environmental tolerance and probiotics is selected as a host, and the pP43NMK plasmid is selected as an expression vector.
The gene segment is connected with a pP43NMK plasmid vector in a seamless splicing mode, and the recombinant plasmid is transferred into bacillus subtilis competent cells WB800 in an electrotransformation mode after the recombinant plasmid is successfully constructed. After single colonies were grown on the selection medium, single colonies were picked and inoculated into 5 mL LB medium containing 50. Mu.g/mL of Canada resistance for activation of the colonies (37 ℃,220 ℃, rpm, 12, h). After activation, the bacterial liquid was transferred to 400 mL LB medium containing 50. Mu.g/mL of the Kana resistance in an inoculum size of 1% to culture and express lipase (30 ℃, 220: 220 rpm fermentation culture 48 h).
After fermentation, centrifuging the fermentation liquor, collecting supernatant, carrying out vacuum freeze drying to obtain crude enzyme powder, re-dissolving the crude enzyme powder in Tris-HCl buffer solution with the pH value of 9 and the concentration of 100mM, carrying out ultrafiltration concentration by using an ultrafiltration cup with the size of 10 kDa, purifying the concentrated enzyme solution by using a nickel column, and carrying out gradient elution by using imidazole-Tris-HCl buffer solutions (pH 8.0) with different concentration gradients (20 mM, 50 mM, 80 mM, 100mM, 150 mM and 200 mM) respectively in sequence by utilizing the characteristic that His-tag protein on a pP43NMK carrier is combined with the nickel column, wherein whether protein is washed out in the eluent is continuously detected by using a coomassie brilliant blue solution, and the imidazole-Tris-HCl buffer solution with the gradient of 150 mM is successfully eluted out the enzyme solution. And (3) performing vacuum freeze drying on the eluted enzyme solution to obtain pure enzyme powder.
EXAMPLE 2 Lipase OUC-Lipase17 enzymatic Property Studies
(1) Optimal pH of Lipase OUC-Lipase17
At 37℃the same amount of OUC-Lipase17 enzyme powder (8 mg) was incubated in 1 mL different pH buffers for 2 min to create different pH environments, 100. Mu.L of enzyme solution was removed after incubation was completed, 20. Mu.L of 200 mM p-nitrophenol palmitate (pNPP) was added, reaction 5 min was stopped, 480. Mu.L of 1% SDS was added, and absorbance A 405 nm at a wavelength of 405 nm was examined for the effect of pH conditions on Lipase OUC-Lipase17 activity. The buffers used included: 100 mM sodium phosphate buffer (pH 6.0-8.0), 100 mM Tris-HCl buffer (pH 7.0-9.0), 100 mM Glycine-NaOH buffer (pH 9.0-10.0).
The activity of Lipase OUC-Lipase17 under the optimum pH buffer conditions was defined as 100% and the activities under other pH buffer conditions were expressed as a percentage relative to the optimum enzyme activity. As a result, as shown in FIG. 1, lipase OUC-Lipase17 had the highest enzyme activity in Tris-HCl having pH=9.0 and Glycine-NaOH buffer having pH=9.0, and the enzyme activity was less than half of the highest enzyme activity at pH=6.0, which indicates that the enzyme is an alkaline Lipase, and the optimum pH was 9.0.
(2) PH stability of Lipase OUC-Lipase17
The enzyme activity stability of the Lipase OUC-Lipase17 under different pH buffer conditions is measured by incubating the same amount of OUC-Lipase17 enzyme powder under different pH buffer conditions of 0h, 6 h, 24 h, 30 h, 48h, 72h and 96 h respectively, adding 20 mu L of pNPP as a substrate, and measuring the enzyme activity stability of the Lipase OUC-Lipase17 under different pH buffer conditions at 37 ℃ and pH 9, wherein the Lipase OUC-Lipase17 has good stability within the pH range of 6.0-10.0, and the enzyme activity is maintained for more than 65% after incubation for 72 h.
(3) Optimal temperature of Lipase OUC-Lipase17
Under the condition of optimal pH (pH=9.0), the same amount of OUC-Lipase17 and a substrate pNPP are incubated and reacted at different temperatures (20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃ and 55 ℃) to detect the influence of the temperature on the enzyme activity of the Lipase OUC-Lipase 17.
The activity of OUC-Lipase17 at the optimum temperature is defined as 100% and the activity at other temperatures is expressed as a percentage of the relative highest enzyme activity. As a result, as shown in FIG. 3, the optimum temperature of the Lipase OUC-Lipase17 was 30℃and, at temperatures lower than 30℃the enzyme activity of the Lipase OUC-Lipase17 increased with an increase in temperature, and at temperatures higher than 30℃the enzyme activity decreased with an increase in temperature, and at 50℃the enzyme activity had been significantly decreased.
(4) Temperature stability of Lipase OUC-Lipase17
The same amount of OUC-Lipase17 enzyme powder is respectively incubated for 0 h, 6 h, 24 h, 30 h, 48 h, 72 h and 96 h under different temperature conditions, then the sample is taken, the enzyme activity is measured under the same condition, and the stability of the enzyme activity of the Lipase OUC-Lipase17 under different temperature conditions is measured. As shown in FIG. 4, the Lipase OUC-Lipase17 has no significant decrease in enzyme activity after incubation at various temperatures of 72 h, indicating that the enzyme has good temperature stability below 40 ℃.
(5) Effect of Metal ion on Lipase OUC-Lipase17 enzymatic Activity
The effect of different species of metal ions and Na 2 -EDTA on the enzyme activity of Lipase OUC-Lipase17 was determined by adding to the reaction system metal ions （Zn2+、Ca2+、Mg2+、Na+、Fe3+、Ba2+、K+、Mn2+、Ni+、Li+）（ having final concentrations of 1mM and 10mM, both added as hydrochloride salt), and Na 2 -EDTA at pH 9.0 and temperature of 30 ℃. The reaction system without metal ions and Na 2 -EDTA was used as a blank control, and the activity of Lipase OUC-Lipase17 under this condition was defined as 100%, and the enzyme activities under other conditions were defined as percentages relative to the control. As a result, as shown in FIG. 5, zn 2+、Fe3+、Na2 -EDTA at concentrations of 1mM and 10mM had inhibitory effects on the enzyme activities, in which Zn 2+ had the strongest inhibitory effect on the enzyme activities, while Na 2 -EDTA also inhibited the enzyme activities to a great extent, indicating that Lipase OUC-Lipase17 was a metal ion-dependent enzyme. Mg 2+、Na+、Ba2+、K+、Mn2+、Ni+、Ca2+ added at a concentration of 1mM has a certain promoting effect on the enzyme activity, and Mg 2+、Na+、Ba2+、K+、Mn2+、Ni+、Ca2+ added at a concentration of 10mM has a certain inhibiting effect on the enzyme activity. The influence of Li + on the enzyme activity is not obvious, and the addition of Li + of 1mM or 10mM has a slight promotion effect on the enzyme activity.
EXAMPLE 3 Lipase OUC-Lipase17 catalyzes the hydrolysis of astaxanthin esters to give astaxanthin in free form
The activity of Lipase OUC-Lipase17 in hydrolyzing astaxanthin esters to prepare free astaxanthin was studied initially, and the specific steps were as follows:
(1) Dissolving haematococcus pluvialis oil (astaxanthin ester content about 10%) in absolute ethanol to prepare haematococcus pluvialis oil solution with the concentration of 1 mg/mL;
(2) Mixing 200 μl of haematococcus pluvialis oil solution and 5 mL of Glycine-NaOH buffer solution with pH of 9.0 in 25 mL brown triangular flask with plug, adding 40 mg enzyme powder into experimental group, and adding inactivating enzyme powder into control group;
(3) After removing oxygen in the triangular bottle with the stopper by nitrogen blowing treatment, sealing the bottle by using a sealing film;
(4) Fixing the reaction bottle in a water bath shaking table at 30 ℃ and 200 rpm for reaction 1.5 h;
(5) After the reaction is finished, 400 mu L of reaction solution is taken in an EP tube, 400 mu L of isopropanol and 800 mu L of dichloromethane are added for extraction, and centrifugal delamination is carried out;
(6) Removing the water phase (upper layer), performing nitrogen blowing concentration treatment on the lower organic phase, and then spotting on a silica gel plate;
(7) The astaxanthin ester was developed with a developing agent (acetone: n-hexane=1:4) and observed for hydrolysis.
As shown in FIG. 6, the TLC result shows that the experimental group added with the Lipase OUC-Lipase17 only reacts 1.5 h, and obvious free astaxanthin is generated, while the control group and the original haematococcus pluvialis algae oil do not have obvious free astaxanthin, which shows that the Lipase OUC-Lipase17 has good activity of hydrolyzing astaxanthin ester, and has higher development potential in the aspect of hydrolyzing astaxanthin ester to generate free astaxanthin.
The foregoing examples are provided to fully disclose and describe how to make and use the claimed embodiments by those skilled in the art, and are not intended to limit the scope of the disclosure herein. Modifications that are obvious to a person skilled in the art will be within the scope of the appended claims.

Claims (10)

1. Lipase OUC-Lipase17, characterized in that: the amino acid sequence is shown as SEQ ID NO. 1.
2. The Lipase OUC-Lipase17 coding gene of claim 1, wherein: the nucleotide sequence is shown as SEQ ID NO. 2.
3. Use of the Lipase OUC-Lipase17 according to claim 1 for hydrolyzing astaxanthin esters or for preparing free astaxanthin.
4. A use according to claim 3, characterized in that: in specific application, the hydrolysis conditions are as follows: the temperature is 0-45 ℃ and the pH is 6.0-10.0.
5. A use according to claim 3, characterized in that: in specific application, astaxanthin ester in haematococcus pluvialis algae oil is hydrolyzed.
6. A process for hydrolyzing an astaxanthin ester or preparing free astaxanthin, characterized by: hydrolysis of astaxanthin esters using the Lipase OUC-Lipase17 of claim 1 gives free astaxanthin.
7. The method of hydrolyzing astaxanthin esters or preparing free astaxanthin according to claim 6, wherein: adding Lipase OUC-Lipase17 into haematococcus pluvialis algae oil or its solution, hydrolyzing at 0-45 deg.C and pH 6.0-10.0 to obtain free astaxanthin.
8. The method of hydrolyzing astaxanthin esters or preparing free astaxanthin according to claim 7, wherein: the hydrolysis time is 1-2 hours;
or: the hydrolysis temperature is 20-40 ℃;
Or: the pH of the hydrolysis was 9.0.
9. A recombinant expression vector, characterized in that: it contains the coding gene of Lipase OUC-Lipase 17; the nucleotide sequence of the coding gene of the Lipase OUC-Lipase17 is shown as SEQ ID NO. 2.
10. The recombinant engineering bacterium is characterized in that: comprising the coding gene of Lipase OUC-Lipase17 or the recombinant expression vector of claim 9; the nucleotide sequence of the coding gene of the Lipase OUC-Lipase17 is shown as SEQ ID NO. 2.
CN202211209623.0A 2022-09-30 2022-09-30 Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin Active CN116064471B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211209623.0A CN116064471B (en) 2022-09-30 2022-09-30 Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211209623.0A CN116064471B (en) 2022-09-30 2022-09-30 Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin

Publications (2)

Publication Number Publication Date
CN116064471A CN116064471A (en) 2023-05-05
CN116064471B true CN116064471B (en) 2024-05-31

Family

ID=86179250

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211209623.0A Active CN116064471B (en) 2022-09-30 2022-09-30 Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin

Country Status (1)

Country Link
CN (1) CN116064471B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2633847A1 (en) * 2005-12-09 2007-06-14 Suntory Limited A novel 32 kda lipase from tetrasphaera
JP2009215184A (en) * 2008-03-07 2009-09-24 Makoto Inoue CELL-SELECTIVE, SELECTIVE PPAR gamma MODULATOR
CN104293874A (en) * 2014-09-23 2015-01-21 中国海洋大学 Method for preparing free astaxanthin
CN112534055A (en) * 2018-07-13 2021-03-19 豪夫迈·罗氏有限公司 Oligonucleotides for modulating expression of RTEL1
CN112941049A (en) * 2021-02-24 2021-06-11 中国海洋大学 Lipase and application thereof in hydrolyzing astaxanthin ester

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2633847A1 (en) * 2005-12-09 2007-06-14 Suntory Limited A novel 32 kda lipase from tetrasphaera
JP2009215184A (en) * 2008-03-07 2009-09-24 Makoto Inoue CELL-SELECTIVE, SELECTIVE PPAR gamma MODULATOR
CN104293874A (en) * 2014-09-23 2015-01-21 中国海洋大学 Method for preparing free astaxanthin
CN112534055A (en) * 2018-07-13 2021-03-19 豪夫迈·罗氏有限公司 Oligonucleotides for modulating expression of RTEL1
CN112941049A (en) * 2021-02-24 2021-06-11 中国海洋大学 Lipase and application thereof in hydrolyzing astaxanthin ester

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Identification of a GDSL lipase from Streptomyces bacillaris and its application in the preparation of free astaxanthin;Kunpeng Gao等;Journal of Biotechnology;20211231;第280-287页 *
脂肪酶Sv-lip5 的异源表达及其在虾青素酯水解中的应用;闫娇等;南方水产科学;20220430;第18卷(第2期);第30-38页 *

Also Published As

Publication number Publication date
CN116064471A (en) 2023-05-05

Similar Documents

Publication Publication Date Title
Khandeparkar et al. Isolation, purification and characterization of the xylanase produced by Arthrobacter sp. MTCC 5214 when grown in solid-state fermentation
Pera et al. Catalytic properties of lipase extracts from Aspergillus niger.
RU1838410C (en) Method of obtaining alpha-amylase
Zhu et al. Purification and characterization of a new κ-carrageenase from the marine bacterium Vibrio sp. NJ-2
Ayaz et al. Purification and characterization of organic solvent-tolerant lipase from Streptomyces sp. OC119-7 for biodiesel production
CN104140959B (en) Novel esterase as well as coding gene and application of esterase
Yao et al. Immobilization and characterization of tannase from a metagenomic library and its use for removal of tannins from green tea infusion
An et al. Characterization and overexpression of a glycosyl hydrolase family 16 beta-agarase YM01-1 from marine bacterium Catenovulum agarivorans YM01T
Kanwar et al. Isolation of a Pseudomonas lipase produced in pure hydrocarbon substrate and its application in the synthesis of isoamyl acetate using membrane-immobilised lipase
Chi et al. Production and characterization of a novel thermostable extracellular agarase from Pseudoalteromonas hodoensis newly isolated from the west sea of South Korea
CN107828806A (en) A kind of β alpha-glucosidase genes of new resistance to glucose and its application
You et al. Characterization and efficient production of an α‐agarase from marine bacterium Catenovulum maritimum STB14
Wang et al. Purification and characterization of chitinase from a new species strain, Pseudomonas sp. TKU008
CN116064471B (en) Lipase OUC-Lipase17 and application thereof in preparation of free astaxanthin
CN100347290C (en) Producing microorganism for trans-glycosylation beta-galactosidase
Gao et al. Identification of a GDSL lipase from Streptomyces bacillaris and its application in the preparation of free astaxanthin
CN104762306B (en) A kind of ocean esterase and its encoding gene E32 and application
CN109971735B (en) Preparation method of cholesterol esterase
Vyas et al. Purification and characterization of α-amylase from a novel thermoalkalophilic strain of Bacillus sonorensis GV2 isolated from mushroom compost
Jyoti et al. Partial purification and characterization of an acidophilic extracellular α-amylase from Bacillus licheniformis JAR-26
Zhu et al. Isolation and characterization of a novel bacterium Burkholderia gladioli Bsp-1 producing alkaline lipase
CN114015673B (en) Lipase Sv-lip5 and application thereof in hydrolysis of astaxanthin ester
CN108913674B (en) Lipid hydrolase and application thereof in synthesis of EPA/DHA glyceride
Fathi et al. Partial purification, characterization and immobilization of a novel lipase from a native isolate of Lactobacillus fermentum
Ajamani et al. Mathematically optimized production, purification and characterization of penicillin G acylase from soil bacterial isolates AA17A and AA17B

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Sun Jianan

Inventor after: Yu Kexin

Inventor after: Mao Xiangchao

Inventor after: Gao Kunpeng

Inventor after: Yan Jiao

Inventor before: Mao Xiangchao

Inventor before: Yu Kexin

Inventor before: Sun Jianan

Inventor before: Gao Kunpeng

Inventor before: Yan Jiao

GR01 Patent grant
GR01 Patent grant