CN116063581A

CN116063581A - GFAP antigen, GFAP antigen expression gene, GFAP antigen expression vector and application

Info

Publication number: CN116063581A
Application number: CN202310126072.XA
Authority: CN
Inventors: 郝峻巍; 刘亮; 徐芳; 赵淑芳
Original assignee: Xuanwu Hospital
Current assignee: Xuanwu Hospital
Priority date: 2022-09-28
Filing date: 2023-02-15
Publication date: 2023-05-05

Abstract

The invention relates to a GFAP antigen, a GFAP antigen expression gene, a GFAP antigen expression vector and application, wherein the GFAP antigen consists of GFAP protein and a multimerization protein motif at the carboxyl end of the GFAP protein. The invention discovers that the addition of the multimerization protein motif can change the wild type diffuse shape of the GFAP protein into a more compact aggregation structure, locally increases the concentration of the GFAP antigen protein and makes positive signals present a unique aggregation form, wherein the aggregation effect of the tetramerization GFAP-Tetramer plasmid is particularly obvious; the invention introduces mCherry fluorescent protein on the basis of the tetramerization of GFAP protein to perform double fluorescence detection, and compared with the existing immunofluorescence detection method, the detection method provided by the invention further increases the detection sensitivity and specificity, so that the detection result interpretation is more definite.

Description

GFAP antigen, GFAP antigen expression gene, GFAP antigen expression vector and application

Technical Field

The invention relates to the technical field of biological analysis and detection, in particular to a GFAP antigen, a GFAP antigen expression gene, a GFAP antigen expression vector and application.

Background

In recent years, the understanding of nervous system diseases is gradually in progress, but the pathogenesis of nervous system diseases is extremely complex, such as nervous system degenerative diseases, neuroinflammation and the like, bring great difficulty to treatment, and more accurate diagnosis and effective treatment are required to be studied continuously and intensively. Glial Fibrillary Acidic Protein (GFAP) is used as a mature astrocyte marker and plays an important role in diagnosis and treatment of nervous system diseases. Glial Fibrillary Acidic Protein (GFAP) is a type iii intermediate filamin, which exists in monomeric form. Glial Fibrillary Acidic Protein (GFAP) is mainly present in mature astrocytes, is an important component of astrocytes and is also a main cytoskeleton, and besides high-level expression in astrocytes in the nervous system, glial acidic protein (GFAP) is also expressed in chondrocytes, fibroblasts, myoepithelial cells, lymphocytes and hepatic astrocytes, and the expression of Glial Fibrillary Acidic Protein (GFAP) is affected by various factors, such as brain injury, neurotumor and other diseases. Astrocyte proliferation is often accompanied by increased expression of Glial Fibrillary Acidic Protein (GFAP). Thus, GFAP can be used as a biomarker for astrocyte proliferation in the event of central nervous system injury.

Glial Fibrillary Acidic Protein (GFAP) is commonly applicable in pathology: GFAP is expressed in astrocytes, ependymal cells, retinal Muller cells, and therefore can be used for diagnosis of tumors of these cell origins and identification of gliomas from meningiomas, but GFAP is not expressed in mature oligodendrocytes (oligodendrocyte negative); GFAP reacts with schwann cells, myoepithelial cells, kupffer and some chondrocytes, and thus diagnosis can be made by GFAP reacting with tumors containing these components (50% soft tissue myoepithelial tumors express GFAP); GFAP can be used as a two-wire labeled antibody for malignant peripheral schwannoma (GFAP is expressed locally in 30% of cases).

GFAP astrocytopathy is a meningiomitis or localized meningoepitheliitis, which is associated with IgG binding to Glial Fibrillary Acidic Protein (GFAP). GFAP is a cytoplasmic protein with 8 different types of cutter, and GFAPa is commonly used as an antigen (Flanagan EP, hinson SR, lennonVA, et al Glial fibrillary acidic protein immunoglobulin G as biomarker Ofautoimmune astrocytopathy: analysis of 102 patients.Ann Neurol. (2017) 81:298-309). GFAP is in a diffuse state in the cytoplasm and has no fixed morphological features. The use of GFAP as an antigen to detect the presence or absence of specific antibodies in serum or cerebrospinal fluid is an important indicator of the characterization of GFAP astrocytopathy. Therefore, GFAP can be used as a biomarker for differential diagnosis of GFAP astrocytopathy, and detection of GFAP antibodies can provide effective help for early diagnosis and subsequent treatment of patients.

Current methods for detecting GFAP antibodies are enzyme linked immunosorbent assay (ELISA) and Cell-based indirect immunofluorescence (CBA). ELISA was prepared by coating in vitro expressed, purified GFAP protein into well plates and air-drying. Compared with ELISA, the CBA method utilizes cells to express the full length of GFAP protein, and protein folding and protein modification are completed in vivo, so that the natural spatial conformation of antigen can be reserved to the greatest extent, and the antigen and antibody reaction is facilitated. Current evidence suggests that CBA is significantly more sensitive than ELISA. Therefore, GFAP cell indirect immunofluorescence is widely used for characterization of GFAP astrocytopathy.

In practical laboratory tests, when a blood sample of a patient is screened by using the CBA method, due to the high concentration of total antibodies in blood (about 10 g/L), a complex protein system exists in serum, and the nonspecific adsorption effect in the process of detecting antibodies is strong, so that noise is high, and a strong background fluorescent signal is usually generated. The GFAP is a cytoplasmic protein, is dispersed in cytoplasm and has no fixed morphological characteristics, when antibody detection is carried out, the condition that a target fluorescent signal is relatively close to a background fluorescent signal is easy to occur, namely positive signals generated by reaction of antibodies in a sample and antigens expressed by cells and cell background staining have no good differentiation, false negatives are easy to occur particularly when detecting positive patients with low titer, and therefore, the problem of how to increase the signal to noise ratio of detection of the GFAP autoimmune antibodies is a urgent problem to be solved.

Furthermore, there are differences in one aspect due to understanding to those skilled in the art; on the other hand, since the applicant has studied a lot of documents and patents while making the present invention, the text is not limited to details and contents of all but it is by no means the present invention does not have these prior art features, but the present invention has all the prior art features, and the applicant remains in the background art to which the right of the related prior art is added.

Disclosure of Invention

In practical laboratory tests, when a Cell-based indirect immunofluorescence (CBA) method is used to screen a patient's blood sample, because the concentration of total antibodies in blood is high (about 10 g/L), a complex protein system exists in serum, the nonspecific adsorption effect in the process of detecting antibodies is strong, the noise is high, and a strong background fluorescent signal is usually generated, so that a positive signal generated by the reaction of antibodies in the sample and antigens expressed by cells is not well distinguished from the background fluorescent signal, and for a positive patient with low titer, the detection result is easy to be false negative, so that how to increase the signal-to-noise ratio of GFAP autoimmune antibody detection is a problem to be solved.

In view of the shortcomings of the prior art, the invention provides a GFAP antigen which is composed of GFAP protein and a multimerization protein motif at the carboxyl terminal of the GFAP protein. The multimeric protein motif is a dimerized, trimerized or tetramerized protein motif. The nucleotide sequence of the dimeric protein motif is shown as SEQ ID NO. 2. The amino acid sequence of the dimerization protein motif is shown as SEQ ID NO. 3. The nucleotide sequence of the trimerization protein motif is shown as SEQ ID NO. 4. The amino acid sequence of the trimerization protein motif is shown as SEQ ID NO. 5. The nucleotide sequence of the tetramerization protein motif is shown as SEQ ID NO. 6. The amino acid sequence of the tetramerization protein motif is shown as SEQ ID NO. 7.

According to the invention, genetic engineering is carried out on the GFAP antigen, a protein motif for promoting protein multimerization is introduced at the carboxyl end of the GFAP antigen, after the multimerization protein motif is added, the GFAP protein is subjected to homologous multimerization in cells, the aggregation morphology of the GFAP antigen is changed to form a special aggregation structure, the GFAP antigen is changed from a wild type diffuse state to a more compact aggregation structure, the concentration of the GFAP antigen protein is locally increased, and a positive signal is enabled to present a unique aggregation morphology, so that the aim of distinguishing a positive signal generated by detection from a background fluorescent signal is fulfilled.

The antigen provided by the invention is provided with a protein label for detection. Preferably, the antigen is his-tagged. Preferably, the antigen is Flag tagged.

The invention also provides a nucleic acid molecule encoding an antigen consisting of a GFAP protein and a multimerization protein motif at the carboxy terminus of the GFAP protein, said antigen bearing a protein tag for detection.

The nucleic acid molecules provided by the invention are connected with fluorescent labels. Preferably, the fluorescent tag is an mCherry fluorescent tag. Preferably, the fluorescent tag is an eCFP fluorescent tag. Preferably, the fluorescent tag is an eYFP fluorescent tag.

The invention also provides a eukaryotic expression vector of the GFAP antigen, which comprises the nucleic acid molecule and a plasmid vector.

According to a preferred embodiment, the N-terminus of the nucleic acid molecule bearing the tetramerisation protein motif is linked to a mCherry fluorescent tag. The full sequence of the mCherry-GFAP-Tetramer gene is shown in SEQ ID NO. 8.

The invention also provides application of the GFAP antigen, the nucleic acid molecule and the eukaryotic expression vector in improving the detection sensitivity of the GFAP specific autoantibody.

The invention also provides a preparation method of the GFAP antigen, which comprises the following steps: obtaining said nucleic acid molecule encoding an antigen consisting of a GFAP protein and a multimerization protein motif at the carboxy terminus of the GFAP protein, performing cleavage and ligation of said nucleic acid molecule for insertion into a plasmid vector to obtain an expression vector, transfecting a host cell with said expression vector, and culturing said host cell to produce the GFAP antigen.

According to the invention, through genetic modification of the GFAP expression plasmid, the detection sensitivity of the CBA method of the GFAP autoantibody is improved. According to the invention, the GFAP antigen is genetically modified through genetic engineering, a protein motif for promoting protein multimerization is introduced into the carboxyl end of the GFAP antigen, after the multimerization protein motif is added, the GFAP protein is subjected to homologous multimerization in cells, the aggregation morphology of the GFAP antigen is changed to form a special aggregation structure, the GFAP antigen is changed from wild type diffuse state to a more compact aggregation structure, the concentration of the GFAP antigen protein is locally increased, and a positive signal is enabled to show a unique aggregation morphology, so that the aim of distinguishing a positive signal generated by detection from a background fluorescent signal is fulfilled. Compared with wild GFAP antigen in a diffuse state, the modified GFAP-Tetramer antigen protein has a more compact aggregation structure, and has higher signal-to-noise ratio in an immunofluorescence experiment, namely positive signals and background fluorescence signals can be obviously distinguished, so that the detection sensitivity of the GFAP specific autoantibody can be obviously improved.

In addition, the invention discovers that the aggregation effect of the tetramerized GFAP-tetra plasmid is particularly obvious, so that on the basis of the tetramerization label, the invention introduces the mCherry fluorescent label which does not exist in human body, on one hand, the transfection efficiency and the expression level of the plasmid are convenient to observe, and on the other hand, a bicolor fluorescence observation means is added, and the GFAP fusion protein expressed by cells and the mCherry fluorescent protein act together, so that the invention has good co-localization effect and can detect obvious positive signals. The mCherry-GFAP-Tetramer plasmid and the modified antigen are prepared into a detected cell material, so that the detection sensitivity and specificity are further increased compared with the existing method for performing immunofluorescence detection by directly using the GFAP full-length protein, the detection result is easier to interpret and more clear, and the method can be used for detecting the GFAP autoantibody of a patient efficiently.

Drawings

FIG. 1 is a GFAP-Internal Disorder Region (IDR) prediction graph provided by the present invention;

FIG. 2 is a map of the GFAP-multimerization-his plasmid provided by the present invention;

FIG. 3 is a graph showing the results of wild-type and multimerized GFAP immunofluorescence (Anti-his) and tetramerized GFAP antigen expression levels provided by the present invention;

FIG. 4 is a map of the mCherry-GFAP-Tetramer plasmid provided by the present invention;

FIG. 5 is a diagram showing the immunofluorescence of the tetramerization GFAP and the expression level of the tetramerization GFAP antigen (Anti-GFAP verification);

FIG. 6 is a graph of the serum test of anti-GFAP positive patients provided by the present invention.

Detailed Description

The following detailed description refers to the accompanying drawings.

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention, and preferred embodiments of the present invention are set forth. The present invention is not limited to the embodiments described herein, which are provided for a more thorough and complete understanding of the present disclosure. Unless defined otherwise, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in the description presented herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The present invention uses PONDR to predict GFAP protein, which has a long Internal Disorder Region (IDR) within it, as shown in fig. 1, indicating that GFAP protein is a potential phase change protein, but its phase change ability is insufficient to allow itself to form a droplet structure of liquid droplet, and the present invention attempts to use smaller coid-coil motifs, which are usually heptapeptide repeats of hydrophobic (H) and polar (P) residues, HPPHPPP, most of which contain more than 4 consecutive heptapeptide repeats, to aggregation concentration operations of GFAP protein, which have been found to form different valency homomultimers, such as dimerization, trimerization, and the like. The invention discovers that the distribution of the expression GFAP after transfection can be obviously changed by introducing a multimerization motif, and an aggregation structure similar to phase change occurs in cells.

The main reagents, instruments and sources used in the invention are as follows: PCR enzyme:

max DNA Polymerase (Takara, cat# R045A); KOD DNA Polymerase (brand Toyobo, product number KOD-201); nhe I (NEB product number R3131); not I (NEB product number R3189); t4 DNA ligase (NEB cat# M0202T); cell line: HEK293T and Hep2 cells; glue recovery kit: omega Gel Extraction Kit; plasmid: pEGFP-N1 (available from Clontech, cat# 6085-1); plasmid extraction kit: omega plasmid mini kit; pure water meter: millipore->

5UV Water Purification System; pipetting: eppendorf; PCR instrument: bio-Rad T100; his anti body (Enginbody product number AT 0025); GFAP anti (thermo Fisher product number 13-0300); fluorescent secondary antibody Alexa Fluor ^TM 488 (ThermoFisher product number A-11001).

The invention provides a GFAP antigen, which consists of GFAP protein and a multimerization protein motif at the carboxyl terminal of the GFAP protein. The invention carries out fusion expression on the domains of a plurality of Coiled-Coil and GFAP antigens to obtain a plurality of GFAP protein multimerization expression plasmids, transfects host cells and cultures the host cells to generate the GFAP antigens, wherein the antigens consist of GFAP proteins, multimerization protein motifs and his tags or mCherry tags. The produced GFAP antigen was immunofluorescent with serum positive for anti-his antibodies, commercial GFAP antibodies and autoimmune GFAP antibodies.

Example 1

Analysis of disordered regions within GFAP protein:

downloading the sequence of GFAP protein (NP_ 002046.1) from NCBI database, storing in FASTA format, inputting the sequence into on-line website (http:// www.pondr.com /), selecting the Predictor: VLXT, input protein name: GFAP was attached to the protein sequence of GFAP, and the analysis result was obtained after the sub was performed, and as shown in FIG. 1, GFAP protein contained 3 consecutive IDR regions, and it was predicted that GFAP protein might be phase change protein. However, no obvious phase change was found in native GFAP transfected 293 cells (GFAP-his in FIG. 1), resulting in a liquid droplet or aggregation structure. GFAP is therefore presumed to have the potential for phase transition, but is not sufficient in its phase transition capacity and requires additional stimulation means.

Example 2

The GFAP antigen protein multimerization screening procedure was as follows:

1. the gene of GFAP and coupled dimerization, trimerization and tetramerization labels is obtained through artificial synthesis, the optimized nucleotide sequence of GFAP is shown as SEQ ID NO.1, and the optimized nucleotide sequence corresponds to GFAP protein (NP_ 002046.1); the label sequences of dimerization, trimerization and tetramerization are respectively shown as SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO. 7. The gene synthesis is completed by general biological company, subcloning is completed, the subcloning is inserted into pEGFP-N1 plasmid vector, the insertion site is NheI/NotI, the GFP label carried by the vector is removed, and the his label is uniformly carried on the C end of the gene (general company production numbers G0234847, G0230887, G0233840); three plasmids carrying the target gene were obtained, designated as GFAP-dimer-his, GFAP-oligomer-his and GFAP-Tetramer-his, respectively, and the plasmid maps are shown in FIG. 2.

2. Respectively taking GFAP-dimer-his, GFAP-oligomer-his and GFAP-Tetramer-his, and transfecting the cultured HEK293 cells according to a PEI transfection reagent transfection method to obtain HEK293 cells expressing genes of GFAP-dimer-his, GFAP-oligomer-his and GFAP-Tetramer-his, wherein the temperature is 37 ℃ and the concentration is 5% CO ₂ Culturing for 24h.

Transfection methods also include lipofectamin2000, lipofectamin3000, other liposome transfection reagents, electrotransfection or other transfection methods.

3. Cells were incubated for 24h after transfection, fixed with 2% PFA for 10 min, and plated with triton-100PBS containing 0.2%.

His antibody immunofluorescent staining.

(1) his anti body (Enginbody product number AT 0025) 1: diluting at 1000, and incubating the cell climbing sheet for 1h;

(2) Washing with PBS for 3 times, each time for 5min;

(3) Fluorescence labeled secondary antibody Alexa Fluor 488 (available from Thermo fisher company) 1: diluting at 1000, and incubating for 45min;

(4) Washing with PBS for 3 times, each time for 5min;

(5) The observation result under the microscope is photographed, and the photographing result is shown in fig. 3.

FIG. 3 is a diagram showing the immunofluorescence of wild-type and multimerized GFAP (Anti-his) which is obtained by reacting wild-type GFAP expressed from the GFAP-his plasmid with his antibody; GFAP-dimer is the result of reaction of dimerized GFAP expressed from the GFAP-dimer-his plasmid with his antibody (Enginbody product number AT 0025); GFAP-primer is the result of the reaction of trimerized GFAP expressed from the GFAP-primer-his plasmid with his antibody; GFAP-Tetramer is the result of the reaction of a tetramerized GFAP expressed from the GFAP-Tetramer-his plasmid with his antibody. The left results in FIG. 3 show that the fluorescence signals of GFAP-dimer, GFAP-oligomer and GFAP-Tetramer show a tendency to aggregate gradually as compared with the fluorescence signals shown by GFAP-his, wherein the fluorescence signals of GFAP-Tetramer aggregate brightly and GFAP-his are weakest, indicating that the aggregation morphology of GFAP antigen changes from a diffuse state to a dense aggregation state after addition of multimeric protein motifs, and the GFAP antigen has a more aggregated fluorescence signal after reaction with an antibody after addition of tetrameric protein motifs as compared with wild type, and the GFAP protein is found to change from a diffuse state to a more dense aggregation state. The experimental results of fig. 3 demonstrate that with the introduction of the multimerization tag, the GFAP protein is transformed from a diffuse state to a dense aggregation state, and that the tetramerized GFAP aggregation state is particularly evident. Meanwhile, we collected 293 cells transfected with GFAP-Tetramer-his and GFAP-his plasmids, and conducted Western Blot experiments using commercial GFAP antibodies (Thermofiser, 13-0300), and FIG. 3 shows the results of the expression level of tetramerized GFAP antigen, which shows that the addition of multimerization motifs did not increase the expression of GFAP antigen, but changed the dispersion distribution of GFAP proteins to an aggregated state. In addition, the present invention has found that fluorescent tags such as GFP that can dimerize can promote aggregation of GFAP proteins.

This example constructs eukaryotic expression plasmids for GFAP conjugated his tag and provides a series of fusion proteins for GFAP-his protein with different multimerization protein tags (tags at the carboxy terminus). GFAP can be linked to a Flag tag which does not normally interact with a target protein and does not normally affect the function or property of the target protein, and Flag as a tag protein can be recognized by an anti-Flag antibody, so that FLAG-containing fusion proteins can be detected and identified by Western Blot, ELISA, CBA or the like. The left side of the figure 5 is a tetramerized GFAP immunofluorescence diagram, the right side of the figure 5 is a tetramerized GFAP antigen expression level diagram, and after immunofluorescence experimental screening, the effect of the GFAP antigen protein aggregation is particularly obvious after the tetramerized protein motif is added, as shown in the left side of the figure 5; after transfecting cells with a GFAP-his fusion expression plasmid having a tetramerization tag (28 amino acids), it was found that the plasmid, although not increasing the expression level of GFAP antigen protein, was shown on the right in FIG. 5, the introduction of an additional tetramerization protein motif enabled the GFAP protein to be converted from a diffuse state into an aggregate structure.

Example 3

The present example provides a GFAP antigen consisting of GFAP protein and a tetramerization protein motif at the carboxyl terminus of GFAP protein, the antigen having a his tag. The nucleotide sequence of the tetramerization protein motif is shown as SEQ ID NO. 6. The amino acid sequence of the tetramerization protein motif is shown as SEQ ID NO. 7. The preparation method of the antigen of this example is the method provided in example 2.

Example 4

The present example provides a GFAP antigen consisting of GFAP protein and a dimerized protein motif at the carboxyl terminus of GFAP protein, the antigen having a his tag. The nucleotide sequence of the dimeric protein motif is shown as SEQ ID NO. 2. The amino acid sequence of the dimerization protein motif is shown in SEQ ID NO. 3. The preparation method of the antigen of this example is the method provided in example 2.

Example 5

The present example provides a GFAP antigen consisting of GFAP protein and trimerized protein motifs at the carboxy terminus of GFAP protein, the antigen bearing a his tag. The nucleotide sequence of the trimerization protein motif is shown as SEQ ID NO. 4. The amino acid sequence of the trimerization protein motif is shown in SEQ ID NO. 5. The preparation method of the antigen of this example is the method provided in example 2.

Example 6

This example provides a nucleic acid molecule encoding an antigen consisting of a GFAP protein and a tetramerization protein motif at the carboxy terminus of the GFAP protein, said antigen bearing a his tag. The method for preparing the nucleic acid molecule of this example is provided in example 2.

Example 7

This example provides a nucleic acid molecule encoding an antigen consisting of a GFAP protein and a dimerized protein motif at the carboxy terminus of the GFAP protein, said antigen bearing a his tag. The method for preparing the nucleic acid molecule of this example is provided in example 2.

Example 8

This example provides a nucleic acid molecule encoding an antigen consisting of GFAP protein and trimerized protein motifs at the carboxy terminus of GFAP protein, the antigen bearing a his tag. The method for preparing the nucleic acid molecule of this example is provided in example 2.

Example 9

This example provides eukaryotic expression vectors for GFAP antigens, including nucleic acid molecules and plasmid vectors. The nucleic acid molecule encodes an antigen consisting of GFAP protein and a tetramerization protein motif at the carboxyl end of GFAP protein, and the antigen is provided with a his tag. The preparation method of the expression vector of this example is provided in example 2.

Example 10

This example provides eukaryotic expression vectors for GFAP antigens, including nucleic acid molecules and plasmid vectors. The nucleic acid molecule encodes an antigen consisting of GFAP protein and a dimerized protein motif at the carboxyl terminus of GFAP protein, the antigen bearing a his tag. The preparation method of the expression vector of this example is provided in example 2.

Example 11

This example provides eukaryotic expression vectors for GFAP antigens, including nucleic acid molecules and plasmid vectors. The nucleic acid molecule encodes an antigen consisting of GFAP protein and trimerized protein motif at the carboxyl terminus of GFAP protein, the antigen bearing his tag. The preparation method of the expression vector of this example is provided in example 2.

Example 12

The detection of GFAP antibody requires preparation of GFAP antigen or antigen-expressing cells, and the embodiment provides a preparation method of GFAP autoantibody detection material, comprising the following steps:

1. on the basis of the GFAP-tetra-his, a red light tag mCherry was introduced, and a primer was designed using an overlap extension PCR method (20211063385.3), mCherry-F: GTGAACCGTCAGATCCGCTAGCACCGCCatggtgagcaagggcgaggagg, mCherry-R: GCGGAGGTGATGCGTCTCCTCTCCATAGAGCCTCCACCCCCCTTGTACAGCTCGTCCATGCCGC.

First round PCR reaction

(1) First, diluting the first round PCR amplification primer to a final concentration of 10 mu M according to the concentration;

(2) The mixed PCR system is as follows:

(3) Mixing the mixed PCR reaction system, and starting PCR amplification after transient instantaneous centrifugation;

the PCR reaction procedure is as follows:

pre-denaturation:	94℃，2min.
		denaturation:	98℃，10sec.
annealing:	60℃*，10sec.
		extension:	72℃，20s(1Kb/1Os)
cycle number:	35 cycles
		Extension:	72℃，2min
preservation conditions:	10℃

after the PCR is completed, electrophoresis runs, cuts the gel, and retrieves the PCR product according to the gel retrieval kit instruction.

3. Second round PCR reaction

(1) The reaction system is as follows:

reagent(s)	Volume (mul)
		KOD buffer	5
2mM dNTPs	5
		25mM MgSO ₄	2
First round PCR recovery of product	16
		10-50 ng/. Mu.l GFAP-Tetramer-his plasmid	1
KOD DNA Polymerase	1
		ddH ₂ O	20
Total volume of	50

(2) The PCR reaction procedure is as follows:

pre-denaturation:	94℃，2min.
		denaturation:	98℃，10sec.
annealing:	55℃，20sec.
		extension:	68℃，7min30s
cycle number	13 cycles
		Extension:	68℃，10min
preservation conditions:	10℃

dpn1 digestion: after the second round of PCR reaction is completed, 1 μl of Dpn1 enzyme is added into the reaction tube for reaction at 37 ℃ for 1h, and the template plasmid in the PCR reaction system is thoroughly removed.

5. Conversion: the PCR product after digestion with 10. Mu.l of Dpn1 was used to transform E.coli competent cells, which were resuscitated and plated onto Kan-resistant LB solid culture plates.

6. Single colonies are picked, added into LB culture medium containing Kan antibiotics, and cultured at 37 ℃ by shaking overnight.

7. The recombinant plasmid mCherry-GFAP-Tetramer-his is extracted and sent to sequencing, and recombinants with correct sequencing results are screened.

The mCherry fluorescent tag was seamlessly connected to the N-terminal of the GFAP-tetra-his gene, a new plasmid was obtained and named mCherry-GFAP-tetra, and after sequencing was correct, the plasmid was extracted for subsequent experiments, and the plasmid map is shown in FIG. 4.

8. And (3) taking mCherry-GFAP-Tetramer plasmid, and transfecting the cultured HEK293 cells according to a PEI transfection reagent transfection method to obtain HEK293 cells expressing mCherry-GFAP-Tetramer genes.

9. And (3) fixing and tabletting the transfected cells for 24 hours by using a fixing solution to prepare the cell climbing tablet. The fixing liquid is fixing agents such as acetone, formaldehyde, paraformaldehyde, methanol, ethanol and the like.

The fixed cell climbing sheet is subjected to immunofluorescence staining, and the specific steps are as follows:

(1) Incubating the immobilized climbing slices with GFAP positive human serum (diluted 1:10), wherein the incubation time is 1h;

(2) PBST is washed for 3 times, each time for 5min;

(3) Incubating the secondary goat anti-human IgG marked by green Fluorescence (FITC) for 45min; PBST is washed for 3 times, each time for 5min;

(4) The results were observed under a microscope and photographed.

As shown in FIG. 6, alexa Fluo 488 is the result of detection of the reaction of GFAP expressed by mCherry-GFAP-Tetramer-his plasmid with GFAP antibody in serum, mCherry is the autofluorescence of GFAP expressed by mCherry-GFAP-Tetramer plasmid, and Mered is the effect of combining autofluorescence and detected signals. As is clear from the experimental results, the concentration of GFAP antibody in the sample was different, and the fluorescence intensity and the number of positive cells were different. As can be seen from fig. 6, the GFAP antibody signals with different concentrations can be effectively detected by the GFAP-tetra-his antigen expressing cells, so that the problem that the GFAP positive signals and the background fluorescent signals of the patients with low titer positive are not easily distinguished is solved, and as shown in sample 3 in fig. 6, the detection of the GFAP-tetra-his antigen for anti-GFAP positive serum has good sensitivity, specificity and accuracy, and an effective solution is provided for judging whether the GFAP antibody exists in the patients.

The invention constructs eukaryotic expression plasmid of GFAP antigen protein based on Cell Based Assay (CBA) detection system, and creatively introduces fusion expression protein motif promoting protein dimerization, trimerization and tetramerization into carboxyl terminal of GFAP protein. After the multimerization protein motif is added, the GFAP antigen protein is subjected to homologous multimerization in cells, so that the GFAP protein is changed into a denser aggregation structure from a wild type diffuse shape, the concentration of the GFAP antigen protein is locally increased, positive signals are in a unique aggregation form, and the aggregation effect of the tetramerized GFAP-Tetramer plasmid is particularly obvious. In the embodiment, in the detection of an actual patient sample, the mCherry fluorescent tag is introduced on the basis of the tetramerization of the GFAP protein, so that the mCherry-GFAP-Tetramer expression vector is obtained, the problem that the cytoplasmic protein GFAP positive signal is not obvious is solved, and a qualitative solution is provided for accurately judging whether the GFAP antibody exists in a patient.

The method provided by the invention can enhance the GFAP cell immunofluorescence signal and provides an effective identification method for GFAP autoantibody detection. Compared with the conventional immunofluorescence method, the GFAP antigen expressed by the mCherry-GFAP-Tetramer expression vector provided by the invention has higher sensitivity and specificity when detecting antibodies. When conventional immunofluorescence methods are unable to confirm the presence of GFAP antibodies in a patient sample, mCherry-GFAP-Tetramer expressing neoantigen cells can be used as a material for further identification. Compared with the existing method for performing immunofluorescence detection by directly using the GFAP full-length protein, the method provided by the invention further increases the detection sensitivity and specificity, so that the detection result is more clear in interpretation, and the patient GFAP autoantibodies can be efficiently detected.

Example 13

This example provides eukaryotic expression vectors for GFAP antigens, including nucleic acid molecules and plasmid vectors. The nucleic acid molecule encodes an antigen consisting of GFAP protein and a tetramerization protein motif at the carboxyl end of GFAP protein, and the antigen is provided with a his tag. The eukaryotic expression vector is linked to a mCherry fluorescent tag. The full sequence of the mCherry-GFAP-Tetramer gene is shown in SEQ ID NO. 8. In addition, the fluorescent label can be an eCFP fluorescent label, an eYFP fluorescent label and the like, the fluorescent labels can display the expression condition of a target gene in real time, and the fluorescent label has the advantages of stable fluorescent property, rapidness, simplicity, high sensitivity and the like in detection. The preparation of the expression vector provided in this example is provided in example 12.

Example 14

The GFAP antigen, the nucleic acid molecule and the eukaryotic expression vector provided by the embodiment are applied to improving the detection sensitivity of the GFAP specific autoantibody. GFAP antigens include the antigens provided in examples 2-5. The nucleic acid molecules include the nucleic acid molecules provided in examples 6-8. Eukaryotic expression vectors include the expression vectors provided in examples 9-13. The experiment is to carry out genetic modification on the GFAP antigen through genetic engineering, a protein motif for promoting protein polymerization is introduced into the carboxyl end of the GFAP antigen, after the multimerization protein motif is added, the GFAP protein is subjected to homologous multimerization in cells, the aggregation morphology of the GFAP antigen is changed to form a special aggregation structure, the GFAP antigen is changed from a wild type dispersive state to a more compact aggregation structure, the concentration of the GFAP antigen protein is locally increased, and a positive signal is enabled to show a unique aggregation morphology, so that the aim of distinguishing a positive signal generated by detection from a background fluorescent signal is fulfilled. Compared with a diffuse wild GFAP antigen, the modified mCherry-GFAP-Tetramer antigen protein has a denser aggregation structure, and an auxiliary judgment means of endogenous red light is added, so that the modified mCherry-GFAP-Tetramer antigen protein has higher signal to noise ratio in an immunofluorescence experiment, namely positive signals and background fluorescence signals can be obviously distinguished, and the detection sensitivity and accuracy of GFAP specific autoantibodies can be obviously improved.

It should be noted that the above-described embodiments are exemplary, and that a person skilled in the art, in light of the present disclosure, may devise various solutions that fall within the scope of the present disclosure and fall within the scope of the present disclosure. It should be understood by those skilled in the art that the present description and drawings are illustrative and not limiting to the claims. The scope of the invention is defined by the claims and their equivalents. The description of the invention encompasses multiple inventive concepts, such as "preferably," "according to a preferred embodiment," or "optionally," all means that the corresponding paragraph discloses a separate concept, and that the applicant reserves the right to filed a divisional application according to each inventive concept. Throughout this document, the word "preferably" is used in a generic sense to mean only one alternative, and not to be construed as necessarily required, so that the applicant reserves the right to forego or delete the relevant preferred feature at any time.

Claims

1. A GFAP antigen, wherein the antigen consists of a GFAP protein and a multimerizing protein motif at the carboxy terminus of the GFAP protein.

2. The antigen of claim 1, wherein the multimerization protein motif is a dimerized, trimerized, or tetramerized protein motif.

3. The antigen of claim 2, wherein the nucleotide sequence of the dimerizing protein motif is set forth in SEQ ID No. 2.

4. The antigen of claim 2, wherein the nucleotide sequence of the trimerization protein motif is set forth in SEQ ID No. 4.

5. The antigen of claim 2, wherein the nucleotide sequence of the tetramerization protein motif is set forth in SEQ ID No. 6.

6. The antigen according to any one of claims 1 to 5, wherein the antigen carries a protein tag for detection.

7. A nucleic acid molecule encoding an antigen according to any one of claims 1 to 6.

8. The nucleic acid molecule of claim 7, wherein the nucleic acid molecule is linked to a fluorescent tag.

9. Eukaryotic expression vector for a GFAP antigen, characterized in that it comprises a nucleic acid molecule according to claim 7 or claim 8 and a plasmid vector.

10. Use of a GFAP antigen according to any one of claims 1 to 6, a nucleic acid molecule according to claim 7, a eukaryotic expression vector according to claim 8 or claim 9 to increase the detection sensitivity of a GFAP specific autoantibody.