CN116059366A

CN116059366A - Construction of nano-drug carrying p16-siRNA and application of nano-drug in treatment of post-infarction ventricular remodeling

Info

Publication number: CN116059366A
Application number: CN202210823642.6A
Authority: CN
Inventors: 靳建亮; 顾鑫; 王晓彦; 王芳; 张晓东; 周佳雯; 王秋懿
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2022-07-14
Filing date: 2022-07-14
Publication date: 2023-05-05

Abstract

The invention discloses construction of a nano-drug carrying p16-siRNA and application thereof in treating post-infarction ventricular remodeling, and belongs to the technical field of medicines. The research of the inventor discovers that the nano-drug carrying the p16-siRNA can target fibroblasts in myocardial infarction areas and knock down the expression of the p16 cells after intravenous injection, inhibit NLRP 3-inflammatory small body passages in myocardial infarction areas, remarkably reduce myocardial inflammation, improve cardiac function and reduce myocardial infarction areas and peripheral area fibrosis, thereby treating myocardial infarction post ventricular remodeling and providing a new treatment scheme for clinically treating myocardial infarction post ventricular remodeling.

Description

Construction of nano-drug carrying p16-siRNA and application of nano-drug in treatment of post-infarction ventricular remodeling

Technical Field

The invention belongs to the technical field of medicines, relates to application of a nano-drug carrying p16-siRNA and a product thereof, and in particular relates to construction of the nano-drug carrying p16-siRNA and application of the nano-drug in treating ventricular remodeling after infarction.

Background

Cardiovascular system diseases are the first factors causing death, and according to the data published in China cardiovascular disease report 2017, the proportion of cardiovascular disease death in rural areas and cities in China is up to 45% and 42% respectively, namely, in the annual death population, almost half of the death causes are caused by cardiovascular diseases. Myocardial infarction (myocardial infarction, MI) is the leading cause of death from cardiovascular disease, with the incidence and extent of ventricular remodeling being closely related to aging and increasing with age. Nearly half of MI patients experience poor ventricular remodeling leading to cardiomyocyte hypertrophy, interstitial fibrosis, left ventricular dilation and heart failure. As an important risk factor for MI, inflammatory aging is an important cause of deterioration of ventricular remodeling, significantly increasing mortality in patients. In the standardized use of traditional Angiotensin Converting Enzyme Inhibitors (ACEI), beta receptor blockers (beta-blockers), and biosulfan, the progress of ventricular remodeling after infarction still cannot be controlled, and therefore, there is a need to find key drug therapeutic targets and targeted drugs for controlling ventricular remodeling after infarction.

At present, the application of p16 serving as a novel key target for clinically preventing and treating post-MI ventricular remodeling, and a nano-drug carrying p16-siRNA and a report of product treatment of post-MI ventricular remodeling are not related.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provides application of a nano-drug carrying p16-siRNA and a product thereof.

The technical scheme of the invention is as follows:

a first object of the present invention is to provide the use of p16 as a therapeutic target in the preparation or screening of a medicament for the treatment of ventricular remodeling following myocardial infarction.

It is a second object of the present invention to provide the use of p16 as a target in screening a preparation for down-regulating the expression level of one or more proteins from the group consisting of alpha-SMA, POSTN, collagen I, IL-1β, IL-6, TNF-alpha, NLRP3, ASC, caspase-1.

It is a third object of the present invention to provide a medicament for treating ventricular remodeling after myocardial infarction, comprising a nucleic acid molecule that inhibits or silences p16 expression. The nucleic acid molecule for inhibiting or silencing p16 expression is taken as a main active ingredient.

Further, the medicine is a nano medicine.

Further, the nucleic acid molecule that silences p16 expression is a p16-siRNA.

Further, the p16-siRNA targets the p16 coding region sequence fragment 5'-TCTCAGAGGATCCCGGAAATTT-3' (SEQ ID NO. 4)

Further, the p16-siRNA sequence is as follows:

sense strand:

5′-TGCTGAGCGGAACGCAAATATCGCACGTTTTGGCCACTGACTGACGTGCGATATGC GTTCCGCTdTdT-3′(SEQ ID NO.1)；

antisense strand:

5′-dTdTTGCTGAGCGGAACGCAAATATCGCACGTTTTGGCCACTGACTGACGTGCGAT ATGCGTTCCGCT-3′(SEQ ID NO.2)。

further, the Negative Control (NC) -siRNA sequence is:

sense strand:

5′-UUCUCCGAACGUGUCACGUTTdTdT-3′(SEQ ID NO.5)；

antisense strand:

5′-dTdTACGUGACACGUUCGGAGAATT-3′(SEQ ID NO.6)。

further, the drug is a nanoparticle carrying p16-siRNA.

Further, the drug also comprises a delivery system comprising FH peptide, lipid membrane (Li), neutrophil Membrane Protein (NMP), mesoporous Silica Nanoparticle (MSN);

preferably, the drug is a mesoporous silica nanoparticle loaded with p16-siRNA, the lipid membrane coats the mesoporous silica nanoparticle loaded with p16-siRNA, the FH peptide is coated by the lipid membrane to obtain a lipid membrane coated FH peptide, and the lipid membrane coated FH peptide and neutral granulocyte membrane protein (NMP) are embedded into the lipid membrane coated with the mesoporous silica nanoparticle loaded with p16-siRNA, and the drug is abbreviated as FNLM-sip16 (figure 12).

Further, the FH peptide includes phenylalanine (F) histidine (H).

Further, the FH peptide has an amino acid sequence of FHKHKSPALPPV (SEQ ID NO. 3).

In a specific embodiment, the nanoparticle carrying p16-siRNA is p16-siRNA carrying SEQ ID NO.1 and SEQ ID NO.2, and comprises a delivery system consisting of FH peptide shown in SEQ ID NO.3, neutral granulocyte membrane protein (NMP), lipid membrane (Li) and Mesoporous Silica Nanoparticle (MSN), wherein the delivery system is called FNLM, and the nanoparticle carrying p16-siRNA is called FNLM-sip16.

Intravenous injection of the FNLM-sip16, capable of targeting fibroblasts of the MI region and knocking down expression of p16 in the cells; meanwhile, the NLRP 3-inflammatory small body signal pathway in the MI area can be inhibited, and the myocardial inflammation can be obviously reduced, the heart function can be improved, and the fibrosis degree of the MI area and surrounding areas can be reduced.

A fourth object of the present invention is to provide the use of a substance that inhibits or silences p16 expression in the preparation of a medicament for treating ventricular remodeling following myocardial infarction.

Further, the substance for silencing p16 gene expression is a nucleic acid molecule for inhibiting or silencing p16 expression or a drug for treating ventricular remodeling after myocardial infarction.

Compared with the prior art, the technical scheme of the invention has the beneficial effects that:

the invention discovers that an aging marker molecule p16 plays an important role in the ventricular remodeling process after MI, and p16 aggravates inflammatory aging of cardiac fibroblasts in a post MI ventricular remodeling region and an aging-related secretion phenotype thereof, and the role is closely related to a new regulatory mechanism that p16 promotes transcription to regulate NLRP3 expression so as to activate NLRP3 inflammatory body signal paths, so that the invention determines p16 as a novel key target for clinically preventing and treating post MI ventricular remodeling.

Aiming at the problem that a small molecular drug or a bioactive drug for specifically inhibiting p16 of heart fibroblasts after MI is not available clinically at present, the invention constructs a nano drug for targeting heart fibroblasts after myocardial infarction, namely phenylalanine (F) histidine (H) peptide-neutral granulocyte membrane protein (NMP) -lipid (Li) membrane-mesoporous silica nano particle (MSN) core-p 16-siRNA, namely FNLM-sip16, carrying p16-siRNA.

We demonstrate by scientific experiments that: the nano medicine p16-siRNA-FNLM can target fibroblasts in myocardial infarction area and inhibit the expression of p16 of the cells by intravenous injection, thereby down regulating NLRP 3-inflammatory body signal path in myocardial infarction area, inhibiting the expression of pro-inflammatory factors IL-1 beta, IL-6 and TNF-alpha of aging related secretion phenotype, improving cardiac function, reducing fibrosis degree of MI area and surrounding area, further treating ventricular remodeling after MI and improving cardiac function. Meanwhile, the research shows that the nano-drug has no obvious hepatotoxicity and renal toxicity in vivo, and the safety of the nano-drug is high.

The invention provides a new treatment scheme for clinical treatment of post-MI ventricular remodeling.

Drawings

FIG. 1 is a representative image of echocardiography after 4 weeks of myocardial infarction (FIG. 1A) and Left Ventricular Ejection Fraction (LVEF) and left ventricular foreshortening fraction (LVFS) statistics (FIG. 1B) of WT and p16 knockout (p 16-KO) mice;

FIG. 2 is a representative microscopic image of Masson staining of cardiac tissue after 4 weeks from myocardial infarction in WT and p16-KO mice (FIG. 2A) and a statistical plot of the area of fibrosis (FIG. 2B);

FIG. 3 is a representative microscopic image of the immunohistochemical staining of the Collagen I and the statistical plot of the ratio of the total positive areas (FIG. 3A) after 4 weeks on myocardial infarction area (FIG. 3B) in WT and p16-KO mice;

FIG. 4 is a representative microscopic image of myocardial infarction area α -SMA immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice (FIG. 4A) and statistical plot of total positive area ratio (FIG. 4B);

FIG. 5 shows Western blot detection results (FIG. 5A) of myocardial infarction area alpha-SMA and Collagen I protein expression levels after 4 weeks of myocardial infarction in WT and p16-KO mice (FIG. 5B);

FIG. 6 is a statistical plot of serum BNP levels after 4 weeks from myocardial infarction in WT and p16-KO mice;

FIG. 7 is a representative microscopic image of myocardial infarction area IL-1. Beta. Immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice (FIG. 7A) and statistical plot of total positive area ratio (FIG. 7B);

FIG. 8 is a representative microscopic image of myocardial infarction area IL-6 immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice (FIG. 8A) and statistical plot of the ratio of positive area to total area (FIG. 8B);

FIG. 9 is a representative microscopic image of myocardial infarction area TNF-. Alpha.immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice (FIG. 9A) and statistical plot of the ratio of positive area to total area (FIG. 9B);

FIG. 10 shows the results of Western blot detection of protein expression levels of pro-IL-1β, IL-1β and TNF- α in the infarct zone after 4 weeks from the myocardial infarction of WT and p16-KO mice (FIG. 10A) and the statistical chart (FIG. 10B);

FIG. 11 shows Western blot detection results (FIG. 11A) and statistical graphs (FIG. 11B) of protein expression levels of the infarct region NLRP3 signaling pathway molecules NLRP3 and ASC after 4 weeks from myocardial infarction of WT and p16-KO mice;

FIG. 12 is a diagram of a FNLM-sip16 build mode;

FIG. 13 is a representative image of an FNLM-sip16 transmission electron microscope;

FIG. 14 is a Zeta potential statistical plot of MSNs, MSNs-sip16 and FNLM-sip 16;

FIG. 15 is a diameter statistics of MSNs, MSNs-sip16 and FNLM-sip 16;

FIG. 16 is an immunofluorescence representative microscopic image of CY3 fluorescently labeled FNLM-sip16 after co-incubation with cardiac fibroblasts;

FIG. 17 is an immunofluorescent-stained representative microscopic image of the Negative Control (NC) group FNLM-siNC or FNLM-sip16 labeled with CY3 in the infarct zone and non-infarct zone of the mouse heart;

FIG. 18 is an HE staining image of liver and kidney of mice after treatment with FNLM-siNC or FNLM-sip 16;

FIG. 19 is a statistical plot of serum glutamic pyruvic transaminase (ALT) levels of mice after treatment with FNLM-siNC or FNLM-sip 16;

FIG. 20 is a statistical plot of serum glutamate oxaloacetic transaminase (AST) levels of mice after FNLM-siNC or FNLM-sip16 treatment;

FIG. 21 is a statistical plot of serum creatinine levels in mice after treatment with FNLM-siNC or FNLM-sip 16;

FIG. 22 is a statistical plot of serum urea nitrogen levels in mice treated with FNLM-siNC or FNLM-sip 16;

FIG. 23 is a representative image of echocardiography of mice in each treatment group (FIG. 23A) and Left Ventricular Ejection Fraction (LVEF) statistics (FIG. 23B) and left ventricular foreshortening fraction (LVFS) statistics (FIG. 23C);

FIG. 24 is a statistical plot of serum BNP levels in mice of each treatment group;

FIG. 25 is a representative microscopic image of cardiac tissue Masson staining (FIG. 25A) and a statistical map of the area of fibrosis (FIG. 25B) after 4 weeks in myocardial mice;

FIG. 26 is a Western blot detection result (FIG. 26A) and a statistical chart (FIG. 26B) of myocardial infarction area alpha-SMA, POSTN and Collagen I protein expression levels after 4 weeks in myocardial infarction mice;

FIG. 27 is a representative microscopic image of the immunohistochemical staining of α -SMA, POSTN, and Collagen I in myocardial infarction area after 4 weeks in myocardial infarction mice (FIG. 27A) and statistical plot of the ratio of positive area to total area (FIG. 27B);

FIG. 28 shows Western blot detection results (FIG. 28A) and statistical plots (FIG. 28B) of protein expression levels of infarct zone NLRP3 signaling pathway molecules NLRP3, ASC, caspase-1, TNF- α, pro-IL-1β, IL-1β and IL-6 after 4 weeks in myocardial infarction mice;

FIG. 29 is a representative microscopic image of TNF- α, IL-1β and IL-6 immunohistochemical staining of myocardial infarction area after 4 weeks in myocardial infarction mice (FIG. 29A) and statistical plot of the ratio of positive area to total area (FIG. 29B);

FIG. 30 is a representative microscopic image of NLRP3, ASC and Caspase-1 immunohistochemical staining of myocardial infarction area after 4 weeks in myocardial infarction mice (FIG. 30A) and statistical plot of the ratio of positive area to total area (FIG. 30B);

FIG. 31 is a Western blot detection result (FIG. 31A) and a statistical chart (FIG. 31B) of protein expression levels of the infarct zone p16 after 4 weeks in the myocardial infarction mice;

fig. 32 is a representative microscopic image of p16 immunohistochemical staining of myocardial infarction area after 4 weeks in myocardial infarction mice (fig. 32A) and statistical plot of the ratio of positive area to total area (fig. 32B).

Detailed Description

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out under conventional conditions or under conditions recommended by the manufacturer.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The reagents or materials from which no separate source is noted are those conventional in the art, can be selected as is common in the art or processed in a conventional manner or processed or used as recommended by the manufacturer, and are commercially available through conventional sources. The preferred methods and materials described herein are presented for illustrative purposes only.

Example 1 validation of p16 as a target for ventricular remodeling following myocardial infarction

(one) construction of mouse MI model

MI model construction was performed using 12 month old Wild Type (WT) mice or p16 knockout mice (p 16-KO). After 4-6 hours of fasting, the mice were weighed and recorded. Abdominal injection anesthesia was performed at 50mg/kg using pentobarbital sodium according to body weight. After fixing the limbs of the mice and disinfecting the skin in the operation area, the hair on the neck and chest of the mice is scraped off by a skin preparation knife. The tissues such as skin, muscle and the like are separated to expose the trachea, an animal breathing machine is opened and connected, and the random fluctuation of the frequency of the thoracic cage is observed and then the thoracic cage is fixed. The surgical operation is performed by shearing the skin in front of the chest of the mouse, cutting an oblique incision about 1 cm long, blunt separating the muscle in front of the chest, exposing the rib and intercostal muscle, finding out a third intercostal space, puncturing the intercostal muscle and pleura by blunt curved forceps, stretching into a self-made draw hook to fix the sternum, blunt separating the intercostal muscle by elbow forceps, stretching the rib, exposing the heart, probing the left auricle, ligating the cardiac muscle and the blood vessel of the mouse with sterile sutures under direct vision, ensuring firm surgical knots, proper tension, and obviously changing local cardiac muscle tissues from red to pale after ligation. The trachea cannula needle is pulled out, the normal respiratory heartbeat of the mouse is recovered, and the mouse is placed on a heat preservation electric blanket to keep the body temperature until the mouse wakes up, and numbering is carried out. The sham operation group only performs chest opening and needle insertion and needle extraction treatment on the mice, does not ligate blood vessels, and the rest steps are the same as MI modeling.

(II) grouping of animal models

Experimental animals were divided into 4 groups:

(1) Sham surgery group (wt+sham group, n=8) with 12 month old wt+mi mice not bound LAD;

(2) Sham operated group of 12 month old p16-ko+mi mice without LAD (p 16-ko+sham group, n=8);

(3) The wt+mi myocardial infarction mice group (wt+mi group, n=8) surviving modeling;

(4) The group of p16-ko+mi myocardial infarction mice surviving after successful modeling (p 16-ko+mi group, n=8).

(III) evaluation of cardiac Functions and infarct fibrosis and inflammation levels in mice after 4 weeks of myocardial infarction

Echocardiography (heart failure) was performed 4 weeks after myocardial infarction modeling. Using a high resolution imaging system to detect the mouse heart, measuring left ventricular end systole inner diameter (LVESD), left ventricular end diastole inner diameter (LVEDD), left ventricular wall thickness (LVPWT), ventricular septum thickness (IVST) in the major and minor axis directions, and calculating Left Ventricular Ejection Fraction (LVEF) and left ventricular foreshortening fraction (LVFS), assessing mouse heart function; ELISA technique detects Brain Natriuretic Peptide (BNP) levels in peripheral serum.

The mice were further anesthetized with 1% sodium pentobarbital, sacrificed by cervical vertebrae removal after blood was taken from the eyeballs, the chest was opened, the heart was rinsed clean, and then cut off, and surrounding tissues were removed on filter paper. The heart specimen core tip is fixed in 4% paraformaldehyde for more than 24h, dehydrated by gradient ethanol and embedded by xylene transparent paraffin. The paraffin sections were 5 μm thick and baked in an oven at 37℃for 24h. The fibrosis related proteins alpha-SMA and Collagen I, inflammatory proteins IL-1 beta, IL-6 and TNF-alpha were detected by Masson staining and immunohistochemical staining. The rest heart tissue is extracted with protein lysate to obtain tissue protein, and the protein inflammatory factors pro-IL-1 beta, TNF-alpha, NLRP3 signal path proteins NLRP3, ASC related to fibrosis are detected by immunoblotting. Blood specimens were naturally coagulated, centrifuged at 3000g at 4℃for 25min and the serum was aspirated for detection of BNP levels.

The results are shown in FIGS. 1-11:

FIG. 1 is a representative image of echocardiography after 4 weeks of myocardial infarction and Left Ventricular Ejection Fraction (LVEF) and left ventricular foreshortening fraction (LVFS) statistics for WT and p16 knockout (p 16-KO) mice. Wherein fig. 1A is an echocardiogram of each group of mice, fig. 1B is a Left Ventricular Ejection Fraction (LVEF) statistic and a left ventricular foreshortening fraction (LVFS) statistic, as can be seen from fig. 1: compared with the non-molding mice, the mice have reduced Left Ventricular Ejection Fraction (LVEF) and left ventricular shortening fraction (LVFS) after MI molding for 4 weeks, and the mice have reduced cardiac function; compared with WT+MI mice, the p16-KO+MI mice had elevated Left Ventricular Ejection Fraction (LVEF) and left ventricular shortening fraction (LVFS) after MI molding for 4 weeks, and improved cardiac function. These results illustrate: p16 knockout can improve mouse cardiac function.

FIG. 2 is a representative microscopic image and fibrous area statistic of cardiac tissue Masson staining after 4 weeks from myocardial infarction in WT and p16-KO mice. Compared with the WT+MI mice, the area of Masson staining positivity was significantly reduced after 4 weeks MI modeling of the p16-KO+MI mice. The results show that: p16 knockout significantly reduced myocardial infarction mice cardiac infarction zone fibrosis levels.

FIG. 3 is a statistical plot of total positive area ratio of representative microscopic images and positive area immunohistochemical staining of the myocardial infarction area Collagen I after 4 weeks from myocardial infarction in WT and p16-KO mice.

FIG. 4 is a statistical plot of total area ratio of positive areas to representative microscopic images of myocardial infarction area α -SMA immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice.

The results show that: the positive areas of Collagen I and alpha-SMA were significantly reduced after 4 weeks MI modeling in p16-KO+MI mice compared to WT+MI mice. This result shows that: p16 knockdown significantly reduced expression of Collagen I and α -SMA in myocardial infarction areas of myocardial infarction mice.

FIG. 5 shows Western blot detection results and statistical graphs of myocardial infarction area alpha-SMA and Collagen I protein expression levels after 4 weeks of myocardial infarction in WT and p16-KO mice. Compared with WT+MI mice, p16-KO+MI mice showed significantly reduced expression of alpha-SMA and Collagen I in cardiac infarction area after 4 weeks MI molding. The results show that: p16 knockdown significantly reduced expression of myocardial infarction area α -SMA and Collagen I in myocardial infarction mice. Meanwhile, by combining the experimental results, the p16 knockout obviously reduces the expression of the fibrosis protein in the myocardial infarction area of the myocardial infarction mice and improves the fibrosis in the myocardial infarction area of the myocardial infarction mice.

FIG. 6 is a statistical plot of serum BNP levels after 4 weeks from myocardial infarction in WT and p16-KO mice. The results show that: the serum BNP levels were significantly reduced after 4 weeks MI modeling in p16-KO+MI mice compared to WT+MI mice.

FIG. 7 is a statistical plot of total area ratio of representative microscopic images and positive areas of IL-1β immunohistochemical staining after 4 weeks from myocardial infarction in WT and p16-KO mice.

FIG. 8 is a statistical plot of total area ratio of representative microscopic images and positive areas of IL-6 immunohistochemical staining after 4 weeks from myocardial infarction in WT and p16-KO mice.

FIG. 9 is a statistical plot of representative microscopic images and positive area to total area ratio of TNF-. Alpha.immunohistochemical staining after 4 weeks on myocardial infarction in WT and p16-KO mice.

The IL-1β, IL-6 and TNF- α positive areas were significantly reduced after 4 weeks MI modeling in p16-KO+MI mice compared to WT+MI mice. The results show that: the p16 knockout obviously reduces the expression of inflammatory factors IL-1 beta, IL-6 and TNF-alpha in myocardial infarction areas of myocardial infarction mice.

FIG. 10 shows the results and statistical graphs of Western blot analysis of protein expression levels of pro-IL-1β, IL-1β and TNF- α in the infarct zone after 4 weeks from the myocardial infarction of WT and p16-KO mice. The p16-KO+MI mice were significantly less expressing pro-IL-1β, IL-1β and TNF- α in MI molding 4 weeks cardiac infarction area compared to WT+MI mice. The results show that: compared with the WT group, the p16 knockout can obviously reduce inflammatory factors in infarct areas after myocardial infarction and improve inflammatory aging after myocardial infarction.

FIG. 11 shows Western blot detection results and statistical diagrams of protein expression levels of NLRP3 signaling pathway molecules NLRP3 and ASC in infarct area after 4 weeks from myocardial infarction of WT and p16-KO mice. P16-ko+mi mice MI model 4 weeks cardiac infarct zone NLRP3 and ASC expression significantly decreased compared to wt+mi mice. The results show that: p16 knockout significantly reduced the expression of the myocardial infarction mouse NLRP3 and ASC proteins compared to WT group. Meanwhile, by combining the experimental results, the p16 knockout can improve the heart function of the myocardial infarction mice, relieve the myocardial heart and inflammation of the myocardial infarction mice and reduce the activation of NLRP3 signals.

Example 2 construction of a nano-drug carrying p 16-siRNA:

construction of nano-drug carrying p16-siRNA

(1) After culturing human peripheral blood neutrophils, collecting cytoplasmic membranes, and performing ultrasonic treatment on the cytoplasmic membranes to obtain Neutrophil Membrane Proteins (NMP).

(2) 3g of cetyltrimethylammonium bromide (CTAB) and 0.15mL of triethanolamine were dissolved in 60mL of distilled water. After 1 hour of incubation at 60 ℃, 16mL of cyclohexane and 4mL of tetraethyl orthosilicate (TEOS) were added, and after 24 hours of continuous stirring, centrifugation was performed, and the product was collected and resuspended several times with ethanol to obtain mesoporous nano-silica (MSNs). To remove residual CTAB, stirring was performed with ammonium nitrate for 3 hours and repeated twice. The final product was diluted with distilled water to a concentration of 20mg/mL to give MSNs suspension.

(3) The nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are respectively synthesized into p16-siRNA fragments, the p16-siRNA fragments are placed in DEPC water to obtain p16-siRNA suspension with the concentration of 500nM, 150 mu L p-siRNA suspension, 150 mu L of MSN suspension prepared in the step (2) and 700 mu L of 3M calcium chloride solution are uniformly mixed for 15 minutes under the ultrasonic action, and the mesoporous silica nanoparticle (MSNs-sip 16) water suspension loaded with the p16-siRNA is obtained.

(4) For lipid coating, distearoyl phosphatidylethanolamine (DMPC, manufacturer: alatine, specification: D163596; 100 mg), phospholipid polyethylene glycol active ester (DSPE-PEG-NHS, manufacturer: R-0042;500 mg) and cationic lipid material (2, 3-dioleoyl-propyl) -trimethylamine DOTAP were dissolved in chloroform in a molar ratio of 76.2:3.8:20, and lipid film (Li) was prepared by evaporating the organic solvent.

(5) FH peptide was synthesized by medium peptide Biochemical Co., ltd. And its amino acid sequence was "FHKHKSPALPPV". In order to combine the FH peptide on the nano particles, the lipid film is adopted to modify and wrap the FH peptide, the rest operation of the lipid film modification and wrap the FH peptide is the same as that of the step (4), except that the FH peptide is also added into a system of DMPC+DSPE-PEG-NHS+DOTAP, so that the DSPE-PEG-NHS and the FH peptide are mixed in a molar ratio of 2:1 for hydration, and stirred at room temperature overnight, and finally the lipid film-coated FH peptide DSPE-PEG-FH is synthesized. Taking part of DSPE-PEG-FH solution, uniformly mixing the solution with the neutral granulocyte membrane protein prepared in the step (1), carrying out water bath ultrasonic treatment for 5-10 seconds, then standing for 6 hours at room temperature, and embedding the neutral granulocyte membrane protein into the DSPE-PEG-FH to obtain the neutral granulocyte membrane protein embedded into the DSPE-PEG-FH.

(6) Uniformly mixing the MSNs-sip16 aqueous suspension prepared in the step (3) with the lipid membrane in the step (4), performing water bath ultrasonic treatment for 5-10 seconds, standing at room temperature for 6 hours, and continuously extruding a hydration product through a 1000, 400 and 200 nanometer polycarbonate porous membrane to obtain a p16-siRNA loaded mesoporous silica nanoparticle system wrapped by the lipid membrane. For Neutrophil Membrane Protein (NMP) insertion, the same volume of the neutral granulocyte membrane protein embedded in DSPE-PEG-FH in step 5, which is coated by a lipid membrane and loaded with p16-siRNA, was added, and the mixture was subjected to ultrasonic treatment for 30 minutes.

(7) Excess lipids, proteins and peptides were removed by centrifugation at 10000g for 5min, giving FH-NMP-LiMSNs-p16 siRNA, FNLM-sip16 (fig. 12), and resuspended in PBS for use.

The observations of the above products are shown in FIGS. 12-15:

FIG. 12 is a diagram showing the construction pattern of FNLM-sip16. The mesoporous silica nanoparticle is loaded with p16-siRNA, the lipid membrane coats the mesoporous silica nanoparticle loaded with p16-siRNA, the FH peptide is coated by the lipid membrane to obtain the FH peptide coated by the lipid membrane, and the FH peptide coated by the lipid membrane and neutral granulocyte membrane protein (NMP) are embedded into the lipid membrane of the mesoporous silica nanoparticle coated with p16-siRNA.

FIG. 13 is a representative image of an FNLM-sip16 transmission electron microscope, showing the structural morphology of FNLM-sip16. It can be seen that: successful packaging of FNLM-sip16 has a lipid coating and a dark monodisperse silica microsphere core.

FIG. 14 is a Zeta potential statistical plot of MSNs prepared in step (2), MSNs-sip16 prepared in step (3) and FNLM-sip16 prepared in step (7), representing colloidal dispersion stability. It can be seen that: its potential is within + -30V, and coagulation or aggregation is more likely to occur, thereby releasing siRNA.

FIG. 15 is a statistical plot of the diameters of MSNs prepared in step (2), MSNs-siR prepared in step (3) and FNLM-siR prepared in step (7), measured using dynamic light scattering experiments (Dynamic light scattering, DLS), showing that: the presence of the lipid coating increased the size of the nanoparticle with an average diameter of 175nm.

(II) FNLM-sip16 co-incubation with cardiac fibroblast cells

To prepare CY 3-labeled FNLM-sip16, we used the silencer (tm) sirna-labeling kit (Invitrogen, AM 1632), adding nuclease-free water, 10X labeling buffer, dsRNA, and labeling dye in order, and incubated for 1 hour at 37 ℃. 5M NaCl and pre-chilled 100% ethanol were added and mixed well and incubated at-20℃for 20-30 min. Centrifugation was carried out at high speed for 20 minutes at 4℃and the supernatant was removed and the precipitated particles were washed with 70% ethanol. Centrifugation is carried out at high speed for 5 minutes at room temperature, the supernatant is removed, the pellet is dried, and the labeled RNA is obtained and suspended in 20. Mu.l of nuclease-free water.

To observe endosomal escape of the nanoparticles, cardiac fibroblasts were seeded on confocal dishes and co-cultured with FNLM-sip16 for 24 hours after hypoxia treatment for 24 hours. The cells were then washed three times and stained for nuclei by incubation with DAPI and observed under a fluorescent microscope.

The results are shown in FIG. 16:

FIG. 16 is a representative microscopic image of immunofluorescence of CY3 fluorescently labeled FNLM-sip16 after co-incubation with cardiac fibroblasts, showing that FNLM-sip16 can enter cardiac fibroblasts.

Example 3 nanomaterial-loaded p16-siRNA can target mouse MI regions in vivo:

(one) construction of mouse MI model

MI model construction was performed using 12 month old Wild Type (WT) mice (purchased from beijing vitelliwa laboratory animal technologies limited). The procedure is as in example 1.

(II) in vivo administration of mouse nanomedicine

After MI modeling using 12 month old WT mice, animals were divided into three groups:

(1) A sham surgery group (wt+sham group, n=6) of 12 month old WT mice with left anterior coronary artery anterior descending (LAD) not ligated; WT+MI myocardial infarction mice surviving after successful modeling were randomly assigned to

(2) Myocardial infarction injection a nano-drug group (wt+mi+fnlm-siNC group, n=6) loaded with Negative Control (NC) -siRNA by FNLM, wherein the FNLM-siNC construction is completely identical to the FNLM-sip16 construction method except that the p16-siRNA is replaced with NC-siRNA shown in SEQ ID No.5 and SEQ ID No. 6;

(3) Myocardial infarction the p16-siRNA loaded nanopharmaceutical set prepared in example 2 (wt+mi+fnlm-sip 16 set, n=6) was injected.

On days after myocardial infarction molding, 200. Mu.L PBS was injected into the tail of the WT+sham group, and 200. Mu.L LFNLM-sip16 was injected into the tail of the WT+MI group for 1 week.

Blood samples were taken at day 1 or day 28 post injection to determine serum glutamic pyruvic transaminase (ALT), glutamic oxaloacetic transaminase (AST) to assess liver function, creatinine (Cr) and urea nitrogen (BUN) to assess kidney function. Mice were then sacrificed and major organs were collected and fixed with 4% PFA. Organs were then paraffin embedded and sectioned for H & E staining.

The results are shown in 17-22:

FIG. 17 is an immunofluorescent-stained representative fiber image of the mouse heart infarct zone and non-infarct zone, WT+MI+FNLM-sip16 group or WT+MI+FNLM-sip16 group, DAPI labeled nuclei, CY3 labeled FNLM-sip or FNLM-sip16. It can be seen that: after myocardial infarction, both FNLM-siNC and FNLM-sip16 home largely to the infarcted area, but there was little home to the non-infarcted area of the heart, indicating that they can target the infarcted area of the heart in heart infarcted mice.

FIG. 18 is an HE staining image of liver and kidney of mice after administration of FNLM-siNC or FNLM-sip16. It can be seen that: liver and kidney tissues of the FNLM-siNC and FNLM-sip 16-dosed mice were free of significant pathological changes and inflammatory responses as compared to the control group.

FIG. 19 is a statistical plot of serum glutamic pyruvic transaminase (ALT) levels of mice after administration of FNLM-siNC or FNLM-sip16.

FIG. 20 is a statistical plot of serum glutamate oxaloacetic transaminase (AST) levels of mice after administration of FNLM-siNC or FNLM-sip16, showing liver function in mice.

It can be seen that: compared with the control group, the levels of ALT and AST of the mice in the FNLM-siNC and FNLM-sip16 administration group are not changed obviously, which indicates that the FNLM-siNC and the FNLM-sip16 have no obvious hepatotoxicity in vivo.

FIG. 21 is a statistical plot of serum creatinine (Cr) levels in mice following administration of FNLM-siNC or FNLM-sip16.

FIG. 22 is a statistical plot of serum urea nitrogen (BUN) levels of mice after administration of FNLM-siNC or FNLM-sip16 showing kidney function in the mice.

It can be seen that: compared with the control group, the serum urea nitrogen and creatinine levels of the mice in the FNLM-siNC and FNLM-sip16 treatment group are not obviously changed in comparison with the control group, which indicates that the FNLM-siNC and FNLM-sip16 have no obvious kidney toxicity in vivo.

Example 4

The nano material carries p16-siRNA to enter heart fibroblasts in MI area, improves heart function and reduces fibrosis degree and inflammatory reaction of infarct area and surrounding area:

to further demonstrate that the nanomaterial we constructed entered heart fibroblasts in MI areas, which can improve heart function and reduce fibrosis and inflammatory response in infarct areas and surrounding areas, we constructed MI models using 12 month old mice, divided into sham-operated groups (wt+sham group, n=6) of 12 month old wt+mi mice with no left anterior coronary artery descending branches (LAD); FNLM-siNC treatment group (wt+mi+fnlm-siNC group, n=6) and FNLM-sip16 treatment group (wt+mi+fnlm-siNC group, n=6); the FNLM-SiNC treated group and FNLM-sip16 treated group were injected with PBS 1 time per week by tail vein injection, FNLM-SiNC or FNLM-sip16, WT+sham group, for 4 weeks, as in example 2. And performing heart ultrasonic cardiography detection. Detecting a mouse heart using a high resolution imaging system, and calculating a Left Ventricular Ejection Fraction (LVEF) and a left ventricular shortening fraction (LVFS), assessing mouse heart function; the levels of Brain Natriuretic Peptide (BNP) in peripheral serum were detected by ELISA techniques. The mouse heart fibrosis related proteins alpha-SMA, POSTN and Collagen I, inflammatory factors IL-1β, IL-6 and TNF-alpha, NLRP3 signaling pathway molecules NLRP3, ASC and Caspase-1 were further detected by immunohistochemical staining. The remaining heart tissue was used to extract heart proteins and protein expression levels of fibrosis-related proteins α -SMA, POSTN and Collagen I, inflammatory factors IL-1β, IL-6 and TNF- α, and NLRP3 signaling pathway molecules NLRP3, ASC and Caspase-1 were detected by Western Blot.

The results are shown in FIGS. 23-32:

fig. 23 is a statistical plot of echocardiogram, left Ventricular Ejection Fraction (LVEF) and left ventricular foreshortening fraction (LVFS) for each treatment group of mice, wherein fig. 23A is an echocardiogram, fig. 23B is a statistical plot of Left Ventricular Ejection Fraction (LVEF), and fig. 23C is a statistical plot of left ventricular foreshortening fraction (LVFS), as can be seen from fig. 23: the Left Ventricular Ejection Fraction (LVEF) and left ventricular shortening fraction (LVFS) of mice after 4 weeks of myocardial infarction were significantly increased by FNLM-sip16 administration compared to the control group, demonstrating that FNLM-sip16 administration can improve cardiac function in myocardial mice.

Fig. 24 is a statistical plot of serum Brain Natriuretic Peptide (BNP) levels for each treatment group of mice, as can be seen: the lower level of BNP in peripheral blood of the FNLM-sip 16-dosed mice compared to the control group suggests that FNLM-sip16 dosing can improve heart failure in myocardial mice.

Fig. 25 is a representative fibrous image and fibrous area statistic of Masson staining of cardiac tissue after 4 weeks in myocardial mice, showing that: the infarct zone and its surrounding areas were significantly reduced in the FNLM-sip16 dosed group compared to the control group.

FIG. 26 shows Western blot detection results of expression levels of alpha-SMA, POSTN and Collagen I proteins in the myocardial infarction area after 4 weeks in myocardial infarction mice, and the results show that: compared with the FNLM-siNC treatment group, the expression level of the pro-fibrosis proteins such as alpha-SMA, collagen I, POSTN and the like in myocardial infarction areas of mice after the FNLM-sip16 is dosed is obviously reduced.

FIG. 27 shows that further detection of myocardial infarction areas α -SMA, POSTN and Collagen I by immunohistochemical staining of myocardial infarction mice after 4 weeks showed a significant decrease in positive areas of α -SMA, collagen I and POSTN in myocardial infarction areas of mice after FNLM-sip16 administration compared to the FNLM-siNC group. The results prove that: compared with the FNLM-siNC group, the FNLM-sip16 can obviously inhibit the expression of the pro-fibrotic protein in the infarcted area after myocardial infarction and reduce the degree of fibrosis after myocardial infarction.

FIG. 28 shows Western blot detection of expression levels of NLRP3, ASC, caspase-1, pro-IL-1β, IL-6 and TNF- α proteins in infarct areas of heart from myocardial infarction mice after 4 weeks. The results show that: protein expression levels of NLRP3 signaling pathway molecules NLRP3, ASC and Caspase-1 in infarct zone of mice were significantly reduced after FNLM-sip16 administration compared to control group.

FIG. 29 shows further detection of cardiac infarct IL-1β, IL-6 and TNF- α by immunohistochemical staining in myocardial mice after 4 weeks, showing: IL-1β, IL-6 and TNF- α positive areas were significantly reduced in the myocardial infarction area of mice after treatment with FNLM-sip16, as compared to the FNLM-siNC group. The results prove that the administration of FNLM-sip16 can obviously reduce inflammatory factors in the infarcted area after myocardial infarction and improve inflammatory aging after myocardial infarction.

FIG. 30 shows further detection of myocardial infarction areas NLRP3, ASC and Caspase-1 after 4 weeks by immunohistochemical staining, showing: compared with the FNLM-siNC group, the NLRP3, ASC and Caspase-1 positive areas of myocardial infarction areas of mice after the FNLM-sip16 administration are obviously reduced. The results prove that the administration of FNLM-sip16 can obviously reduce the expression of NLRP3 signal path molecules in the infarct area after myocardial infarction.

FIG. 31 shows Western blot detection results of p16 protein expression levels in cardiac infarction area after 4 weeks in myocardial infarction mice, showing that: the FNLM-sip16 administration can obviously inhibit the expression of the myocardial infarction region p16 protein, and the experimental result is combined, so that the inhibition of the expression of the myocardial infarction region p16 protein can treat ventricular remodeling after MI and improve cardiac function.

FIG. 32 shows that immunohistochemical staining further examined myocardial infarction area p16 after 4 weeks, and that the number of p16 positive cells in myocardial infarction area was significantly reduced in mice after administration of FNLM-sip16 compared to FNLM-siNC group. The results prove that the FNLM-sip16 can obviously reduce the expression of the myocardial infarction region p16 protein, and the combination of the experimental results shows that inhibiting the expression of the myocardial infarction region p16 protein can treat ventricular remodeling after MI and improve cardiac function.

Claims

Use of p16 as a therapeutic target for the preparation or screening of a medicament for the treatment of ventricular remodeling following myocardial infarction.
2. Use of p16 as a target in the screening of a preparation for down-regulating the expression level of one or more proteins from the group consisting of α -SMA, POSTN, collagen I, IL-1 β, IL-6, TNF- α, NLRP3, ASC, caspase-1.
3. A medicament for treating ventricular remodeling following myocardial infarction, comprising a nucleic acid molecule that inhibits or silences p16 expression.
4. A medicament for the treatment of ventricular remodeling after myocardial infarction as claimed in claim 3 wherein said nucleic acid molecule that silences p16 expression is a p16-siRNA.
5. The drug for treating ventricular remodeling after myocardial infarction as claimed in claim 4, wherein the p16-siRNA sequence is:

sense strand:

5′-TGCTGAGCGGAACGCAAATATCGCACGTTTTGGCCACTGACTGACGTGCGATATGCGTTCCGCTdTdT-3′(SEQ ID NO.1)；

antisense strand:

5′-dTdTTGCTGAGCGGAACGCAAATATCGCACGTTTTGGCCACTGACTGACGTGCGATATGCGTTCCGCT-3′(SEQ ID NO.2)。
6. the drug for treating ventricular remodeling after myocardial infarction as claimed in claim 4, wherein the drug is a nanoparticle carrying p16-siRNA.
7. The drug for treating ventricular remodeling after myocardial infarction as claimed in claim 6, further comprising a delivery system comprising FH peptide, lipid membrane, neutrophil membrane protein, mesoporous silica nanoparticle;

preferably, the medicine is mesoporous silica nanoparticle loaded with p16-siRNA, the lipid membrane coats the mesoporous silica nanoparticle loaded with p16-siRNA, the FH peptide is coated by the lipid membrane to obtain the FH peptide coated by the lipid membrane, and the FH peptide coated by the lipid membrane and the neutral granulocyte membrane protein are embedded into the lipid membrane of the mesoporous silica nanoparticle coated with p16-siRNA.
8. The medicament for treating ventricular remodeling after myocardial infarction according to claim 7, wherein the FH peptide has the amino acid sequence FHKHKSPALPPV (SEQ ID No. 3).
9. Use of a substance that inhibits or silences p16 expression in the manufacture of a medicament for treating ventricular remodeling following myocardial infarction.
10. The use according to claim 9, wherein the substance that silences p16 gene expression is a nucleic acid molecule that inhibits or silences p16 expression or the medicament of claim 3 for treating ventricular remodeling following myocardial infarction.