CN116042824A - Annular RNA marker for diagnosing and treating malignant melanoma and application thereof - Google Patents

Abstract

The invention discloses a circular RNA marker for diagnosing and treating malignant melanoma and application thereof, which is characterized in that the marker is circular RNA: the RNA sequence of the circ_0084043 is shown as SEQ ID NO.1, and the circ_0084043 provided by the invention can target miR-134-5p so as to regulate PCDH9 and has important effects on invasion, metastasis and apoptosis of malignant melanoma. The data indicate that circ_0084043 up-regulates PCDH9 can inhibit MM invasion, metastasis and promote apoptosis by inhibiting Rac1, MMP2 and MMP9, and up-regulates PCDH9 can obviously inhibit MM proliferation in tumor-bearing mice, and down-regulates PCDH9 promotes MM proliferation. The drug applied to the targeting circ_0084043 can obviously inhibit the development of malignant melanoma and achieve the effect of treating the malignant melanoma; meanwhile, PCDH9 can be used as an oncogene to suppress malignant melanoma.

Description

Annular RNA marker for diagnosing and treating malignant melanoma and application thereof

Technical Field

The invention belongs to the technical field of molecular diagnosis and treatment, and particularly relates to a circular RNA marker for diagnosing and treating malignant melanoma and application thereof.

Background

The results of bioinformatics technology indicate that PCDH9 is closely related to prognosis of Chinese MM patients. The tropocadherin (Protocadherin) family is a member of the cadherin superfamily, which is a calcium-dependent adhesion protein that belongs to the cell adhesion molecule. Cadherins can be classified into classical cadherins, desmosomal cadherins, tropocadherins (PCDHs). The tropocadherin family is the most important member of the cadherin family, and studies confirm that PCDHs play a role in neural development, stabilization of cell-cell junction formation, tumor inhibition, and the like. To date, over 70 tropocadherin genes have been identified, and the tropocadherin family can be divided into two major classes, due to the difference in genomic structure: clustered tropocadherins and non-clustered cadherins. Wherein the clustered tropocadherin comprises three subtypes α, β, γ; non-clustered tropocadherins comprise PCDH delta, two isolated tropocadherin isoforms, and PCDH delta comprises δ1 and δ2, wherein the δ1 subtype PCDH is located on chromosome 13q21. In recent years, various non-clustered tropocadherins have been reported to be expressed in a down-regulated or absent state in tumors, closely related to the occurrence of tumors. For example, PCDH8, PCDH9, PCDH10, PCDH17 and PCDH20 are considered as oncogenes. PCDH8 hypermethylation is closely related to the progression of bladder cancer and poor prognosis, and is a biological marker with unique prognosis for bladder cancer patients. PCDH9 is under-expressed in glioblastoma, lymphoma and hepatocellular carcinoma patient tissues. Gene chip studies have shown that PCDH9mRNA is down-regulated in gastric lymph node metastasis compared to the primary tumor. Furthermore, the prior art demonstrates that PCDH9 can suppress hepatocellular carcinoma progression by activating GSK-3b to inhibit metastasis and down-regulating cyclin e to affect proliferation. Highly methylated PCDH10 and down-regulated expression are highly correlated with the pathogeny of breast cancer, nasopharyngeal carcinoma, esophageal cancer and gastric cancer, and up-regulated PCDH10 can obviously inhibit the proliferation and metastasis of the tumors. Tumor metastasis can be inhibited in the prior art by promoting apoptosis by monoclonal antibodies recognizing Protocadherin beta 13 on MM cell membranes, but so far, there has been no study on PCDH and MM.

Malignant Melanoma (MM) is a type of skin cancer that is insensitive to radiation and chemotherapy and has a tendency to metastasize in the early stages of distance. According to the data of the national cancer institute, the incidence of melanoma has increased significantly over the past 30 years, and the uk cancer institute estimated that the incidence of melanoma is 3.1/10,000 worldwide and the mortality is 0.8/10,000. Although some effective biomarkers have been identified in melanoma, chinese melanoma patients have been shown to be of a different subtype than caucasians. Thus, known biomarkers are not well predicted in the prognosis of chinese melanoma patients. About 50% of melanoma patients carry BRAF mutations, leading to excessive activation of the MAPK/ERK signaling pathway, leading to tumor development and metastasis. The combined use of BRAF and MEK inhibitors is the primary method of treating BRAF mutant melanoma. The clinical effect is remarkable, but a large number of drug-resistant cases also appear. Thus, there is an urgent need for a new and viable biomarker and therapeutic target. Meanwhile, MM has the phenomena of high misdiagnosis rate and poor prognosis, the survival rate of patients is low, and the problem of inhibiting MM metastasis is to be solved urgently.

The circRNAs are closed-loop non-coding RNAs formed by covalent bonds, are not influenced by exonuclease, participate in the occurrence and development of various diseases, and have close pathogenic relationship with cancers due to the abnormal regulation of the circRNA-miRNA-mRNA axes. The circRNAs molecules are rich in microRNA (miRNA) binding sites, so that the function of miRNA sponge (miRNA sponge) is achieved, for example, the circRNA cirS-7 can be used as a sponge of miR-7, the binding of the circRNA with mRNA targets is inhibited, and the expression of genes can be regulated. circRNA 0084043 is significantly upregulated in MM tissue, which promotes proliferation, invasion and migration of MM cells, and analysis of miR-134-5p by bioinformatic software is one of the potential targets for circRNA 0084043. In addition, miR-134-5p regulates PCDH9 to participate in pathogenesis of epithelial ovarian cancer, and plays a role in inhibiting cancer in MM.

Based on the above, the inventor uses the circRNA_0084043 as a miRNA sponge to regulate miR-134-5p targeting to inhibit the expression of PCDH9, up-regulates Rac1, MMP2 and MMP9 to promote invasion and metastasis of MM, so that the effect of circRNA_0084043-miR-134-5p-PCDH9 shaft in MM pathogenic mechanism can be revealed, and the MM metastasis and invasion mechanism can be further clarified; the PCDH9 is also clear to regulate the molecular mechanisms of Rac1, MMP2, MMP9, pyk2 and cyclin D1, and screens out high-efficiency targets, so that the preparation is applicable to the inhibition of the biological agents of MM.

Disclosure of Invention

In order to solve the technical problems, the invention provides a circular RNA marker for diagnosing and treating malignant melanoma and application thereof.

In order to achieve the technical effects, the invention is realized by the following technical scheme: a circRNA marker for use in the diagnosis of malignant melanoma, the marker being a circular RNA: the RNA sequence of the circ_0084043 is shown as SEQ ID NO. 1;

application of circ_0084043 in preparing a kit for diagnosing malignant melanoma;

further, the application of the circ_0084043 in preparing a kit for diagnosing malignant melanoma;

the kit is a primer or a reagent containing a recognition circle_ 0084043;

use of circ_0084043 in the manufacture of a medicament for the treatment of malignant melanoma;

the beneficial effects of the invention are as follows:

the circ_0084043 provided by the invention can target miR-134-5p so as to regulate PCDH9, and has important effects on invasion, metastasis and apoptosis of malignant melanoma. Experiments show that the circ-0084043 up-regulates PCDH9 can inhibit MM invasion, metastasis and promote apoptosis by inhibiting Rac1, MMP2 and MMP9, and the up-regulating PCDH9 can obviously inhibit MM proliferation in tumor-bearing mice, and the down-regulating PCDH9 can promote MM proliferation. PCDH9 serving as an oncogene can inhibit malignant melanoma and target circ_0084043 lentivirus, can remarkably inhibit the development of the malignant melanoma, and achieves a good effect of treating the malignant melanoma.

The deficiency of PCDH9 of the Chinese MM patient leads to the excessive expression of Rac1 and leads to the easy invasion and metastasis of MM, and the invention can inhibit the invasion and metastasis of MM by up-regulating the circRNA-0084043-miR-134-5 p-PCDH9 axis to inhibit Rac1, MMP2 and MMP 9.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a graph showing the effect of Q-PCR detection of PCDH9 overexpression and KD on melanoma cells according to the present invention.

FIG. 2 is a graph of the effect of Western blot detection of PCDH9 overexpression and KD on melanoma cells according to the invention.

FIG. 3 is a graph showing that over-expression of PCDH9 of the present invention in A375 (A, B) and G361 (C, D) cells significantly reduced the viability of melanoma cells.

FIG. 4 is a graph of the results of QRT-PCR of the present invention.

FIG. 5 is a graph of the ability of the invention to detect cell migration of A375 cells using scratch test (A).

FIG. 6 is a graph showing the expression levels of PCDH9, PYK2, RAC1, cyclin D1, MMP2, c-jun, XIAP and PD-L1 in melanoma cells after 48h (A, B, C) of transfection using Western blot detection according to the present invention.

Detailed Description

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

Example 1

A circRNA marker for use in the diagnosis of malignant melanoma, the marker being a circular RNA: the RNA sequence of the circ_0084043 is shown as SEQ ID NO. 1;

application of circ_0084043 in preparing a kit for diagnosing malignant melanoma;

the application of the circ_0084043 in preparing a kit for diagnosing malignant melanoma; the kit is a primer or a reagent containing a recognition circle_ 0084043;

use of circ_0084043 in the manufacture of a medicament for the treatment of malignant melanoma;

as shown in fig. 1, lentiviral infection can significantly up-regulate PCDH9 expression. PCDH9 expression significantly up-regulated gene expression of PYK2 and Cyclin D1, down-regulated gene expression of RAC1, MMP1, and MMP9, but not FAK expression in a375 (B) and G361 (C) cells. PCDH9 KD down-regulates A375 (D) and G361 (E) cell PYK2 and CyclinD1 gene expression, up-regulates RAC1, MMP1 and MMP9 gene expression. P <0.05, < P <0.01, < P <0.001, and minimal differences after hoc testing by one-way analysis of variance.

As shown in fig. 2, PCDH9 significantly upregulated PYK2 and Cyclin D1 in G361 cells (B), down-regulated RAC1, MMP2 and MMP9, while similar trends were seen in a375 cells (B), but not significantly (a). KD PCDH9 down-regulates PYK2 and Cyclin D1 levels in A375 (C) and G361 (D) cells, up-regulates RAC1, MMP2 and MMP9 levels. The two groups are compared by adopting a two-factor analysis of variance, the difference is significant, and the difference is the smallest after HOC detection.

As shown in fig. 3, the differences were significant compared to the control group using student's t-test (changes in P <0.05, <0.01, <0.001.Pcdh9 expression significantly affected apoptosis of melanoma cells, over-expression of PCDH9 significantly promoted apoptosis of both cell lines (E), while PCDH9 KD reduced apoptosis of a375 cells and G361 cells (F).

As shown in FIG. 4, CIRC0084043 was expressed in both the human melanoma cell line (A375, SK-MEL-28 and A875) and the normal human epidermal melanocyte line (PIG 1) (a). The circRNA_0084043 was knocked out from A375 and A875 cells with siRNA (B). Data represent mean ± SD of 3 independent experiments. The differences were significant compared to the control group using student' S t-test (P <0.05, <0.01, <0.001, < p.0.001. Pcdh9 was expressed in normal skin, nevus and melanoma tissues immunohistochemical analysis. Positive expression rate of PCDH9 in melanoma tissues was lower than in normal skin or/and nevus tissues PCDH9 was mainly localized to the cytoplasm and a small amount of localized to the nucleus S100 and HMB45 were melanoma markers. Scale bars represent 200 microns (C.) small molecule RNA sequencing of a375 cells after circRNA 0084043 knockdown, differential expression of mirnas was found (D, E.) double luciferase report experiments showed that simulated miR-134-5P could reduce the prediction of the binding site of circRNA 0084043 luciferase reporter (P < 0.01) (F.) circRNA 0084043 to miR-134-5P (G).

Apoptosis was detected by flow cytometry after 48h transfection (B, C), as shown in fig. 5. Data represent mean ± SD of 3 independent experiments. The difference compared with the control group has significance through the two-factor analysis of variance, wherein the difference after the HOC test is the smallest, namely P <0.05, P <0.01, P <0.001 and P <0.0001.

Data as shown in figure 6 represent the mean ± SD of 3 independent experiments. The difference compared with the control group has significance through the two-factor analysis of variance, wherein the difference after the HOC test is the smallest, namely P <0.05, P <0.01, P <0.001 and P <0.0001.

Example 2

The present example is designed to demonstrate the role of the circRNA_0084043-miR-134-5p-PCDH9 shaft in MM invasion and metastasis from three levels of cell, animal, and clinic using techniques such as flow cytometry, western bolt, real time PCR, TUNEL, immunohistochemistry, transmission electron microscopy, RIP-seq, RNA Pull-down, and iTRAQ bioinformatics analysis, co-immunoprecipitation, and chromosomal co-precipitation.

First, it was determined by qRT-PCR whether circ0084043 was expressed in normal melanocytes and melanoma cells. Next, the synthetic si-circ_0084043 was designed, human A375, A875 melanoma cells (human melanoma cell line and normal melanoma cell line were cultured) were cultured and the cells were isolated prior to the experimentThe groups are 4: si-circ_0084043, miR-134-5p, si-circ_0084043+miR-134-5 pininhibitor, normal control, and then A375 cells were transfected with Si-CIRC0084043 and Si-NC. To find more targets for circRNA 0084043, we performed SmallRNA-SEQ on a375 cells after knocking out circRNA 0084043. Subsequently, cells A375 and A875 were plated into 24-well plates and incubated overnight at 37 ℃. Luciferase reporter vector and miR-134-5P mimetic or miR-134-5P inhibitor were then co-transfected with lipofectamine3000 (Invitrogen). 48h after transfection, luciferase activity was detected using a dual luciferase reporter system (Promega, WI, USA). Meanwhile, the expression of PCDH9, rac1, pyk2, cyclin D1, MMP2, PD-L1, c-Jun and XIAP proteins is determined by Western Blot; determining the ability of the cell to migrate by a cell scratch assay; cell cycle and apoptosis were measured by flow cytometry. 6 week old nude female mice were housed in SPF animal chambers. Transfection of pCDH9 overexpressing plasmid, pCDH9 KD plasmid and empty plasmid into mice 5X 10 ⁶ A375 and a375 cells were seeded in 150 μl PBS, respectively. Mice were sacrificed 35 days later to resect tumors and the tumor sizes of each group were measured.

Example 3

3.1 cell culture

Cell lines A375, A875, SK-MEL-28, G361 (melanoma cell line) and PIG1 (normal melanocyte line) were purchased from the American Type Culture Collection (ATCC) (MD, USA). They were inoculated into DMEM medium supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS), 100IU/ml penicillin and 100 μg/ml streptomycin, and cells were incubated in a CO2 incubator (5% CO2, 37 ℃).

3.2 overexpression of lentiviral infection

Prior to the experiment, cells were divided into 3 groups: blank (no lentivirus), control (lentivirus with empty plasmid) and PCDH9 (lentivirus with over-expressed PCDH9 plasmid). To optimize experimental conditions, different lentiviral infection parameters were determined: (i) Cell seeding Density of 0.5X10 ⁶ Cells/ml, (ii) infection time of 12 hours, (iii) observation time of 72 hours, (iv) lentivirus titer of 2X 10 for control group ⁸ TU/ml, (v) lentiviral titres for the transfection group 1X 10 ⁹ TU/mlAnd (vi) MOI (multiplicity of infection) of 20. In summary, in a 6-well plate (1×10 ⁵ Individual cells/well) were inoculated with cells at the appropriate density, incubated overnight to achieve 30-40% adhesion, and then centrifuged at low speed for 30 seconds. After the addition of virus (moi=20), 1ml of fresh medium containing polybrene was added to each group, and 1ml of medium containing 10% fbs was added to the blank group. After 12 hours incubation, the lentiviral-containing medium was replaced with medium containing 10% fbs (2 ml). Cells were observed by inverted fluorescence microscopy and screened by puromycin for post-infection assay.

3.3 lentiviral infection KD

Prior to the experimental procedure, cells were divided into 3 groups: blank (no lentivirus), control (lentivirus with empty plasmid) and PCDH9-siRNA (lentivirus with siRNA plasmid). To optimize experimental conditions, different lentiviral infection parameters were determined: (i) Cell seeding Density of 0.5X10 ⁶ Cells/ml, (ii) infection time of 12 hours, (iii) observation time of 72 hours, (iv) lentivirus titer of 2X 10 for control group ⁸ TU/ml, (v) lentivirus titres for the transfection group were 1X 109TU/ml and (vi) MOI (multiplicity of infection) were 20. In summary, in a 6-well plate (1×10 ⁵ Individual cells/well) were inoculated with cells at the appropriate density, incubated overnight to achieve 30-40% adhesion, and then centrifuged at low speed for 30 seconds. After the addition of virus (moi=20), 1ml of fresh medium containing polybrene was added to each group, and 1ml of medium containing 10% fbs was added to the blank group. After 12 hours incubation, the lentiviral-containing medium was replaced with medium containing 10% fbs (2 ml). Cells were observed by inverted fluorescence microscopy and screened by puromycin for post-infection assay.

3.4 cell transfection

Prior to cell transfection, A375 and A875 cells were seeded into 6-well plates and cultured to a confluency of 60% -80%, followed by transfection of indicated 10 μm oligonucleotides (SI-CIRC 0084043, si-NC, miR-NC, miR-134-5P mimic and miR-134-5P inhibitor) with lipofectamine rnaimax (Invitrogen) and lipofectamine3000 (Invitrogen), respectively.

3.5CCK-8 detection of cell viability

Cells were seeded into 96-well plates (2X 10) ⁵ Individual cells/well) and treated with untransfected plasmid, transfected with empty plasmid and PCDH9 overexpressing plasmid, as described above. After 24, 48, 72, 96h incubation, 10. Mu.L CCK-8 was added to each well and incubated at 37℃for another 4h. The level of the stained formazan derivative was analyzed on Thermo Scientific Multiskan FC (Vantaa, finland) at a wavelength of 450 nm. Viable cells were proportional to formazan product and the percentage of viable cells was calculated.

3.6 flow cytometry for detecting apoptosis

Apoptosis was measured using a flow-through apoptosis assay. Cells were seeded in 6-well plates (1X 10) ⁶ Cells/wells) and treated as described above. After the treatment, the cells were centrifuged (1,000 rpm for 10 minutes). Subsequently, the cells were washed twice with cold PBS and resuspended in 1ml of 1 Xbinding Buffer. mu.L of FITC Annexin V (BD, USA) and 5. Mu.L of PI (BD, USA) were added to 100. Mu.L of this solution, which was then gently vortexed and incubated at room temperature for 15 minutes in the absence of light, and 400. Mu.L of 1 Xbinding Buffer was added to the final solution. Finally, the samples were analyzed using a BD FACSCanto II flow cytometer, and the cells were divided into apoptotic and non-apoptotic groups.

3.7 flow cytometry to detect cell cycle

Cell cycle was measured using flow apoptosis assay. Cells were seeded in 6-well plates (1X 10) ⁶ Cells/wells) and treated as described above. After treatment the cells were centrifuged (1,000 rpm10 min). Then vortexed with 5ml of cold 75% ethanol; cells were incubated at-20℃for 2 hours, washed twice to remove ethanol (first in PBS, then in staining buffer) and centrifuged again (1,000 rpm for 10 minutes). Cells were resuspended with 0.5ml PI/RNase Staining Buffer (BD, USA) and incubated at room temperature for 15 minutes, followed by analysis of the samples using BD FACSCanto II flow cytometer.

3.8 cell migration assay

Cells were seeded into 6-well plates (1.5X10) ⁵ Individual cells/well) and incubated under cell culture conditions for 24 hours until the cells fuse. The scratches were streaked out with a sterile 10. Mu.L pipette tip. The suspension cells were washed twice with PBS, thenIncubation was performed in DMEM medium (with 2% fbs). Scratches were observed using an inverted microscope DMI3000B (Leica, germany) at 0 hours, 24 hours and 48 hours. Image J (Maryland, U.S.A.) was used to measure wound gap.

Example 4

4.1 RNA isolation and purity determination

Cells were washed with cold PBS and lysed with trypsin, then vortexed thoroughly, centrifuged for 5min (1,000 rpm), the supernatant discarded and washed with cold PBS. After 5 minutes (1000 rpm) of rotation, TRIzol was added, respectively, and after 5 minutes of incubation at room temperature, chloroform was added according to the amount of TRIzol (1 ml TRIzol requires 0.2ml chloroform); vortex vigorously for 15 seconds and incubate for 3 minutes at room temperature. The sample was then centrifuged at 4℃for 15 minutes (12,000 g) to obtain the aqueous phase. After incubation for 10 minutes at room temperature, isopropanol was added to precipitate RNA (1 ml TRIzol required 0.5ml isopropanol). The supernatant was discarded and the RNA at the bottom of the tube was then washed with 75% ethanol (1 ml TRIzol requires 1ml ethanol). The sample was centrifuged at 4℃for 5 minutes (7,500 g) several times until all ethanol was removed. After 8 minutes of drying, the RNA samples were dissolved in DEPC treated water using a pipette tip (1. Mu.L of RNA was diluted 1:40 with 39. Mu.L of DEPC treated water). The A260/A280 of the extracted RNA is above 1.8.

4.2 reverse transcription and quantitative real-time PCR (qRT-PCR)

The RNA samples prepared were reverse transcribed using PrimeScript RT kit (TaKaRa, japan) and were genotyped using the 2- ΔΔCT method, and the samples were cycled 40 times (95 ℃,5 seconds and 60 ℃,30 seconds) through ABI7500Fast Real-time PCR System Amplifier (Thermo Fisher).

Example 5

5.1 Western blot analysis

Cells were lysed in buffer containing a mixture of 20mM Tris-HCl (pH=7.5), 0.9% NaCl, 0.2% Triton X-100 and 1% protease inhibitor. Cells between the third and sixth generation were analyzed. The BCA protein assay kit was used to measure total protein concentration. Equal amounts of protein (30. Mu.g) were loaded and separated for each sample in 10% sodium dodecyl acrylamide sulfate-polyacrylamide gel electrophoresis (SDS/PAGE) and transferred to an immobilon PVDF membrane. PVDF membranes were washed 3 times with Tris HCl buffered saline containing 5% tween 20 (TBST) and blocked with 5% defatted dry blocking agent. Followed by incubation with primary antibody overnight at 4 ℃. Next, PVDF membranes were washed 3 times with TBST and then incubated with secondary antibodies. Protein bands were visualized using Immobilon Western Chemiluminescent Substrate and protein signals were detected by Azure Biosystems (CA, USA) Azure c500 Infrared Western Blot Imaging System. Protein expression was quantified using the software Image J and Origin 2020 visualization software.

5.2 Immunohistochemical (IHC) staining

IHC was performed on the collected tissues, 45 normal human skin tissues, 30 human nevus pigmentosus tissues and 30 human MM tissues were selected. These organizations come from the affiliated hospital clinic of the university of Guangdong medical science, are all Chinese (Han nationality), and are identified. These MM tissues were from patients diagnosed with MM by percutaneous pathology in the 2016 to 2021 year, and nevus pigmentosus tissues were from patients who had been subjected to surgical excision in dermatology at the same time. All tissues were prepared as paraffin specimens. The purified xylenes were dewaxed twice (xylene I-10 min, xylene II-10 min), then rinsed with a series of fractionated alcohols (absolute I-5 min, absolute II-5 min, 95% ethanol 5min, 85% -5 min, 75% -5 min) and then distilled water for 3-5 min. Antigen retrieval included incubating the slides in a citric acid retrieval solution heated to 98 ℃ for 2 minutes, then cooling to room temperature (adding cold water and ice packs). The slides were transferred to a wet box and rinsed 3 times with PBS. After protein blocking, primary antibodies (1:200) were incubated overnight at 4 ℃. Then, after 30 minutes at room temperature, the slide was washed 3 times with PBS for 3 minutes each. After removal of PBS and protein blocking, secondary antibodies (1:1000) were added and incubated for 1h at room temperature. The slides were then washed 3 times for 3 minutes with PBS. After removal of the PBS, 1 drop of the prepared DAB solution (1 ml A:1 drop B:1 drop C) was added for DAB staining, followed by observation of the slide under a microscope. After washing with running water for 10min, hematoxylin was added for 1min, and then the slide was washed with water for 5min. The slides were then dehydrated in a series of ethanol (75%, 85%, 95%, 100%) and 100% xylene and fixed with a dry neutral resin coverslip.

5.3 Assessment of expression of various proteins in MM

Expression of various proteins in MM was assessed by semi-quantitative analysis based on staining intensity and percent positive cells. The staining intensity scoring criteria were: no coloration-0, low intensity (pale yellow) -1, medium intensity (light brown) -2, high intensity (dark brown) -3. Randomly selecting 5 fields under a microscope (400×), taking 500 cells as a unit; at the same time, the percentage of positive cells was calculated. The percentage scores were as follows: <5% -0%, 6% -25% -1%, 26% -50% -2;51% -75% -3, >75% -4. The scoring criteria is the product of staining intensity and percentage of positive cells: 0-negative (-), 1-4-positive (+), 5-8-moderate positive (++), 9-12-Strength positive (+++). 5.4 Small RNA sequencing (smallRNA-seq) A375 cells were transfected with si-circ_0084043 and si-NC. After 48h, total RNA was extracted with TRIzol reagent. The total RNA extracted per sample was 3. Mu.g and was used as input material for small RNA libraries.

Using

Multiplex Small RNA Library Prep Set for />

(NEB, usa) a sequencing library was generated and an index code was added to the attribute sequence of each sample. NEB 3'sr Adapter is directly and specifically linked to the 3' end of miRNA, siRNA and piRNA. After the 3' ligation reaction, the SRRT primer hybridizes to an excess of 3' SR Adapter (remaining free after the 3' ligation reaction) and converts the single-stranded DNA Adapter into a double-stranded DNA molecule. This step is important to prevent the formation of linker dimers. Furthermore, DSDNAs are not ligation substrates mediated by T4 RNA ligase 1 and therefore are not ligated to 5' sr adapter in a subsequent ligation step. The 5 'terminal linker was ligated to the 5' ends of miRNA, siRNA and piRNA, and then the first strand cDNA was synthesized using M-MuLV reverse transcriptase (RNaseH-). PCR amplification was performed using LongAmp Taq 2X Master Mix, SR Primer for Illumina and index (X) primers. The PCR product was purified on an 8% polyacrylamide gel (100V, 80 min). Recovering 140-160 bp DNA fragment(length of small non-coding RNA plus 3 'and 5' linkers) was dissolved in 8. Mu.L of eluate. Finally, library quality was assessed on a Agilent Bioanalyzer 2100 system using a DNA high sensitivity chip. Index encoded samples were clustered at cBot Cluster Generation System using TruSeq SR Cluster Kit v-cBot-HS (illumina). After cluster generation, library preparations were sequenced on an Illumina Hiseq 2,500/2,000 platform and 50bp single-ended reads were generated.

5.5 Dual luciferase reporter detection

Wild-type and mutant fragments of circ0084043 were inserted into the pSI-Check2 vector. A375 and a875 cells were seeded in 24-well plates and incubated overnight at 37 ℃. The cells were then co-transfected with a luciferase reporter vector and a miR-134-5p mimic or miR-134-5p inhibitor using Lipofectamine3000 (Invitrogen). Luciferase activity was detected by Dual-Luciferase Reporter Assay System 48 after 48 hours of transfection.

5.6 immunoprecipitation of protein complexes (Co-IP)

PCDH9-Flag was overexpressed by lentiviral infection in A375 and G361 cell lines and cultured in DMEM medium containing 10% FBS. Subsequently, after discarding the cell culture medium and washing once with ice PBS, the cells were lysed in 1ml buffer containing TBS and 1% Triton X-100 and PMSF. The solution was collected in a 1.5ml Ep tube, and after centrifugation (1,000 rpm,15 minutes), the supernatant was collected. For preparation of the input samples, 80. Mu.L of protein solution was boiled with 20. Mu.L of 5 Xloading buffer. The remaining solution was incubated with 2. Mu.L of anti-Flag antibody overnight at 4 ℃. Protein G agarose beads (40. Mu.L per tube) were then added and the solution was shaken at 4℃for 3h and after centrifugation (2,500 rpm for 5 min) the supernatant was removed. The precipitate was washed 5 times with PMSF lysis buffer (1 ml each time), and after addition of loading buffer (40. Mu.L), it was boiled at 100℃for 10min. The control group was incubated with mouse IgG.

5.7 in vivo tumor growth assay

Female nude mice six weeks old were housed in SPF animal houses. Will be 5X 10 ⁶ A375 and a375 cells were transfected with PCDH9 over-expression plasmid, PCDH9 KD plasmid or empty plasmid in 150 μl PBS and then mice were inoculated subcutaneously. After 35 daysMice were sacrificed and tumors were removed and the tumor sizes of each group were measured.

In conclusion, the circ_0084043 can target miR-134-5p so as to regulate PCDH9 and has important effects on invasion, metastasis and apoptosis of malignant melanoma, and data show that circ_0084043 up-regulates PCDH9 can inhibit MM invasion, metastasis and promote apoptosis by inhibiting Rac1, MMP2 and MMP9, and up-regulates PCDH9 can obviously inhibit MM proliferation in tumor-bearing mice, and down-regulates PCDH9 promotes MM proliferation with tumor inhibition efficiency of more than 50%. The medicine targeting circ_0084043 can remarkably inhibit the development of malignant melanoma and achieve the effect of treating the malignant melanoma; it was also confirmed that PCDH9 as an oncogene can suppress malignant melanoma.

In summary, in the description herein, a description of the terms "one embodiment," "example," "specific example," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The preferred embodiments of the invention disclosed above are intended only to assist in the explanation of the invention. The preferred embodiments are not exhaustive or to limit the invention to the precise form disclosed. Obviously, many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, to thereby enable others skilled in the art to best understand and utilize the invention. The invention is limited only by the claims and the full scope and equivalents thereof.

Accessory

SEQ ID NO.1

AAAGAAAGGTTTTGGTGGAACTGCAGGAATGGCATTTGTGGGAACAGTGTGTTCAAGGAGCCACGCAGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCAGGAGGTACTTTATGCCGAGGAAAAACCAGTGAGTGTGATGTTCCAGAGTACTGCAATGGTTCTTCTCAGTTCTGTCAGCCAGATGTTTTTATTCAGAATGGATATCCTTGCCAGAATAACAAAGCCTATTGCTACAACGGCATGTGCCAGTATTATGATGCTCAATGTCAAGTCATCTTTGGCTCAAAAGCCAAGGCTGCCCCCAAAGATTGTTTCATTGAAGTGAATTCTAAAGGTGACAGATTTGGCAATTGTGGTTTCTCTGGCAATGAATACAAGAAGTGTGCCACTGGGAATGCTTTGTGTGGAAAGCTTCAGTGTGAGAATGTACAAGAGATACCTGTATTTGGAATTGTGCCTGCTATTATTCAAACGCCTAGTCGAGGCACCAAATGTTGGGGTGTGGATTTCCAGCTAGGATCAGATGTTCCAGATCCTGGGATGGTTAACGAAGGCACAAAATGTGGTGCTGGAAAGATCTGTAGAAACTTCCAGTGTGTAGATGCTTCTGTTCTGAATTATGACTGTGATGTTCAGAAAAAGTGTCATGGACATGGGGTATGTAATAGCAATAAGAATTGTCACTGTGAAAATGGCTGGGCTCCCCCAAATTGTGAGACTAAAGGATACGGAGGAAGTGTGGACAGTGGACCTACATACAATGAAATGAATACTGCATTGAGGGACGGACTTCTGGTCTTCTTCTTCCTAATTGTTCCCCTTATTGTCTGTGCTATTTTTATCTTCATCAAGAGGGATCAACTGTGGAGAAGCTACTTCAGAAAGAAGAGATCACAAACATATGAGTCAGATGGCAAAAATCAAGCAAACCCTTCTAGACAGCCGGGGAGTGTTCCTCGACATGTTTCTCCAGTGACACCTCCCAGAGAAGTTCCTATATATGCAAACAGATTTGCAGTACCAACCTATGCAGCCAAGCAACCTCAGCAGTTCCCATCAAG

Claims (4)

1. A circRNA marker for the diagnosis of malignant melanoma, characterized in that the marker is a circular RNA: the RNA sequence of circ_0084043 is shown as SEQ ID NO. 1.

Use of circ_0084043 for the preparation of a kit for diagnosing malignant melanoma.

3. Use of circ0084043 according to claim 2 for the preparation of a kit for diagnosing malignant melanoma;

the kit is a primer or reagent comprising a recognition circle 0084043.

Use of circ_0084043 for the preparation of a medicament for the treatment of malignant melanoma.

Images