CN116042805A - Application of exosome miRNA as cisplatin ototoxicity biomarker and targeted therapy thereof - Google Patents

Abstract

The invention discloses application of exosome miRNA as a cisplatin ototoxicity biomarker and targeted therapy thereof, and belongs to the technical field of biology. The mi RNA spectrum in the tissue secretion exosome under the mouse cisplatin ototoxicity model is analyzed, and the fact that 10 specific mi RNA is carried in the exosome of the experimental group, namely the secretion exosome under the cisplatin ototoxicity, can be used as a specific biomarker for diagnosing the cisplatin ototoxicity of the mouse, and analyzes specific molecular information of the mouse under the cisplatin ototoxicity model from a new aspect.

Description

Application of exosome miRNA as cisplatin ototoxicity biomarker and targeted therapy thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of exosome miRNA as a cisplatin ototoxicity biomarker and targeted therapy thereof.

Background

About 4.66 million people worldwide have disabling hearing loss reported by the World Health Organization (WHO) at 3 months 2021, about 5% of the world population, and it is estimated that 9 hundred million people will develop disabling hearing impairment in 2050. Among them, sensorineural hearing loss patients occupy a major part, and have become a serious global public health problem. Many factors in life lead to sensorineural hearing loss including ototoxic side effects from the use of cisplatin, a chemotherapeutic agent. Currently, there is no clear study on the mechanism of Guan Shunbo ototoxicity, particularly the manner in which inner ear sensory cells signal transduction following cisplatin drug action. This means that the study of cisplatin ototoxicity mechanisms and the development of related therapeutic targeted drugs lacks some valuable information. Thus, there is a need to more fully explore those signal transduction of inner ear sensory cells after suffering from cisplatin drug damage.

Exosomes are lipid bilayer nanovesicles secreted by almost all cells, which can carry a variety of biomolecules (including proteins, lipids, nucleic acid molecules, etc.) involved in signal transduction between cells, thereby mediating important molecular signal communication processes. Research shows that exosome miRNAs are the most abundant nucleic acid molecules in exosomes, play an important regulatory role in the development and progression of various diseases, and are generally tissue-specific, and thus are used as biomarkers in many diseases for diagnosis of the diseases (for example, application of plasma exosome miRNAs in endometrial cancer screening, patent number CN 112575088B). However, there is currently no study relating to exosome mirnas in sensorineural hearing loss.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide the application of exosome miRNA as a cisplatin ototoxicity biomarker and targeted therapy thereof.

The aim of the invention can be achieved by the following technical scheme:

a kit for detecting cisplatin ototoxicity, comprising reagents for detecting the expression level of a miRNA, said miRNA being represented by SEQ ID NO:1 to 10.

For detecting SEQ ID NO: 1-10 in the preparation of a kit for detecting cisplatin ototoxicity.

For detecting SEQ ID NO: 1-10, and the application of the reagent for detecting miRNA expression level in screening potential drugs for treating cisplatin ototoxicity.

A medicament for treating hearing loss repair, the medicament comprising the following set of SEQ ID NOs: 11-18.

Further, the miRNA molecule is used as a cisplatin ototoxicity control target.

Further, the medicament also comprises an exosome for carrying the miRNA molecule.

SEQ ID NO: 11-18 in the preparation of a medicament for treating cisplatin ototoxicity.

The invention has the beneficial effects that:

1. the invention analyzes miRNA spectrum in tissue secretion exosomes under a mouse cisplatin ototoxicity model for the first time, and discovers that 10-specific miRNA is carried in the exosomes of an experimental group, namely the exosomes under cisplatin ototoxicity, and can be used as a specific biomarker for diagnosing the cisplatin ototoxicity of the mouse, so that specific molecular information of the mouse under the cisplatin ototoxicity model is analyzed from a new aspect.

2. The research finds that 8 miRNA molecules which are obviously related to apoptosis, oxidative stress and inflammatory reaction regulation and control are contained in the exosomes of the experimental group and can be used as novel regulation and control targets of cisplatin ototoxicity and used for repairing and treating the cisplatin ototoxicity hearing loss. These molecules are carried by tissue secretory exosomes and can be involved in intercellular signal communication, thus mediating inner ear sensory cell injury induced by cisplatin ototoxicity. The molecular regulatory mechanism of cisplatin ototoxicity was resolved at a new view angle.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described, and it will be obvious to those skilled in the art that other drawings can be obtained according to these drawings without inventive effort.

FIG. 1 is a model construction process in vitro of cisplatin ototoxicity in mice;

FIG. 2 is an exosome smallRNA sequencing analysis.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention uses in vitro construction of mouse cisplatin ototoxicity model, and the specific construction process is shown in figure 1

(1) First, the cochlear basement membrane of the neonate 3 days postnatal (P3) was dissected in a sterile environment, the tissue was attached to a circular coverslip with celltak, and placed in a 3.5cm dish well dish for culture. The medium was DMEM/F12 supplemented with 10% foetal calf serum and 0.05% ampicillin. The cochlear tissue was allowed to grow on a glass slide by overnight incubation at 37℃in a culture environment with 5% CO2 concentration. Then the medium was changed and the foetal calf serum in the medium was changed to exosome foetal calf serum (170 g,4 ℃ C., after ultracentrifugation for more than 12 hours, 2/3 of the supernatant was taken as foetal calf serum from which exosomes were removed), 50uM cisplatin was added to the experimental group (cisplatingroup) for culturing for 48 hours, and an equal amount of Phosphate Buffer (PBS) was added to the control group (control group) for the same culturing. Wherein the dosing was changed every 24 hours and the tissue culture supernatants of each group were collected and placed in 50ml ep tubes for extraction of tissue secretion exosomes.

(2) The collected culture supernatant was then subjected to gradient centrifugation to separate exosomes. Culture supernatants from experimental and control groups were first centrifuged at 600g for 10 min at 4℃and the supernatant was transferred to a new 50ml EP tube, and after centrifugation at 2000g for 20 min at 4℃the cell debris from the pellet was removed and the supernatant was transferred to a new 50ml EP tube. Subsequently, the supernatant was filtered through a 0.22um bacterial filter and the supernatant was collected by high-speed centrifugation at 16500g at 4℃to remove large vesicles from the pellet. Finally, the supernatant was transferred to a Beckman high-speed centrifuge tube for ultracentrifugation of 110000g, centrifuged at 4℃for 2 hours, and the centrifuged supernatant was decanted, resuspended in phosphate buffer, and then ultracentrifuged for another 110000g for 2 hours to purify the isolated exosomes. After centrifugation, the supernatant was decanted, the exosome pellet was resuspended with 200ul of phosphate buffer and collected into 1.5ml low adhesion EP tubes, stored frozen in-80 ℃ refrigerator and used for subsequent miRNA sequencing analysis.

(3) The exosomes of the experimental group and the control group each contained 3 biological replicates, and were analyzed for exosome micrornas by using a smallRNA sequencing platform. Firstly extracting total RNA of an exosome sample, separating the total RNA by using PAGE electrophoresis, and cutting and purifying the RNA with the size of 18-30 nt. The 5 'end of the purified small RNA was then ligated with a single stranded DNA linker of 5-adenylated and 3-blocked 3' end. RT primers with UMI were added to the system and hybridized to the 3' linker. A strand of cDNA was then synthesized by reverse transcription extension with the UMI-carrying RT primer. Next, a strand of cDNA was amplified using a hypersensitive polymerase. PCR products of 110-130bp size were then separated as sequencing libraries using PAGE gels and quantified and pooling circularization was performed. And then, quality inspection is carried out on the library, and sequencing is carried out on the library after the quality inspection is qualified.

After the sequencing result is obtained, the 49nt sequence obtained by sequencing is subjected to the processes of removing linker, removing low quality, decontaminating and the like to complete data filtration to obtain a reliable target sequence for standby analysis, and then statistics of sequence length distribution and common sequence statistics among samples are carried out on the target sequence. The cleaned target sequence is processed according to

The small RNAs are classified and annotated according to the priority order of MiRbase > pirnabank > snorRNA (human/plant) > Rfam > other RNA database, and all components and expression quantity information contained in the sample are obtained.

(4) And according to the sequencing result, dividing miRNA with the Q value smaller than or equal to 0.05 (Qvalue smaller than or equal to 0.05) into differential expression miRNA, wherein the expression difference multiple between the experimental group and the control group is larger than 2 (Foldchange is larger than 2). According to statistical analysis, there were 74 up-regulated and 9 down-regulated mirnas differentially expressed in the cispatin group compared to the control group (fig. 2A). The specific miRNA conditions are shown in a cluster thermal diagram of differential expression miRNA between a Bcon group and a cispatin group in FIG. 2, and shown in a table 1, wherein the cluster thermal diagram comprises 10 specific unreported miRNAs, including novel-mmu-miR121-3p, novel-mmu-miR146-5p, novel-mmu-miR208-3p, novel-mmu-miR327-3p, novel-mmu-miR220-5p, novel-mmu-miR351-5p, novel-mmu-miR389-3p, novel-mmu-miR433-5p, novel-mmu-miR474-5p and novel-mmu-miR68-3p.

In fig. 2, (a) there were 74 up-regulated and 9 down-regulated mirnas differentially expressed in the cisstatin group compared to the control group; (B) clustering heat map of mirnas differentially expressed between control group and cispatin group. Which included 10 specific mirnas.

(5) And (3) carrying out functional analysis on the differentially expressed miRNA in the experimental group by utilizing literature research, and exploring a functional miRNA molecule which is carried by the exosome of the experimental group and possibly participates in the development of cisplatin ototoxicity. Firstly, searching each differential miRNA molecule in a PubMed database, for example, inputting 'mmu-miR-34 a-5 p' or 'miR-34 a-5 p', and then researching the searched documents to find that 8 miRNA molecules are obviously related to apoptosis, oxidative stress and inflammatory response regulation. The specific information and sequence are shown in table 2.

MiRNA class	Sequence information
		novel-mmu-miR121-3p	UAACGUGUGAGUGUGUGUUUU
novel-mmu-miR146-5p	UUGCUGGGGUGUGCAUGGUGU
		novel-mmu-miR208-3p	UCCCUCAGACCCUAACUUU
novel-mmu-miR327-3p	ACACACACACACACACACACU
		novel-mmu-miR220-5p	UGCUAUGAUGAAGGCUAUGUUGGUA
novel-mmu-miR351-5p	GGAGGAGGAGGAGGAGGA
		novel-mmu-miR389-3p	GCCGAAAGCAUGGGAACAGCC
novel-mmu-miR433-5p	CCCGGGGAGCCCGGCGGGC
		novel-mmu-miR474-5p	CCUGUCUGUGCCUGCUGUAC
novel-mmu-miR68-3p	UCCCUGAGACCCUUUAAC

Table 1 specific miRNA carried in exosomes of experimental group and sequence information thereof.

MiRNA class	Sequence information
		mmu-miR-124-3p	UAAGGCACGCGGUGAAUGCC
mmu-miR-140-5p	CAGUGGUUUUACCCUAUGGUAG
		mmu-miR-15b-5p	UAGCAGCACAUCAUGGUUUACA
mmu-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAG
		mmu-miR-25-3p	CAUUGCACUUGUCUCGGUCUGA
mmu-miR-339-5p	UCCCUGUCCUCCAGGAGCUCACG
		mmu-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU
mmu-miR-370-3p	GCCUGCUGGGGUGGAACCUGGU

Table 2 mirnas in exosomes of the experimental group that are clearly associated with the regulation of apoptosis, oxidative stress and inflammatory response.

In the description of the present specification, the descriptions of the terms "one embodiment," "example," "specific example," and the like, mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims.

Claims (7)

1. A kit for detecting cisplatin ototoxicity, comprising a reagent for detecting the expression level of a miRNA, wherein the miRNA is SEQ ID NO:1 to 10.

2. For detecting SEQ ID NO: 1-10 in the preparation of a kit for detecting cisplatin ototoxicity.

3. For detecting SEQ ID NO: 1-10, and the application of the reagent for detecting miRNA expression level in screening potential drugs for treating cisplatin ototoxicity.

4. A medicament for the treatment of hearing loss repair, comprising the following set of SEQ ID NOs: 11-18.

5. A medicament for the treatment of hearing loss repair according to claim 4, wherein the miRNA molecule acts as cisplatin ototoxicity regulatory target.

6. The pharmaceutical composition for treating hearing loss according to claim 4, further comprising an exosome for carrying a miRNA molecule.

SEQ ID NO: 11-18 in the preparation of a medicament for treating cisplatin ototoxicity.

Images