CN116042712A

CN116042712A - Fusion expression plasmid of novel coronavirus S protein and RFP gene and application thereof

Info

Publication number: CN116042712A
Application number: CN202211421813.9A
Authority: CN
Inventors: 张韦唯; 戴方平
Original assignee: Jiangsu Zhongfang Gene Biomedical Technology Co ltd
Current assignee: Jiangsu Zhongfang Gene Biomedical Technology Co ltd
Priority date: 2022-11-14
Filing date: 2022-11-14
Publication date: 2023-05-02

Abstract

The invention provides a plasmid for testing RNAi interference effect, which comprises a pLVX IRES mCherry RFP vector and an RNAi target sequence; the RNAi target sequence comprises fragments encoding most of RBD and a conserved region downstream of the RBD of SARS-CoV-2S protein; the pLVX IRES mCherry RFP included the pCMV promoter, the multiple cloning site MCS, the mCherry-red fluorescent protein RFP gene, and the 3' ltr. The invention inserts SARS-CoV-2 protein gene partial sequence and mCherry Red Fluorescent Protein (RFP) gene into fusion gene at the downstream of plasmid pCMV driver to construct pCMV-SARS-CoV-2-RBD-EST-RFP as potential target to test the interference effect of shRNA.

Description

Fusion expression plasmid of novel coronavirus S protein and RFP gene and application thereof

Technical Field

The invention belongs to the technical field of biological medicine, and in particular relates to a fusion expression plasmid of a novel coronavirus S protein and an RFP gene and application thereof.

Background

Plasmids are DNA molecules other than chromosomes (or pseudonucleuses) in organisms such as bacteria, yeasts and actinomycetes, exist in cytoplasm (except yeasts, and 2 μm plasmids of yeasts exist in nuclei), have autonomous replication capacity, can keep constant copy number in daughter cells, express carried genetic information, and are double-stranded DNA molecules in closed loops. Plasmids are not essential for bacterial growth and reproduction, and can be lost by themselves or eliminated by artificial treatment, such as high temperature, ultraviolet light, etc. The genetic information carried by the plasmid can endow the host bacteria with certain biological characters, and is favorable for survival of the bacteria under specific environmental conditions.

Fluorescent imaging has the advantages of convenience, intuitionism, low price, multiple labeling targets and the like, and is widely applied to the field of cell and living body imaging. The fluorescent imaging probe is a basis for realizing fluorescent imaging, and the widely used fluorescent imaging probe comprises green fluorescent protein, red fluorescent protein, other fluorescent reporter groups, fluorescent dyes, quantum dots, noble metal nanoclusters, carbon dots and the like.

mCherry is a red fluorescent protein from mushroom coral (mushroom coral) that is often useful for labeling and tracing certain molecules and cellular components. The advantage of mCherry over other fluorescence is that its color and most used Green Fluorescent Protein (GFP) can be co-tagged and mCherry also has excellent light stability over other monomeric fluorescent proteins.

The fusion gene is formed by using mCherry Red Fluorescent Protein (RFP) gene and SARS-CoV-2 protein gene partial sequence, and pCMV-SARS-COV-2S protein RBD-EST-RFP is constructed as potential target, so that the interference effect of shRNA can be effectively tested. At present, no related report exists in the prior art for testing shRNA interference effect by using mCherry Red Fluorescent Protein (RFP) genes.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provides a novel fusion expression plasmid of coronavirus S protein and RFP gene and application thereof.

The aim of the invention is realized by the following technical scheme:

first aspect:

the invention relates to a plasmid for testing RNAi interference effect, which constructs a target sequence of RNAi on the basis of a basic plasmid pLVX IRES mCherry RFP vector (http:// www.honorgene.com/product_list/carrier_library/126361. Html);

the RNAi target sequence comprises a fragment encoding a majority of the SARS-CoV-2S protein RBD and a portion downstream of the RBD;

the pLVX IRES mCherry RFP included the pCMV promoter, the multiple cloning site MCS, the mCherry-red fluorescent protein RFP gene, and the 3' ltr.

The RNAi is a shRNA target gene.

The RNAi target sequence is shown as SEQ ID NO. 1.

Second aspect:

the invention provides a construction method of the plasmid, which comprises the following steps:

step 1, digestion of the circular vector pLVX IRES mCherry RFP with the enzyme XhoI (C' TCGAG) opens the loop of the circular vector pLVX IRES mCherry RFP;

step 2, further digesting the ring-opened pLVX IRES mCherry RFP by Sac II (CCGC' GG) to obtain a fragment 1 (6337 bp) and a fragment 2 (1810 bp); wherein fragment 1 has a SacII (CCGC ' GG) sticky end at the 5' end and an XhoI (C ' TCGAG) sticky end at the '3' end; fragment 2 had SacII (CCGC' GG) sticky ends at both ends;

step 3, further digesting the fragment 2 by KpnI (GGTAC' C) to obtain a fragment 2.1 (454 bp) and a fragment 2.2 (1356 bp); wherein fragment 2.2 (1356 bp) has a KpnI (GGTAC 'C) sticky end at the 5' end and a SacII (CCGC 'GG) sticky end at the 3' end;

step 4, constructing and obtaining plasmid pCMV-SARS-CoV-2-RBD-EST-RFP by ligating double-stranded DNA fragment (6337 bp) with XhoI (C 'TCGAG) and KpnI (GGTAC' C) cohesive ends, plasmid fragment 1 (636 bp) and plasmid fragment 2.2 (1356 bp) which encode most of SARS-CoV-2S protein RBD and part downstream (total 813bp,SEQ ID NO.1) after RBD with T4 DNA ligase to form a closed loop;

wherein the sequence of the fragment 1 is shown as SEQ ID No. 20; the sequence of the fragment 2 is shown as SEQ ID No. 21; fragment 2.1 has the sequence shown in SEQ ID No. 22; fragment 2.2 has the sequence shown in SEQ ID No. 23.

The application of the plasmid in shRNA screening targets also belongs to the protection scope of the invention.

The shRNA comprises the following sequence:

RBD-1F-250, the nucleotide sequence of which is shown as SEQ ID No. 2;

RBD-1R-250, the nucleotide sequence of which is shown as SEQ ID No. 3; or alternatively, the first and second heat exchangers may be,

RBD-1F-463 has a nucleotide sequence shown in SEQ ID No. 4;

RBD-1R-463 has the nucleotide sequence shown in SEQ ID No. 5; or alternatively, the first and second heat exchangers may be,

RBD-1F-544, the nucleotide sequence of which is shown as SEQ ID No. 6;

RBD-1R-544, the nucleotide sequence of which is shown in SEQ ID No. 7; or alternatively, the first and second heat exchangers may be,

RBD-1F-688, the nucleotide sequence of which is shown as SEQ ID No. 8;

RBD-1R-688 has a nucleotide sequence shown in SEQ ID No. 9.

Preferably, the shRNA comprises the following sequence:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAAC ACCTTTTTTG; as shown in SEQ ID NO. 8.

The sense sequence of the shRNA is shown as SEQ ID NO. 10.

Third aspect of the invention

The invention provides a method for measuring shRNA interference effect, which is characterized by comprising the following steps:

the plasmid pCMV-SARS-CoV-2-RBD-EST-RFP constructed by the construction method and the recombinant plasmid containing shRNA are transfected into HEK293T cells together,

cells transfected with pCMV-SARS-CoV-2-RBD-EST-RFP plasmid exhibit red fluorescence;

cells transfected with the recombinant plasmid containing shRNA are green fluorescent;

cells transfected with pCMV-SARS-CoV-2-RBD-EST-RFP and shRNA-containing recombinant plasmid simultaneously exhibit yellow fluorescence.

The construction method of the shRNA-containing recombinant plasmid comprises the following steps:

s1, taking a pSIL-EGFP vector containing a pCMV-EGFP gene of a gene transfection marker as a basic vector;

s2, a human RNA polymerase III type promoter H1 promoter is constructed at the upstream of the pCMV-EGFP region through XhoI (C 'TCGAG) and HindIII (A' AGCTT) enzyme cutting sites;

s3, shRNA was integrated downstream of the H1 promoter by HindIII (A 'AGCTT) and EcoRI (A' AGCTT) building sites.

The application of the method for determining the shRNA interference effect in shRNA screening also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention inserts SARS-CoV-2S protein gene partial sequence and mCherry Red Fluorescent Protein (RFP) gene into fusion gene at the downstream of pCMV driver of plasmid, constructs pCMV-SARS-CoV-2-RBD-EST-RFP as potential target to test the interference effect of shRNA. The present invention uses pLVX IRES mCherry RFP plasmid as basic carrier, drives mCherry RFP fusion gene expression by pCMV, removes most IRES of said plasmid between XhoI and KpnI, and integrates the synthesized DNA fragment containing sense strand (813 nt) coding most of S protein RBD and its reverse complementary strand annealed into double-chain into said plasmid so as to construct pCMV-SARS-CoV-2-RBD-EST-RFP plasmid capable of expressing fusion gene of SARS-CoV-2S protein gene component and mCherry Red Fluorescent Protein (RFP), and the transcript expressed by said fusion gene can be used as target for testing interference of shRNA.

2. The invention provides a cell model and technical support for the research and development of broad-spectrum small nucleic acid RNAi anti-SARS-CoV-2 drugs or other RNAi drugs which harm human disease viruses.

3. Co-transfection of shRNA and EGFP co-expression plasmid, S protein gene fragment and RFP fusion gene plasmid in human cell line provides a useful cell experimental model for RNAi research.

In view of laboratory biosafety, we constructed a plasmid containing the pCMV-S protein RBD EST-RFP fusion gene and sent the S protein gene fragment into experimental cells. We carefully selected the fragments and linked them as fusion genes that do not produce any fusion proteins, but instead produce wild-type RFP genes as gene transfection markers.

If the transfected cells express the constructed fusion gene containing the S protein RBD EST-RFP, the cells are red fluorescent. Considering the transfer efficiency of shRNA to RNAi, we constructed pCMV-EGFP-pH1-shRNA plasmid. In one configuration, pCMV drives EGFP expression and the human H1 promoter drives shRNA expression. We used LipofectAMINE2000 to mediate transfection of pCMV-S protein RBD EST-RFP fusion gene plasmids and pCMV-EGFP-pH1-shRNA plasmids into cultured cells. The gene transfection efficiency was easily observed under a fluorescence microscope. Co-transfection efficiency can be observed by image fusion analysis of red fluorescence and green fluorescence. Co-transfected cells (yellowish) averaged about 20-30%, and further subjected to RT-qPCR to determine the concentration of the S protein Est fusion gene transcript of interest to test the RNAi effect of shRNA. Here, we report shRNA688 in this study, since we have observed RNAi results for shRNA688, we did not attempt to classify cells expressing red or green fluorescent genes by flow cytometry (FASC).

Drawings

Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:

FIG. 1 is a cluster analysis of the RBD region of the S protein of SARS-CoV-2 variant and a subsequent partial downstream region;

FIG. 2 is the positions of shRNA250, shRNA463, shRNA544, and shRNA688 of the S protein gene targeting SARS-CoV-2 Delta;

FIG. 3 is a position of shRNA688 targeting the downstream portion of SARS-CoV-2s S protein gene after RBD;

FIG. 4 is a schematic diagram of the construction of pCMV-EGFP-pH1-shRNA688 plasmid;

FIG. 5 is a schematic diagram showing the construction of pCMV-SARS-CoV-2-RBD-EST-RFP plasmid;

FIG. 6 is a schematic representation of the linkage of the RBD of the SARS-CoV-2Delta S protein and the partial downstream region (813 nt) insert (gene sequence shown in bold underlined) following RBD to the RFP gene;

FIG. 7 is a fluorescent image analysis (10 Xobjective, leka) of S protein RBD-RFP fusion gene, shRNA250 and EGFP gene transfected cells, wherein; (A) cell growth after cotransfection (in sunlight); (B) the cell expresses RFP with green fluorescence; (C) the EGFP gene expressed by the cells has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, which eventually appeared yellow after image fusion.

FIG. 8 is a fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA544 and EGFP gene transfected cells (10X objective, leica); wherein; (A) cell growth after cotransfection (in sunlight); (B) the cell expresses RFP with green fluorescence; (C) the EGFP gene expressed by the cells has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, which eventually appeared yellow after image fusion.

FIG. 9 is a fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA463 and EGFP gene transfected cells (10X objective, leica); wherein; (A) cell growth after cotransfection (in sunlight); (B) the cell expresses RFP with green fluorescence; (C) the EGFP gene expressed by the cells has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, which eventually appeared yellow after image fusion.

FIG. 10 is a fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA688 and EGFP gene transfected cells (10X objective, leica); wherein; (A) cell growth after cotransfection (in sunlight); (B) the cell expresses RFP with green fluorescence; (C) the EGFP gene expressed by the cells has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, which eventually appeared yellow after image fusion.

FIG. 11 is a fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA blank control and EGFP gene transfected cells (10X objective, leka); wherein; (A) cell growth after cotransfection (in sunlight); (B) the cell expresses RFP with green fluorescence; (C) the EGFP gene expressed by the cells has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, which eventually appeared yellow after image fusion.

FIG. 12 shows the degradation efficiency of shRNA688 on novel coronavirus S protein ESTs.

FIG. 13 is a shRNA688 of S protein gene targeting SARS-CoV-2 delta.

Detailed Description

The invention will now be described in detail with reference to the drawings and specific examples. The following examples, which are presented to provide those of ordinary skill in the art with a detailed description of the invention and to provide a further understanding of the invention, are presented in terms of implementation and operation. It should be noted that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made on the premise of the inventive concept are all within the protection scope of the present invention.

Example 1 determination of the Gene of interest

The polygene and S protein sequences of SARS-CoV-2 variant, α, β, γ, δ and armuronate were obtained from genbank (https:// www.ncbi.nlm.nih.gov/nuccore/. SRAS-CoV-2 was clustered by the UCSC genome browser's online tool (http:// genome. UCSC. Edu/cgi-bin/hgBlat), and the analysis system (Clustal Omega) (https:// www.ebi.ac.uk/Tools/msa/clustalo /). The conserved regions were selected according to the sequence of the S protein gene of SRAS-CoV-2.

The invention selects RNAi targets by analyzing the conserved and mutated sequences of SARS-CoV-2 mutant. The whole RNA genome of SARS-CoV-2 mutant and S protein gene thereof were subjected to cluster analysis. S protein genes can be identified as being located in their RNA genome. In the SARS-CoV-2delta mutant genome, the S protein gene (3816 nt) starts at 21517nt and ends at 25332nt. The RBD (317-539 aa) sequence of the S protein (1271 aa) coding region of genome (OL 903477.1) starts at 22465nt and ends at 23133nt.

Described as a sequence in sp|p0dtc2|spike_sars2) starts from 22465nt to 23133nt ends (as in fig. 1). FIG. 1 is a cluster analysis of the S protein RBD region of SARS-CoV-2 variant: there is at least one peptide level mutation per RBD region, as shown by the two blocks (bold solid boxes). In these blocks, mutations in the peptide sequence (blank background) are from different S protein RBD subtypes of SARS-CoV-2 variant, including the Omicron variant within the dashed box. In the last line, sequences containing RBD and part downstream of RBD were derived from Delta, 813nt cDNA was selected to integrate into RFP gene overexpression plasmid as shRNA target of the present invention. The peptide region downstream (grey box) after RBD is highly conserved in all variants without any mutation.

Although there are different types of mutations in the RBD of the SARS-CoV-2S protein, the 813nt cDNA sequence (SEQ ID No. 1) encoding the RBD region portion of the SARS-CoV-2Delta S protein gene and the highly conserved portion downstream region after RBD was selected as a potential shRNA target, wherein

Mutation and conserved region confirmation of SARS-CoV-2 variant S protein RBD: a published SARS-CoV-2Spike protein (S protein, surface glycoprotein subtype, YP_ 009724390) consists of 1273 amino acids. Of these, 223 amino acids (319-541) are used for the Receptor Binding Domain (RBD). RBD is used to bind human ACE2 (https:// www.uniprot.org/uniprotkb/P0DTC 2). The sequence of S protein gene of SARS-CoV-2 variant and its translation protein subtype is clustered by using cDNA and protein sequence of S protein and RBD as reference. The results indicate that there is at least one amino acid mutation per RBD of the S protein subtype. There are several mutations in omacrons BA BA.1, BA5.1.3, BA.5.2.1. However, there is a conserved region downstream of RBD that has no mutation. In this study we selected 813nt cDNA sequences encoding most of the RBD region and part downstream of the RBD of the SARS-CoV-2Delta S protein (FIG. 1). The cDNA sequence and its reverse complement are synthesized and annealed to fragments, which are integrated with RFP cDNA to form fusion genes in pCMV RFP expression plasmids.

Example 2 design of shRNA

Based on RNAi principle, 4 shRNA sequences were designed. In this study, shRNA was designed based on the 813nt (SEQ ID No. 1) insert of Delta (see fig. 2, table 1).

FIG. 2 shows shRNA250, shRNA463, shRNA544, and shRNA688 of the S protein gene targeting SARS-CoV-2 Delta. The S protein gene of SARS-CoV-2Delta and the position of its encoded protein are indicated.

TABLE 1 oligonucleotide sequences for construction of shRNA expression plasmids

Considering that shRNA was not only directed to Delta, but also to omics and other variants, we eventually selected shRNA688 near the downstream portion of the S protein gene RBD, but in a highly conserved region (fig. 3).

FIG. 3 shows shRNA688 targeting the downstream portion of SARS-CoV-2s S protein gene after RBD. The sense sequence of shRNA688 is "GGT GTT CTT ACT GAG TCT AAC", as shown in SEQ ID NO.10, which is within complete identity (in bold frame, upper region) downstream after all RBDs of the SARS-CoV-2 variant S protein gene. If the sense sequence of shRNA688 is translated into a peptide sequence as a reference, it is "GVLTESN" (light box, lower region), which is identical to all of the comparison peptide sequences of the S protein subtype, although there is a mutation in the RBD peptide sequence of the SARS-CoV-2 variant S protein.

shRNA688, whose sense sequence is "GGTGT TCTTA CTGAG TCTAA C", downstream of the RBD of all SARS-CoV-2 variant S protein genes, is completely identical (fig. 3 and 4).

The sense sequence (21 bp) of shRNA688 was selected, and the target sequence of the S protein gene of SRAS-CoV-2 was identical. After the forward sequence (21 bp) there is a circular sequence with "TTCAAGAC". Thereafter, there is a reverse complement (21 bp) fragment and a poly (T) 6 fragment.

shRNA688 shRNA matched not only Delta, but also S protein mRNA conserved regions in omacrons and other mutants.

EXAMPLE 3 construction of plasmid

1. Construction of pCMV-EGFP-pH1-shRNA688 expression vector

This example provides the construction of pCMV-EGFP-pH1-shRNA688 expression plasmid comprising the steps of:

step 1, basic carrier selection: to construct shRNA expression plasmids, pSIL-EGFP vectors containing the pCMV-EGFP gene used as a gene transfection marker gene were used as basic vectors (https:// www.addgene.org/52675/sequences /). The constructed pCMV-EGFP-pH1-shRNA688 expression plasmid is prepared on the basis of a pSIL-EGFP vector containing an Enhanced Green Fluorescent Protein (EGFP) gene driven by a pCMV promoter for gene transfection of a marker gene.

2、pCMV-EGFP-pH1-shRNA688

2.1, H1 promoter (108 bp) is one of the human RNA polymerase III type promoters; the H1 promoter (108 bp) was inserted into the XhoI (1704) and HindIII (1725) restriction sites and constructed upstream of the pCMV-EGFP region by XhoI and HindIII cleavage sites.

The annealed duplex of the forward strand of shRNA688 (4 elements shown) and its reverse complement were integrated downstream of the H1 promoter with HindIII (1725) and EcoRI (1737) restriction overhangs and confirmed by Sanger sequencing.

The shRNA688 cDNA contains 4 elements. The sense sequence is "GGT GTT CTT ACT GAG TCT AAC", loop "TTC AAG AGC", antisense "GTT AGA CTC AGT AAG AAC ACC", and "TTT" is terminated. Sanger sequencing confirmed the H1 promoter and shRNA688. The constructed plasmid carries a pCMV promoter for driving the expression of EGFP marker genes and a human H1 promoter for driving the expression of shRNA688, and shRNA688 is designed for targeting S protein transcripts of SARS-CoV-2. (FIG. 4)

The double-stranded DNA of shRNA688 was constructed downstream of the human H1 promoter of a plasmid that also simultaneously expressed the Enhanced Green Fluorescent Protein (EGFP) marker gene. RNAi treatment was analyzed by fluorescent quantitative reverse transcription polymerase chain reaction (qRT-PCR) plus specific probes for the degradation of mRNA of the SARS-CoV-2S protein gene transcript expressed in co-transfected HEK293T cells. The result shows that the shRNA688 can effectively reduce the mRNA of the SARS-CoV-2S protein gene transcript. The designed shRNA688 structure and its sequence are in the list (table 1).

As shown in FIG. 4, the constructed EGFP marker gene and shRNA688 co-expression plasmid targeting SARS-CoV-2S protein gene transcript was designated pCMV-EGFP-pH1-shRNA688. The pSIL EGFP expression plasmid was used as a basic vector. The human H1 promoter (108 bp) was inserted into the XhoI and HindIII restriction sites. The shRNA688 forward strand (4 elements shown) and its reverse complement were annealed to double strands, integrated into the downstream H1 promoter by HindIII and EcoRI restriction overhangs, and confirmed by Sanger sequencing.

2. Construction of corresponding plasmids of shRNA250, shRNA463 and shRNA544

The method for constructing shRNA250, shRNA463, shRNA544 plasmids is the same as the method for constructing shRNA688.

EXAMPLE 4 construction of expression plasmid containing fusion gene of RBD fragment and RFP of SARS-CoV-2S protein

1. Construction of fusion Gene expression plasmid (pCMV-SARS-CoV-2-RBD-EST-RFP) containing RBD fragment of SARS-CoV-2S protein and RFP

RBD EST and mCherry-Red Fluorescent Protein (RFP) fusion genes of SARS-CoV-2Delta S protein are constructed on the basis of pLVX-IRES mCherry RFP plasmid. For expressing potential targets to assess the effectiveness of shRNA interference.

1.1 selection and preparation of RBD-containing fragments of SARS-CoV-2Delta S protein Gene

One published surface glycoprotein subtype of SARS-CoV-2 (YP_ 009724390) consists of 1273 amino acids. Of these 223 amino acids (319-541) belong to the Receptor Binding Domain (RBD). RBD is used for binding to human ACE2 (https:// www.uniprot.org/uniprotkb/P0DTC 2/entry). The S protein gene sequence of SARS-CoV-2 variants and its protein subtype are clustered by using the S protein gene sequence, especially the gene component and protein sequence of RBD as reference. The results indicate that there is at least one amino acid mutation in each RBD of the S protein subtype. There are multiple mutations in the amikacin ba.1, BA5.1.3, ba.5.2.1 mutants. However, there were no mutations in the conserved regions downstream of RBD.

Based on a cluster analysis of the S protein sequence of the SARS-CoV-2 variant, a fragment (813 bp) containing the RBD sequence (EST) was selected from the S protein of the SARS-CoV-2Delta variant. This is a region that contains not only the specific mutation (S) of the SARS-CoV-2Delta S protein gene, but also a shared conserved region with that contained by the S protein genes of Omicron B.1, B.5 and other SARS-CoV-2.

To construct this EST expression plasmid containing the S protein RBD, the fragment sequence (813 bp) was synthesized as a sense strand, its reverse complement as an antisense strand, and a small number of nucleotides were added at both ends. After annealing the forward and antisense strands into double-stranded DNA fragments with reconstituted cohesive ends, 5 'XhoI cohesive ends (C' TCGAGs) and 3 'kpnl (GGTAC' C) cohesive ends were formed.

The 813nt cDNA sequence encoding most of the RBD region and part downstream of the RBD was selected for SARS-CoV-2 δS protein. The cDNA sequence and its reverse complement were synthesized and annealed to fragments that were integrated with mCherry Red Fluorescent Protein (RFP) cDNA as a fusion gene in pCMV RFP expression plasmid as a potential target for shRNA688.

1.2 Construction of expression plasmid containing RBD fragment and RFP fusion gene of SARS-CoV-2S protein

pLVX IRES mCherry RFP vector (Takara Bio USA) comprising CMV promoter, multiple Cloning Site (MCS), mCherry-Red Fluorescent Protein (RFP) gene and 3' LTR, etc., was used as a basic vector for RBD-containing ESTs expressing SARS-CoV-2S protein gene.

In this vector MCS, there are cleavage sites for XhoI (2809) and SacII (2834). There are two SacII (CCGCGG) and two KpnI (GGTACC) cleavage sites in the vector. Their cleavage sites are SacII (2834), kpnI (3289), sacII (4644) and KpnI (4869).

We chose to use the pLVX IRES mCherry RFP plasmid as the primary vector. In the pLVX IRES mCherry RFP plasmid, pCMV drives mCherry RFP gene expression. We removed most of the IRES of this plasmid between XhoI (CTCGAG) and KpnI (GGTACC). The synthesized DNA fragment containing the sense strand (813 nt) encoding the majority of the S protein and its reverse complement were annealed to double strands. And successfully integrating this DNA fragment into the plasmid. Constructing pCMV-SARS-CoV-2-RBD-EST-RFP plasmid expressed by SARS-CoV-2S protein gene component and mCherry Red Fluorescent Protein (RFP) fusion gene. Transcripts of this fusion gene expression can be used as targets for testing the interference of shRNA (fig. 5).

As shown in FIG. 5, the construction of the plasmid pCMV-RBD-EST, which is a fusion gene of SARS-CoV-2S protein and RFP, was designated as (pCMV-SARS-CoV-2-RBD-EST-RFP). The synthesized and annealed double-stranded DNA fragment has an XhoI cohesive end (C 'TCGAG) at the 5' end and a KpnI (GGTAC 'C) cohesive end at the 3' end. The sense strand (813 nt) of the DNA fragment encodes most of the RBD of the SARS-CoV-2Delta S protein. The 3' LTR serves as a polyadenylation signal to terminate transcription.

For construction, the empty vector (Takara Bio USA) was double digested with the enzymes XhoI and SacII.

The method comprises the following specific steps:

the circular plasmid pLVX IRES mCherry RFP was first opened with XhoI (C' TCGAG). Obtaining digested vector DNA from a 0.8% agarose gel; the recovered DNA was further digested with SacII (CCGC' GG). The two fragments from the double digestion vector, fragment 1 (as shown in SEQ ID No. 20) and fragment 2 (as shown in SEQ ID No. 21), were separated on a 1% agarose gel (Shanghai source Biotech Co., ltd.). Fragment 1 (6337 bp) has a SacII (CCGC ' GG) sticky end at the 5' end and an XhoI (C ' TCGAG) sticky end at the '3' end; fragment 2 (1810 bp) had SacII (CCGC' GG) cohesive ends at both ends. Further digesting the fragment 2 with KpnI (GGTAC' C) to obtain fragment 2.1 (454 bp, SEQ ID No. 22) and fragment 2.2 (1356 bp, SEQ ID No. 23); wherein fragment 2.2 (1356 bp) has a KpnI (GGTAC 'C) sticky end at the 5' end and a SacII (CCGC 'GG) sticky end at the 3' end; fragment 2.2 (1356 bp) and fragment 2.1 (454 bp) were further separated on a 1.5% agarose gel. Obtaining fragment 2.2 (1356 bp) with KpnI sticky end (5 ') and SacII sticky end (3') from the gel; then, three fragments, two of fragment 1 (6337 bp) and fragment 2.2 (1356 bp) from the pLVX-IRES-mCherry vector, the other fragment was a double-stranded DNA fragment (825 bp) encoding most of the RBD and the post-RBD downstream region of SARS-CoV-2S protein (total 813bp,SEQ ID NO.1) and carrying the sticky ends of XhoI (C 'TCGAG) and KpnI (GGTAC', ligated and closed-loop using T4 DNA ligase (5 u/. Mu.L) (Thermo Fisher Scientific) to become an expression plasmid. The constructed plasmid was called pCMV-S protein RBD-EST-RFP (pCMV-SARS-CoV-2-RBD-EST-RFP). The insertion region of the plasmid was confirmed by Sanger sequencing (FIG. 1).

The 813nt insert integrated with the RFP gene was confirmed by Sanger sequencing as a fusion gene. The insert theoretically encodes a majority of the SARS-CoV-2Delta S protein RBD and a portion of the downstream region 813nt (SEQ ID No. 1) after RBD, but the 813nt insert begins at a position downstream of the S protein "M" encoding start "ATG". Thus, 813nt insertion of the RFP fusion gene only expressed mRNA and failed to produce any fusion protein (fig. 6).

FIG. 6 shows the RBD of SARS-CoV-2Delta S protein and the partial downstream region (813 nt) insert (gene sequence shown in bold underlined) following RBD linked to RFP gene. The insert is located between the 5 'restriction site, xhoI (CTCGAG, in the box before 813nt sequence) and the 3' restriction site kpnl (GGTACC, in the box after 813nt sequence). It is clear that in 813nt, which is taken in this study, there is no "ATG" for the formation of potential fusion proteins, and thus the RFP protein is translated from its own "ATG", and the RFP protein is wild-type (in large boxes).

2. Testing of interference effects of different shRNAs

2.1 test methods

Human cell line HEK293T cells (ATCC) were cultured in humidified incubator (all reagents from Siemens technologies) with addition of 10% Fetal Bovine Serum (FBS), 1% antibiotics (100. Mu.g/mL penicillin, 100. Mu.g/mL streptomycin), 2mM glutamine, and 1.5mg/mL sodium bicarbonate at 37℃in 5% CO 2. Subcultured HEK293T cells were used for transient transfection experiments. Dilution of cell suspension to 1X 10 ⁵ Individual cells/mL, seeded in 6-well plates. When cells grew to 70%, they were washed with Phosphate Buffered Saline (PBS).

HEK293T cells were co-transfected with liposome-to-DNA ratio (1:3) mediated liposome 2000 according to the transfection reagent manufacturer's recommendations as described in the experimental groups below.

2.2 test results

(1) Fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA and EGFP gene transfected cells

Transgene expression was detected and verified under a fluorescent microscope 24 hours after transfection. Red or green fluorescent cells (10 x magnification, lycra DMIL LED, germany) were observed with a fluorescent microscope system. Fluorescent cells (red or/and green fluorescence) in the cultured cells (under normal light) were observed. An image is photographed. The images were overlaid using software matching the microscope images and RFP and EGFP gene co-expression cells were analyzed to see double transfection efficiency.

Altogether 3 classes of transfected cells:

first, cells transfected with pCMV-S protein RBD-EST-RFP fusion gene plasmid (pCMV-SARS-CoV-2-RBD-EST-RFP) exhibit red fluorescence;

the second type, cells transfected with any one of pCMV-EGFP-pH1-shRNA250, pCMV-EGFP-pH1-shRNA463, pCMV-EGFP-pH1-shRNA544, pCMV-EGFP-pH1-shRNA688, pCMV-EGFP-pH1-shRNA blank Control (Control group) are green fluorescent;

third, transfected cells received both plasmids; such transfected cells expressed both red and green fluorescence, and co-transfected cells displayed yellow fluorescence upon superposition of the computer images (D in FIGS. 7-11).

Transfected cells were observed under a fluorescence microscope 1 day after transfection with red or green fluorescence filters (10X objective, racecard), respectively, as shown in fig. 7-11. In the test: fig. 7 (a), fig. 8 (a), fig. 9 (a), fig. 10 (a), fig. 11 (a) were grown after cotransfection (in sunlight). The cells of FIGS. 7 (B), 8 (B), 9 (B), 10 (B) and 11 (B) express RFP with green fluorescence. The EGFP gene expressed by the cells of FIGS. 7 (C), 8 (C), 9 (C), 10 (C) and 11 (C) has red fluorescence. Fig. 7 (D), 8 (D), 9 (D), 10 (D), 11 (D) when cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, and eventually displayed yellow after image fusion.

(2) Targeted degradation assay

Is used for detecting the expression level of the shRNA inhibiting SARS-CoV-2S protein RBD EST.

a. Nucleic acid extraction and strand-specific cDNA Synthesis

HEK293T cells co-transfected with pCMV-EGFP-pH1-shRNA plasmid and pCMV-S protein RBD-EST-RFP fusion gene (pCMV-SARS-CoV-2-RBD-EST-RFP) plasmid simultaneously exhibit green and red fluorescence.

qRT-PCR was performed and data were statistically analyzed. The experiment was repeated more than three times. For quantitative RT-PCR, total RNA of transfected cells was extracted from 24 hours after transfection with FastPure cell/tissue total RNA isolation kit V2 (Vazyme RC112, china). The cells in each well were lysed with buffer in the kit. Thereafter, the subsequent steps are performed according to the manufacturer's instructions. The mass and concentration of total RNA eluted in each sample was measured with a Nanodrop2000 spectrophotometer (Thermo Scientific, waltham, mass., USA); samples with a ratio A260/280 between 1.8 and 2.2 were considered for the next step. cDNA was prepared from 1. Mu.g total RNA at 45℃using HiScript III strand 1 cDNA synthesis kit (+gDNA wind) (Vazyme R312-01/02, china) and oligonucleotides (dT) as primers.

Quantitative targeting of SARS-CoV-2 transcript by RT-qPCR

The SARS-CoV-2S protein RBD-EST and housekeeping gene transcripts in cultured cells were quantitatively transfected with RT-qPCR. Total RNA and cDNA were prepared as described above. RT-qPCR was performed using the AceQ Universal U+ probe Master Mix V2 (Vazyme Q513, china). For each reaction, 10. Mu.L of "2X AceQ Universal U+Probe Master Mix V2", 0.4. Mu.L of sense primer (10. Mu.M), 0.4. Mu. L antisense primar (10. Mu.M), targeting S protein RBD specific probe (10. Mu.M) and ddH2O containing sample cDNA, in total volume of 20. Mu.L.

The primers and targeted S protein RBD specific probes we designed and used are listed in Table 2. The cycling conditions of RT-qPCR were incubation at 37℃for 2 minutes, initial denaturation at 95℃for 5 minutes, and then 45 amplification cycles using Light Cycler480 (Basel's, switzerland) at 95℃and 60℃for 10 seconds and 30 seconds, respectively. The amount of transcripts was normalized to the amount of GAPDH transcripts. Using Standard 2 ^-ΔCt The targeted degradation of shRNA to RBD EST expression was calculated by quantification.

TABLE 2 primers and probes for RT-qPCR for detection of shRNA-induced degradation of SARS-CoV-2S protein RBD-EST

(3) RT-qPCR detection of S protein Est efficiency of shRNA250, shRNA463, shRNA544 and shRNA688 degradation transfection HEK293T gene

HEK293T cells are respectively transfected by 4 plasmids of pCMV-EGFP-pH1-shRNA250, pCMV-EGFP-pH1-shRNA463, pCMV-EGFP-pH1-shRNA544, pCMV-EGFP-pH1-shRNA688 and pCMV-S protein RBD (pCMV-SARS-CoV-2-RBD-EST-RFP) containing EST-RFP fusion gene plasmids, and then have green and red fluorescence. Each transfected total RNA was isolated and cDNA was prepared. RT-qPCR was performed and data were statistically analyzed.

The results showed that the ESTs of the S protein were significantly lower in the cells treated with pH1-shRNA688 than in the other groups, while the remaining 3 shRNAs (shRNA 250, shRNA463, and shRNA 544) did not significantly degrade the S protein (Table 3).

TABLE 3 RT-qPCR detection of degradation efficiency of different shRNAs on New coronavirus S protein ESTs

The results obtained by repeating three experiments with the pH1-shRNA688 show that the transcription concentration of S protein mRNA Est (813 bp) in transfected cells after the shRNA688 treatment is obviously reduced compared with a control group. Although the concentration of S protein mRNA Est813 was different in each experiment, their degradation rates were at similar levels. Three experiments showed that S protein mRNA Est813 degraded by A0.465, B0.531 and C0.462. The mean and standard error was 0.486.+ -. 0.039 (Table 4, FIG. 12), and the selected shRNA688 was targeted to a conserved region downstream after the RBD coding region of the SARS-CoV-2delta variant S protein (FIG. 13).

TABLE 4 repeated RT-qPCR detection of the degradation efficiency of shRNA688 on New coronavirus S protein ESTs

As shown in fig. 12, the degradation rate (D.R) was at a similar level, although the starting amount of S protein mRNA Est813 was different in each experiment. The transcript concentration of the S protein mRNA Est (813 bp) in transfected cells after shRNA688 treatment (dark bars) was significantly reduced compared to the control (light bars). This region is the conserved region located after the novel coronavirus S protein RBD (FIG. 12).

As shown in FIG. 13, shRNA688 of S protein gene targeting SARS-CoV-2 delta.

The S protein gene of SARS-CoV-2delta and the position of its coded protein are indicated. The selected shRNA688 targets a conserved region downstream next to the RBD coding region of the SARS-CoV-2δ variant S protein.

The foregoing describes specific embodiments of the present invention. It is to be understood that the invention is not limited to the particular embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the claims without affecting the spirit of the invention.

Claims

1. A plasmid for testing the effect of RNAi interference, wherein the plasmid is a target sequence for constructing RNAi based on a basic plasmid pLVX IRES mCherry RFP vector;

2. The plasmid of claim 1, wherein the RNAi is a shRNA target gene.

3. The plasmid of claim 1, wherein the RNAi target sequence is as set forth in SEQ ID No. 1.

4. A method of constructing a plasmid according to any one of claims 1 to 3, comprising the steps of:

step 1, digesting the circular vector pLVX IRES mCherry RFP by using an enzyme XhoI to open the loop of the circular vector pLVX IRES mCherry RFP;

step 2, further digesting the ring-opened pLVX IRES mCherry RFP by Sac II to obtain a fragment 1 and a fragment 2; wherein fragment 1 has a SacII sticky end at the 5' end and an XhoI sticky end at the '3' end; both ends of the fragment 2 are provided with SacII sticky ends;

step 3, further digesting the fragment 2 by KpnI to obtain a fragment 21 and a fragment 22, wherein the fragment 21 is provided with a KpnI sticky end 5 'end and a SacII sticky end 3' end;

step 4, connecting most of the RBD of the encoded SARS-CoV-2S protein and part of downstream sequences after RBD as shown in SEQ ID NO.1, and double-stranded DNA fragments with XhoI and KpnI sticky ends, fragment 1 and fragment 2.2 with T4 DNA ligase to form a closed loop, and constructing and obtaining plasmid pCMV-SARS-CoV-2-RBD-EST-RFP;

5. Use of the plasmid according to any one of claims 1-3 or the plasmid constructed by the method according to claim 4 in shRNA screening targets.

6. The use according to claim 5, wherein the shRNA comprises the following sequence:

RBD-1F-250, the nucleotide sequence of which is shown as SEQ ID No. 2;

RBD-1F-463 has a nucleotide sequence shown in SEQ ID No. 4;

RBD-1F-544, the nucleotide sequence of which is shown as SEQ ID No. 6;

RBD-1F-688, the nucleotide sequence of which is shown as SEQ ID No. 8;

RBD-1R-688 has a nucleotide sequence shown in SEQ ID No. 9.

7. The use according to claim 5, wherein the shRNA comprises the following sequence:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAACACCTTTTTTG; as shown in SEQ ID NO. 8.

8. The use according to claim 5, wherein the shRNA comprises a sense sequence as set forth in SEQ ID No. 10.

9. The method for determining the shRNA interference effect is characterized by comprising the following steps:

co-transfecting the plasmid of any one of claims 1-3 or the plasmid constructed by the method of claim 4, with a recombinant plasmid comprising shRNA, HEK293T cells;

cells transfected with the plasmid of any one of claims 1-3 or constructed by the method of claim 4 exhibit red fluorescence;

cells transfected with the plasmid of any one of claims 1-3 or the plasmid constructed by the method of claim 4 and the recombinant plasmid containing shRNA simultaneously exhibit yellow fluorescence.

10. The method according to claim 9, wherein the construction method of the shRNA-containing recombinant plasmid comprises the steps of:

s2, constructing a human RNA polymerase III type promoter H1 promoter at the upstream of the pCMV-EGFP region through XhoI and HindIII enzyme cutting sites;

s3, shRNA was integrated downstream of the H1 promoter by HindIII and EcoRI construction sites.