CN116004820A - Ring-shaped RNA marker related to cervical cancer, detection kit and application of method in diagnosis of cervical cancer - Google Patents

Abstract

The invention discloses a circular RNA marker related to cervical cancer, which is characterized in that the circular RNA marker is circular RNA hsa_circ_0005571, and the nucleotide sequence of the circular RNA hsa_circ_0005571 is shown as SEQ ID NO: 1. The invention also discloses a detection kit and application of the method in cervical cancer diagnosis based on the circular RNA hsa_circ_ 0005571. The circular RNA hsa_circ_0005571 can be used as an effective marker for cervical cancer detection. The kit and the detection method have the characteristics of simple operation, high sensitivity, strong specificity, short period and the like, are beneficial to early diagnosis and treatment of cervical cancer, and provide assistance for subsequent research and development of novel drugs with potential treatment value for cervical cancer.

Description

Ring-shaped RNA marker related to cervical cancer, detection kit and application of method in diagnosis of cervical cancer

Technical Field

The invention belongs to the technical field of genetic engineering biology, and particularly relates to a cervical cancer-related annular RNA marker, a detection kit and application of a method in cervical cancer diagnosis.

Background

Cervical Cancer (CC) is a malignant tumor of the reproductive system that severely threatens female health, and its morbidity and mortality are fourth among female malignant tumors worldwide. It is estimated that 57 cases of cervical cancer are new and more than 31 cases of death worldwide in 2018. Cervical cancer is the second most common malignancy in women in developing countries; the cervical cancer cases in China and India account for about 1/3 of the total cases worldwide. Along with the change of modern female life habits, genital tract viral diseases are continuously increased, and sexually transmitted diseases are generally prevalent, so that cervical cancer onset ages tend to be younger.

Early detection is an effective method for preventing and treating cervical cancer, and through early detection and diagnosis, effective means can be adopted to intervene and treat the cervical cancer early, so that the survival rate of the cervical cancer is improved, and the prognosis of a patient is greatly improved. Currently the main detection means include cytology and HPV detection. Cytology involves traditional pap smear and liquid-based cytology. The traditional Papanicolaou smear method has lower detection cost, but the technology has limited accuracy and sensitivity, large doctor reading quantity and stronger subjectivity, and more missed diagnosis or misdiagnosis conditions are caused by the problems existing in the process of sampling materials and smear. Compared with the traditional smear method, the liquid-based cytology examination is more advanced, but still depends on subjective judgment of doctors on cell morphology, lacks objective standard, is easily influenced by subjective factors and is limited by material quality, so that diagnosis results are ambiguous [ research progress of screening value of HPV E6E7, cervical liquid-based cytology and colposcope biopsy in cervical cancer; journal 2022, 5, 23, 3 of gynaecology and obstetrics in China. HPV typing detection is based on the identification of HPV DNA from cervical secretions. Despite the high sensitivity, HPV detection cannot distinguish whether a positive result is associated with clinical lesions; higher HPV infection rates are accompanied by relatively lower cervical cancer incidence, with only persistent HPV infection being intimately associated with precancerous lesions. This may lead to an abnormally excessive diagnosis, causing unnecessary anxiety in women. And other important factors such as genetic differences among individuals in the cervical cancer occurrence and development process are also suggested. Therefore, it is important to explore the exact pathogenesis of cervical cancer and to find new diagnostic markers and potential therapeutic targets.

Circular RNA (circularRNAs, circRNAs) is a class of closed circular RNA molecules that are produced primarily from pre-mRNA by alternative splicing processes. The circRNA is more stable than linear mRNA (linear RNA) due to the lack of 5 'end caps and 3' end poly (A) tails in its structure, and the lack of free ends required for exonuclease degradation. The prior researches show that the circRNA can widely participate in the regulation of various pathophysiology such as tumor cell proliferation, differentiation, apoptosis, invasion and metastasis by acting as a micro RNA (miRNA) sponge or bait, interacting with RNA binding proteins, even translating functional peptides and the like. Meanwhile, the circRNAs have the characteristics of endogenous property, enrichment, conservation, stability and the like, can be specifically expressed in cancer tissues, and also exist in blood, plasma, extracellular vesicles, saliva and urine. The above properties of CircRNAs indicate the potential of CircRNAs as diagnostic biomarkers and application therapies.

Recent researches prove that the abnormal expression of the circRNAs also exists in cervical cancer, which suggests that the circRNAs possibly play an important role in the occurrence and development of cervical cancer, and are expected to be applied to clinic as novel tumor markers or molecular therapeutic targets. However, in general, the current research on the circRNAs in cervical cancer is still not comprehensive and deep enough, the molecular mechanism of the circRNAs in cervical cancer is still in the basic research stage, and a large research space exists in the aspects of whether the circRNAs can be used as a cervical cancer tumor diagnosis marker or not, and the like, and the research still needs to be further confirmed.

Disclosure of Invention

Aiming at the defects that the research on the circRNAs is not complete and deep enough and the cervical cancer diagnosis marker is lacking in the prior art, the invention provides a ring RNA marker related to cervical cancer, a detection kit and application of a method in cervical cancer diagnosis. The circular RNA hsa_circ_0005571 is verified to be used as an effective marker for cervical cancer detection.

The aim and the technical problems of the invention are realized by adopting the following technical proposal.

In one aspect, the invention provides a circular RNA marker related to cervical cancer, the circular RNA marker is circular RNA hsa_circ_0005571, and the nucleotide sequence of the circular RNA hsa_circ_0005571 is shown as SEQ ID NO: 1.

Further, the primer sequence with detection specificity to the circular RNA hsa_circ_0005571 is shown in SEQ ID NO:2 and SEQ ID NO: 3.

The invention also provides an application of the annular RNA marker in preparing a cervical cancer diagnosis kit.

In yet another aspect, the present invention provides a cervical cancer diagnostic kit for detecting the relative expression level of a marker circular RNA hsa_circ_0005571 in a sample to be detected, the kit comprising a primer pair comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 3.

Further, the sample to be tested comprises at least one of the group comprising: a circulating tumor cell in uterine tissue, lymph node, urine, semen, blood, serum, plasma, blood or in the gono-bank, a tissue comprising metastasis, and a source comprising cervical cancer cells or parts thereof, and free or protein-bound RNA molecules from cervical cancer cells.

Further, the kit also comprises qPCR amplification Mix and ddH ₂ O。

Further, the qPCR amplification Mix comprises a SYBGREEN dye.

Further, the kit also comprises an internal standard system, wherein the internal standard system is an internal standard primer designed according to the GAPDH sequence of the internal reference gene, the internal standard primer comprises an upstream primer and a downstream primer, the nucleic acid sequence of the upstream primer is shown as SEQ ID NO.4, and the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 5.

In still another aspect, the present invention provides a method for detecting cervical cancer marker circular RNA hsa_circ_0005571 using a cervical cancer diagnostic kit, the method comprising the steps of:

s1, extracting RNA: extracting total RNA by adopting a Trizol method;

s2, reverse transcription of RNA: preparing a reverse transcription system and performing reverse transcription to synthesize cDNA according to the instruction of TonkBioTM First Chain cDNA Synthesis Kit kit instructions;

the reverse transcription system comprises the following components in percentage by weight:

/>

the reaction conditions are as follows: reacting at 42 ℃ for 60min and at 70 ℃ for 5min;

s3, fluorescence quantitative PCR amplification: the kit provided by the invention is adopted, the cDNA obtained in the step S2 is used as a template for PCR amplification, and fluorescent signals are collected;

the fluorescent PCR amplification system comprises the following components in percentage by weight:

the reaction conditions of the fluorescent PCR are as follows: the mixture was pre-denatured at 95℃for 10min, then denatured at 95℃for 15s, annealed at 52℃for 30s, and extended at 72℃for 30s, and the total was subjected to 38 cycles.

Compared with the prior art, the invention has obvious advantages and beneficial effects: the invention discloses a kit for detecting circular RNA hsa_circ_0005571 related to cervical cancer and application thereof in preparing a reagent for detecting cervical cancer or a reagent for assisting in diagnosing cervical cancer for the first time, wherein the hsa_circ_0005571 quantitative detection kit comprises a pair of specific amplification primers for detecting hsa_circ_0005571 and a pair of specific primers for internal reference GAPDH, and expression of hsa_circ_0005571 in cervical cancer patient samples and normal samples is detected by SYBR Green fluorescent quantitative PCR, and relative expression quantity parameters of hsa_circ_0005571 are calculated for assisting in diagnosing cervical cancer. Compared with the traditional cervical cancer detection technology, the method has the characteristics of simplicity in operation, high sensitivity, strong specificity, short period and the like, and is favorable for early diagnosis and treatment of cervical cancer.

The foregoing description is only an overview of the present invention, and is presented in terms of preferred embodiments of the present invention and detailed description below in conjunction with the accompanying drawings, in order to provide a more clear understanding of the technical means of the present invention.

Drawings

FIG. 1 shows the structure and full-length sequence of the hsa_circ_0005571 gene of circular RNA;

FIG. 2 shows a graph of the results of melting curves of the primers hsa_circ_0005571 of circular RNAs;

FIG. 3 shows a diagram of the results of Sanger sequencing of the circular RNA hsa_circ_0005571PCR product;

FIG. 4 shows the detection of the expression level of circular RNA hsa_circ_0005571 in cervical and paracancerous tissues using real-time PCR;

FIG. 5 shows the detection of expression levels in plasma samples of circular RNA hsa_circ_0005571 cervical cancer patients and healthy control groups using real-time PCR;

fig. 6 shows ROC curves for plasma circular RNAs hsa_circ_ 0005571.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved more clear, the invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the detailed description is presented by way of example only and is not intended to limit the invention.

The circular RNA hsa_circ_0005571, which is located on human chromosome 19 (18285849-18286507), originates from exons 1-3 of its linear parent gene IFI 30. The full length of the nucleotide sequence is 351nt (SEQ ID NO: 1). Wherein the first two nucleotides and the last two nucleotides are loop-forming binding sites. There is currently little report on hsa_circ_0005571, and only one study suggests that hsa_circ_0005571 may be involved in regulating malignant biological processes such as proliferation, invasion, migration, and apoptosis of triple negative breast cancer cells [ PMID:35378000 ]. However, the expression pattern and function of hsa_circ_0005571 in cervical cancer tissues and cells are not researched, and the correlation with the occurrence and development of cervical cancer is not known.

In one aspect, the invention provides a cervical cancer-related annular RNA marker, a detection kit and application of a method in cervical cancer diagnosis, wherein the annular RNA hsa_circ_0005571 contains a nucleotide sequence shown as SEQ ID NO. 1.

SEQ ID NO:1：

ACAGGCAATCTATACCTGCGGGGGCCCCTGAAGAAGTCCAATGCACCGCTTGTCAATGTGACCCTCTACTATGAAGCACTGTGCGGTGGCTGCCGAGCCTTCCTGATCCGGGAGCTCTTCCCAACATGGCTGTTGGTCATGGAGATCCTCAATGTCACGCTGGTGCCCTACGGAAACGCACAGGAACAAAATGTCAGTGGCAGGTGGGAGTTCAAGTGCCAGCATGGAGAAGAGGAGTGCAAATTCAACAAGGTGGAGGCCTGCGTGTTGGATGAACTTGACATGGAGCTAGCCTTCCTGACCATTGTCTGCATGGAAGAGTTTGAGGACATGGAGAGAAGTCTGCCACTA。

In a second aspect, the invention provides a detection primer with detection specificity to circular RNA hsa_circ_0005571, the nucleotide sequence of the detection primer is shown as SEQ ID NO. 2-3, and the detection primer can be used for preparing a kit for diagnosing and treating cancers.

The nucleotide sequence of the forward Primer (Primer F) is GGAGAGAAGTCTGCCACTAAC (SEQ ID NO: 2);

the nucleotide sequence of the reverse Primer (Primer R) was GCTTCATAGTAGAGGGTCACATT (SEQ ID NO: 3).

In specific applications, the method further comprises a forward primer and a reverse primer of the internal reference GAPDH:

an internal reference GAPDH Primer F CAATGACCCCTTCATTGACC (SEQ ID NO: 4);

internal reference GAPDH Primer R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 5).

In a third aspect, the sample for detection is selected from the group consisting of: circulating tumor cells in uterine tissue, lymph nodes, urine, semen, blood, serum, plasma, blood or in the gono-bank, tissue comprising metastasis, and a source comprising cervical cancer cells or parts thereof, and free or protein-bound RNA molecules from cervical cancer cells; preferably, the sample is a biopsy material.

Example 1 extraction and characterization of circular RNA hsa_circ_0005571

1. Trizol method total RNA extraction

Step 1, weighing about 50mg of cervical cancer tissue or a tissue sample beside the cancer, adding 1mL of Trizol (Invitrogen, cat. No. 15596026), fully shearing the tissue, and then pulping the tissue by using a tissue refiner; for plasma RNA, 5mL of whole blood is collected and placed in an EDTA anticoagulation collection tube, after gentle mixing, 1500g is centrifuged for 5min, the supernatant is centrifuged for 10min again by 1500g, and then the supernatant is sucked to a new nuclease-free tube and stored at-80 ℃ for standby; the 250. Mu.L plasma samples were taken, 750. Mu.L Trizol was added and vortexed.

And 2, cracking the sample prepared in the step 1 at room temperature for 5min, adding chloroform according to the proportion of adding 0.2mL of chloroform into each 1mL of Trizol, covering a tube cover, standing for 5min after vortex shaking for 15s, centrifuging for 15min at 12000rpm at 4 ℃, and separating the mixed liquid into a lower chloroform phase, a middle protein layer, an upper colorless water phase and RNA all distributed in the water phase after centrifuging.

And 3, transferring the water phase into a new centrifuge tube, adding equal volume of isopropanol, uniformly mixing, standing for 30min at-20 ℃, and centrifuging at 12000rpm for 10min at 4 ℃ to obtain precipitate, wherein all RNA exists in the precipitate.

Step 4, remove supernatant, add 1mL 75% ethanol to the system to wash RNA precipitate, and centrifuge at 7500rpm for 5min at 4deg.C.

And 5, repeating the step 4.

And 6, removing the ethanol solution, drying at room temperature for 5-10min until ethanol volatilizes, adding ddH2O water without RNase into a centrifuge tube, and fully dissolving to obtain total RNA.

And 7, determining the concentration and purity of the RNA by using the Nanodrop ND-2000, and after determining that the quality of the RNA reaches the standard, sub-packaging and storing at the temperature of minus 80 ℃.

2. Synthesis of first Strand cDNA sequence

Preparing a reverse transcription system (instrument: bio-rad Berle S1000 gradient PCR instrument; kit: shanghai Co-technology Co., ltd., tonkBioTM First Chain cDNA Synthesis Kit, TB 30001B) from a PCR tube, wherein the reverse transcription system is: 1. Mu.L total RNA (about 500-1000 ng), 1. Mu.L random primer, 10. Mu.L ddH2O, 2. Mu.L dNTP mix (dATP, dGTP, dCTP and dTTP), 4. Mu.L reverse transcription buffer, 1. Mu.L RNase inhibitor, 1. Mu.L reverse transcriptase, total volume 20. Mu.L;

the reaction conditions are as follows: the reaction is carried out at 42 ℃ for 60min and at 70 ℃ for 5min. The cDNA obtained by reverse transcription is stored at-80 ℃ for standby.

3. Specific amplification primer design of circular RNA hsa_circ_0005571

Through circBase, CSCD and circbank databases, the corresponding linear deoxyribonucleotide sequence and structural information of the circular RNA hsa_circ_0005571 are obtained, and FIG. 1 is a gene structure diagram of the circular RNA, and the full length of the nucleotide sequence is 351nt (shown as SEQ ID NO: 1). Wherein the first two nucleotides and the last two nucleotides are loop-forming binding sites. Primer design principle: (1) following the common primer design principle; (2) primers were designed across the cleavage site (backsplice junction).

Step 1, sequence re-splicing, in order to meet the design requirement of crossing the cutting sites, according to the full-length nucleotide sequence of the embodiment 1hsa_circ_0005571, a 3 '-end 176-351nt length sequence is cut and placed in front of a 5' -end 1-175nt length sequence, so as to re-splice and form a new sequence, wherein the sequence comprises the cutting sites after loop splicing.

And 2, designing primers according to a conventional method aiming at the sequences obtained by re-splicing, and writing according to a 5 '. Fwdarw.3' direction by default according to a general sequence linear storage rule.

And 3, primer output and specificity debugging, namely introducing the Primer sequence obtained in the step 2 into an NCBI database (http:// Blast. NCBI. Nlm. Nih. Gov/Blast. Cgi), and performing Primer specificity comparison and optimization by using a Primer-Blast tool.

Step 4, the designed primers were synthesized by Souzhou Jin Weizhi Biotechnology Co.

The forward Primer (Primer F) nucleotide sequence is: GGAGAGAAGTCTGCCACTAAC (SEQ ID NO: 2);

the reverse Primer (Primer R) nucleotide sequence is: GCTTCATAGTAGAGGGTCACATT (SEQ ID NO: 3).

In one possible embodiment, the GC content of the upstream primer is 52.4% and the GC content of the downstream primer is 43.5%, wherein GC content refers to the ratio of guanine to cytosine in the 4 bases of DNA. Further, the upstream primer has a TM value of 62.0 degrees, the downstream primer has a TM value of 62.0 degrees, and the TM value refers to the melting temperature of the upstream primer or the downstream primer.

4. Specific amplification primer verification of circular RNA hsa_circ_0005571

Step 1, real-time PCR amplification reaction (instrument: ABI7500 real-time fluorescence quantitative PCR instrument; kit: shanghai Co-technology Co., ltd., golden qPCR SYBR Green Master Mix (2X), TK 03013).

(1) The reaction system is as follows: 2. Mu.L of the cDNA obtained by reverse transcription in step 3, 0.8. Mu.L of the upstream primer (SEQ ID NO: 2), 0.8. Mu.L of the downstream primer (SEQ ID NO: 3), 6.4. Mu.L of ddH2O, 10. Mu.L of qPCR amplification Mix (containing SYBGREEN dye), and a total volume of 20. Mu.L;

(2) Real-time PCR reaction conditions: the mixture was pre-denatured at 95℃for 10min, then denatured at 95℃for 15s, annealed at 52℃for 30s, and extended at 72℃for 30s, and the total was subjected to 38 cycles. The ABI7500 fluorescent quantitative PCR instrument selects a melting curve program, and continuously collects sample fluorescent signals during the ramp up process to obtain a melting curve.

(3) The amplification reaction was performed on a real-time fluorescent quantitative PCR instrument ABI7500 (Applied Biosystems, foster City, CA, USA), and GAPDH was amplified as an internal control while amplifying the gene of interest, with the primer sequences for GAPDH:

an internal reference GAPDH Primer F CAATGACCCCTTCATTGACC (SEQ ID NO: 4);

internal reference GAPDH Primer R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 5).

The GAPDH primer was synthesized by Suzhou Jin Weizhi Biotechnology Co., ltd and passed through 2 ^-△△Ct The relative expression level of the gene was calculated by the method.

Step 2, real-time PCR amplification reaction product Sanger sequencing, further by Sanger sequencing to verify primers on the basis of step 1.

FIG. 2 shows a graph of the melting curve of the circular RNA hsa_circ_0005571 primer, showing that the dissolution curve shows a single peak. The PCR products were subjected to Sanger sequencing, and the results are shown in FIG. 3, which shows that the sequencing result is single-peak and the cyclization site is correct. Thus, primer verification of the circular RNA was completed.

Example 2 relative expression amount of circular RNA hsa_circ_0005571 in cervical cancer samples was calculated

Step 1 total RNA was extracted as described in example 1, and residual genomic DNA in the extracted RNA was removed by DNase, and the RNA was reverse transcribed into cDNA.

And 2, detecting by adopting fluorescent quantitative PCR amplification, wherein the primer sequence of the fluorescent quantitative PCR is shown as SEQ ID NO. 2-5.

And 3, analyzing results. Relative quantification is carried out by taking a reference gene as a standard, the target hsa_circ_0005571 is normalized and passes through 2 ^-△△Ct The relative expression level of hsa_circ_0005571 is calculated by the method. Wherein 2 is ^-△△Ct The higher the value of (c) represents the higher the expression level of hsa_circ_ 0005571.

FIG. 4 shows the detection of the expression level of circular RNA hsa_circ_0005571 in cervical and paracancerous tissues using real-time PCR. As shown in FIG. 4, the fluorescence quantitative PCR detection results show that the expression of hsa_circ_0005571 in cervical cancer tissues is significantly higher than that of other tissues. FIG. 5 shows the detection of expression levels in plasma samples of circular RNA hsa_circ_0005571 cervical cancer patients and healthy control groups using real-time PCR. As shown in fig. 5, the expression of the circular RNA hsa_circ_0005571 in the plasma of cervical cancer patients was significantly higher than in healthy control plasma.

Subsequently, to identify whether hsa_circ_0005571 can be used as a biomarker for cervical cancer, the present invention further evaluates its subject working characteristics curve (ROC curve). It is well known to those skilled in the art that the area under the ROC curve is between 1.0 and 0.5, with AUC >0.5, the closer the AUC is to 1, indicating better diagnostic results. The accuracy of AUC is lower when 0.5-0.7, and the accuracy of AUC is higher when 0.7-0.9, and AUC is greater than 0.9 to indicate that the detection target is an ideal specific marker, and AUC is greater than 0.7 to indicate that the detection target can be used as the specific marker for the detection.

Fig. 6 shows ROC curves of plasma circular RNAs hsa_circ_0005571 for distinguishing cervical cancer patients from healthy subjects (auc=0.820). The results show an area under ROC curve (AUC) of 0.820 (P < 0.0001). The detection of the relative expression level of hsa_circ_0005571 is suggested to be of higher value for diagnosis of cervical cancer. Thus, the fluorescent quantitative PCR detection method can well detect the expression condition of the circular RNA hsa_circ_0005571 in organisms.

While the invention has been described with respect to preferred embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention, and that any such changes and modifications as described in the above embodiments are intended to be within the scope of the invention.

Claims (9)

1. A circular RNA marker associated with cervical cancer, wherein the circular RNA marker is circular RNA hsa_circ_0005571, and the nucleotide sequence of the circular RNA hsa_circ_0005571 is as shown in SEQ ID NO: 1.

2. The cervical cancer-associated circular RNA marker of claim 1, wherein the primer sequence specific for the circular RNA hsa_circ_0005571 is set forth in SEQ ID NO:2 and SEQ ID NO: 3.

3. The use of the circular RNA marker of claim 1, wherein the circular RNA marker is used in the preparation of a cervical cancer diagnostic kit.

4. The kit is used for detecting the relative expression quantity of a marker circular RNA hsa_circ_0005571 in a sample to be detected, and comprises a primer pair, wherein the primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown as SEQ ID NO:2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 3.

5. The cervical cancer diagnostic kit according to claim 4, wherein the sample to be tested comprises at least one of the group consisting of: a circulating tumor cell in uterine tissue, lymph node, urine, semen, blood, serum, plasma, blood or in the gono-bank, a tissue comprising metastasis, and a source comprising cervical cancer cells or parts thereof, and free or protein-bound RNA molecules from cervical cancer cells.

6. The cervical cancer diagnostic kit of claim 4, further comprising qPCR amplification Mix and ddH ₂ O。

7. The cervical cancer diagnostic kit of claim 6, wherein the qPCR amplification Mix comprises a SYBGREEN dye.

8. The cervical cancer diagnostic kit according to claim 4, wherein the kit further comprises an internal standard system, wherein the internal standard system is an internal standard primer designed according to the sequence of the reference gene GAPDH, the internal standard primer comprises an upstream primer and a downstream primer, the nucleic acid sequence of the upstream primer is shown as SEQ ID No.4, and the nucleic acid sequence of the downstream primer is shown as SEQ ID No. 5.

9. The method for detecting cervical cancer marker circular RNA hsa_circ_0005571 by using the cervical cancer diagnostic kit according to claim 4, wherein the method comprises the following steps:

s1, extracting RNA: extracting total RNA by adopting a Trizol method;

s2, reverse transcription of RNA: preparing a reverse transcription system and performing reverse transcription to synthesize cDNA according to the instruction of TonkBioTM First Chain cDNA Synthesis Kit kit instructions;

the reverse transcription system comprises the following components in percentage by weight:

the reaction conditions are as follows: reacting at 42 ℃ for 60min and at 70 ℃ for 5min;

s3, fluorescence quantitative PCR amplification: the kit provided by the invention is adopted, the cDNA obtained in the step S2 is used as a template for PCR amplification, and fluorescent signals are collected;

the fluorescent PCR amplification system comprises the following components in percentage by weight:

the reaction conditions of the fluorescent PCR are as follows: the mixture was pre-denatured at 95℃for 10min, then denatured at 95℃for 15s, annealed at 52℃for 30s, and extended at 72℃for 30s, and the total was subjected to 38 cycles.

Images