CN116004745A - Method for carrying out biotin labeling on 3' -end of DNA fragment - Google Patents

Abstract

The invention provides a method for biotin labeling of the 3' -end of a DNA fragment. According to the method, the target DNA fragment and the auxiliary DNA fragment are prepared, the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' -end, at least one A base is contained in the excess part, and the 3' -end of the target DNA fragment is subjected to biotin labeling by utilizing Klenow fragment or T4DNA polymerase, so that the labeling efficiency of the biotin labeling of the 3' -end of the DNA fragment is high and stable. Compared with TdT enzyme labeling, the method disclosed by the invention has the advantages of high labeling efficiency, more sensitivity, capability of performing accurate positioning, and suitability for 3' -terminal biotin labeling of experiments with high requirements on fragment positioning, such as EMSA (empirical mode decomposition). In addition, compared with the conventional marking method, the marking method provided by the invention has the advantages of fewer steps, simplicity and convenience in operation, low cost, practical application value and suitability for popularization and use.

Description

Method for carrying out biotin labeling on 3' -end of DNA fragment

Technical Field

The invention belongs to the technical field of molecular biology experiments. More specifically, it relates to a method for biotin-labeling the 3' -end of a DNA fragment.

Background

DNA and RNA labeling is widely applied to modern molecular biology experiments, and is a very important experimental technique. Labeled DNA, RNA, or oligonucleotide probes are often used in a variety of hybridization techniques to locate and bind complementary sequences of DNA and RNA, including cloning, southern and Northern analysis, in situ hybridization, and sequencing by hybridization, among others. The success of such applications depends on the successful introduction of the tag by various methods, such as end-labeling, random primer, nick translation, in vitro transcription, and various polymerase chain reaction methods. Meanwhile, with the development of biotechnology, a simple and efficient method for labeling the 3' -end of a DNA fragment with biotin is urgently required.

Typically, the 3' end of the DNA is labeled so as not to interfere with hybridization reactions, nor with EMSA detection based on sequence-specific protein binding. Thus, the biotin-labeled DNA probe can be used for conventional Northern, southern, EMSA (i.e., gel shift) as well as colony hybridization or in situ hybridization, etc. Currently, a common method for biotin-labeling the 3 '-end of a DNA fragment is to add biotin-labeled dUTP to the 3' -end of the DNA fragment by a terminal deoxynucleotidyl transferase (Terminal Deoxynucleotidyl Transferase, tdT). TdT can catalyze a reaction of adding dNTPs to the 3' -OH end of DNA without depending on the template. With respect to the efficiency of TdT for catalyzing the reaction of adding dNTPs to the ends of double-stranded DNA, the efficiency of TdT for catalyzing the reaction of adding dNTPs to the ends of single-stranded DNA is much higher than that of double-stranded DNA with the ends of the single-stranded DNA being retracted at the end of the single-stranded DNA. TdT can also catalyze reactions with dNTPs at the 3' end of RNA under appropriate conditions, but the sensitivity of TdT labeling is not entirely ideal in experiments.

For example, chinese patent CN 103255133a discloses a method of labeling a DNA fragment with biotin at the 3 'end by ultrasonic disruption to obtain a DNA fragment, and then labeling the DNA fragment with biotin at the 3' end by Klenow fragment or T4DNA polymerase. However, the labeling efficiency is unstable due to uncertainty in the terminal nucleotides of the DNA fragments. In addition, DNA fragments generated by restriction enzymes or ultrasonic disruption are always limited and cannot be precisely located, and thus, the method is not applicable to labels requiring relatively high fragment location requirements, such as electrophoresis mobility experiments (electrophoretic mobility shift assay, EMSA).

Disclosure of Invention

The invention aims to overcome the defects and the shortcomings of the prior art and provide a method for labeling the 3' -end of a DNA fragment by biotin.

The above object of the present invention is achieved by the following technical scheme:

according to the invention, the target DNA fragment and the auxiliary DNA fragment are prepared, and after the DNA fragment is subjected to high-temperature pyrolysis, the 3' -end of the target DNA fragment is subjected to biotin labeling by utilizing Klenow fragment or T4DNA polymerase. Wherein, the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end, and at least one A base is contained in the excess part, and the target DNA fragment and the auxiliary DNA fragment can be prepared by a primer amplification mode or an artificial synthesis mode.

The target DNA fragment and the auxiliary DNA fragment prepared by the primer amplification or artificial synthesis method are specific sequences, and can be accurately positioned when the labeled fragments are used for experiments after biotin labeling. The invention prepares the target DNA fragment and the auxiliary DNA fragment, so that the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end, and the excessive part at least contains one A base, so that the method has higher efficiency of carrying out biotin labeling on the 3' end of the DNA fragment, and is also suitable for the biotin labeling of the 3' end of experiments with higher requirements on fragment positioning, such as EMSA.

The invention provides a method for biotin labeling of the 3' -end of a DNA fragment, which comprises the following steps:

s1, preparing a target DNA fragment and an auxiliary DNA fragment, wherein the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end and contains an A base in the superfluous part;

s2, mixing the target DNA fragment and the auxiliary DNA fragment in the S1 in equal quantity, cracking at a high temperature of 95 ℃ for 5-10 minutes, cooling, adding Klenow fragment or T4DNA polymerase for cutting treatment, simultaneously adding dNTPs, wherein dUTP containing biotin marks is added, and carrying out biotin marks on the 3' -end of the target DNA fragment by filling in.

Specifically, the target DNA fragment and the auxiliary DNA fragment may be prepared by means of primer amplification or by means of artificial synthesis in step S1.

Preferably, the DNA fragments are prepared by means of primer amplification using high fidelity enzymes, see example 1.

Specifically, when the high-temperature cleavage is performed in step S2, it is necessary to add a buffer according to the enzyme to be used. NEB buffer2 is added to the cleaved DNA fragments at high temperature for protecting the DNA, for example, before cleavage with Klenow fragments. Before the cleavage treatment with T4DNA polymerase, buffer of T4DNA polymerase was added to the high temperature cleaved DNA fragment.

Specifically, when the Klenow fragment was added for cleavage treatment in step S2, 14U of the Klenow fragment was used per 1. Mu.g of the DNA fragment.

Specifically, in the case of adding T4DNA polymerase for cleavage treatment in step S2, 2.5U of T4DNA polymerase was used per 1. Mu.g of DNA fragment.

Specifically, in the case of performing the cutting treatment in step S2, the treatment condition is a water bath at 37 ℃.

Specifically, when Klenow fragment is added to perform the cleavage treatment in step S2, the treatment time is 1 to 4 hours.

Preferably, the treatment time is 3 hours, see example 1.

Specifically, in the step S2, when T4DNA polymerase is added for the cleavage treatment, the treatment time is 5-10 min.

Specifically, 1. Mu.L dNTPs are used per 1. Mu.g of DNA fragment in step S2, which contains biotin-labeled dUTP.

The dNTPs contain 0.35mM Biotin-11-dUTP,0.65mM dTTP,1mM dGTP,1mM dATP and 1mM dCTP.

Specifically, when the compensation is performed in the step S2, the incubation time is 10-20 min.

Specifically, the fill-up condition in step S2 is incubation at 25 ℃.

Specifically, after the equilibration, an aqueous EDTA solution was added to the reaction solution for treatment, and 0.5. Mu. Mol of EDTA was used for each 1. Mu.g of DNA fragment, and the mixture was incubated at 70℃for 10 minutes.

The reaction solution after the biotin labeling can be directly used, or can be purified by a DNA purification kit or a mixed solution of chloroform and isoamyl alcohol for purifying the target DNA fragment.

Chloroform and isoamyl alcohol are mixed according to the proportion of 24:1, added into the treated DNA solution according to the proportion of 1:1, oscillated for 2 minutes, centrifuged at high speed for 2 minutes, the supernatant is taken after layering, the biotin-marked DNA fragment is obtained by ethanol precipitation method, and stored in a refrigerator at-20 ℃ for standby use as the biotin-marked DNA of EMSA.

The invention has the following beneficial effects:

the invention provides a method for biotin labeling of the 3' -end of a DNA fragment. Compared with the existing method, the biotin labeling method provided by the invention overcomes the defect of unstable labeling efficiency caused by uncertainty of nucleotide at the tail end of the DNA fragment broken by ultrasonic waves in the existing labeling method. In addition, the DNA fragments generated by restriction endonuclease or ultrasonic disruption are always limited and cannot be positioned accurately, and the marking method can be used for positioning accurately and is suitable for experiments with high requirements on fragment positioning such as EMSA. Compared with the conventional labeling method, the labeling method has the advantages of high and stable labeling efficiency, more sensitivity, fewer steps, simple and convenient operation, low cost and practical application value, and is suitable for popularization and use.

Drawings

FIG. 1 is a schematic diagram of the working principle of the biotin labeling at the 3' -end of amplified DNA fragments.

FIG. 2 is an agarose gel electrophoresis of a target DNA fragment and an auxiliary DNA fragment.

FIG. 3 is a coomassie brilliant blue staining chart of the purified target protein.

FIG. 4 is a diagram of detection of biotin-labeled DNA by chemiluminescence in an EMSA assay.

FIG. 5 is a diagram of the biotin-labeled DNA of the TdT enzyme and Klenow fragment detected by chemiluminescence.

FIG. 6 shows the results of detection of the efficiency of biotin labeling in different labeling modes.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 PCR amplification of the Pseudomonas aeruginosa LasR Gene and 3' -Biotin labelling

According to the invention, the target DNA fragment and the auxiliary DNA fragment are prepared, and after the DNA fragment is subjected to high-temperature pyrolysis, the 3' -end of the target DNA fragment is subjected to biotin labeling by utilizing Klenow fragment or T4DNA polymerase. Wherein, the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end, and at least one A base is contained in the excess part, and the target DNA fragment and the auxiliary DNA fragment can be prepared by a primer amplification mode or an artificial synthesis mode. The working principle of the 3' -end biotin labeling is shown in figure 1, and the biotin is labeled when the target DNA is supplemented due to the existence of the auxiliary DNA fragment, and more biotin combined with the target DNA fragment can be obtained by adding an A base into the auxiliary DNA fragment, so that the target DNA can be regulated according to experimental requirements.

The invention takes Pseudomonas aeruginosa LasR protein as an example and takes an EMSA experiment of the Pseudomonas aeruginosa LasR protein as an example for explanation, and the experiment is repeated at least three times in order to ensure the repeatability of the experiment.

1. PCR amplification of target DNA fragments and helper DNA fragments

In the EMSA experiment, the size of the target DNA fragment to be labeled with biotin is 100 to 500bp. The invention aims at the Pseudomonas aeruginosa LasR protein and selects a proper target DNA fragment. On the basis, the amplification primers of the target DNA fragment and the auxiliary DNA fragment are respectively designed, the target DNA fragment and the auxiliary DNA fragment are obtained through PCR amplification, the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end, and the extra fragment contains A base.

The primers set in the invention are as follows:

primer 1 (Rsal-lasI-290-F): TGGCTTTCCCGTCGGGC

Primer 2 (Rsal-lasI-290-R): ACACTTGAGCACGCAACTTG

Primer 3 (Rsal-lasI-300-R): CGCTCCTTGAACACTTGAGC

Primer 4 (Rsal-lasI-300A-R): AAAAAAAAAAACACTTGAGCACGCAACTTG

Wherein, primer 1 and primer 2 are matched for amplifying target DNA fragments, primer 1 is matched with primer 3 and primer 4 for amplifying auxiliary DNA fragments, and when primer 1 and primer 4 are used, the 3' end of the amplified auxiliary DNA fragments is more than 10A bases.

The invention uses the genomic DNA of pseudomonas aeruginosa as a template, uses high-fidelity enzyme (common PCR enzyme can be used, but the high-fidelity enzyme is more accurate) to amplify, and uses gel electrophoresis to verify the PCR amplified product, and the result is shown in figure 2. Wherein, lane 1 is the Rsal promoter sequence, namely the target DNA fragment, lane 2 is the auxiliary DNA fragment 1 which is 10bp more than the Rsal promoter sequence, the 3 'end of the auxiliary DNA fragment only contains 1A base, lane 3 is the auxiliary DNA fragment 2, and the 3' end of the auxiliary DNA fragment is 10A bases more. As can be seen from FIG. 2, the target DNA fragment and the auxiliary DNA fragment were successfully amplified in the present invention, so that the DNA product was recovered by using the DNA recovery kit of OMEGA.

The sequence of the target DNA fragment (Rsal promoter sequence) is as follows:

TGGCTTTCCCGTCGGGCGGTGCGGGTGGCCTTTGCCCGGAAGGCCATGTTTTGGGGCTGTGTTCTCTCGTGTGAAGCCATTGCTCTGATCTTTTCGGACGTTTCTTCGAGCCTAGCAAGGGTCCGGGTTCACCGAAATCTATCTCATTTGCTAGTTATAAAATTATGAAATTTGCATAAATTCTTCAGCTTCCTATTTGGAGGAAGTGAAGATGATCGTACAAATTGGTCGGCGCGAAGAGTTCGATAAAAAACTGCTGGGCGAGATGCACAAGTTGCGTGCTCAAGTGT

the sequence 1 of the helper DNA fragment (10 bp more at the 3' -end of the Rsal promoter sequence) is as follows: TGGCTTTCCCGTCGGGCGGTGCGGGTGGCCTTTGCCCGGAAGGCCATGTTTTGGGGCTGTGTTCTCTCGTGTGAAGCCATTGCTCTGATCTTTTCGGACGTTTCTTCGAGCCTAGCAAGGGTCCGGGTTCACCGAAATCTATCTCATTTGCTAGTTATAAAATTATGAAATTTGCATAAATTCTTCAGCTTCCTATTTGGAGGAAGTGAAGATGATCGTACAAATTGGTCGGCGCGAAGAGTTCGATAAAAAACTGCTGGGCGAGATGCACAAGTTGCGTGCTCAAGTGTTCAAGGAGCG

The sequence 2 of the auxiliary DNA fragment (10 bp more 3' -end of the Rsal promoter sequence, all A bases) is as follows:

TGGCTTTCCCGTCGGGCGGTGCGGGTGGCCTTTGCCCGGAAGGCCATGTTTTGGGGCTGTGTTCTCTCGTGTGAAGCCATTGCTCTGATCTTTTCGGACGTTTCTTCGAGCCTAGCAAGGGTCCGGGTTCACCGAAATCTATCTCATTTGCTAGTTATAAAATTATGAAATTTGCATAAATTCTTCAGCTTCCTATTTGGAGGAAGTGAAGATGATCGTACAAATTGGTCGGCGCGAAGAGTTCGATAAAAAACTGCTGGGCGAGATGCACAAGTTGCGTGCTCAAGTGTAAAAAAAAAA

2. 3' -end biotin labeling of target DNA fragments

Mixing 1 mug target DNA fragment and 1 mug auxiliary DNA fragment, adding 10 XNEB buffer2, heating at 95 ℃ for 5-10 minutes, and then cooling on ice for 5 minutes; after cooling, 2. Mu.L of dNTPs (containing 0.35mM Biotin-11-dUTP,0.65mM dTTP,1mM dGTP,1mM dATP and 1mM dCTP) were added, 2. Mu.L of Klenow fragment (M0210S, NEB) was added, and the mixture was then supplemented with nuclease-free water to 100. Mu.L, reacted at 37℃for 3 hours for cleavage treatment, and then reacted at 25℃for 15 minutes for filling; after the equilibration, an aqueous EDTA solution was added to the reaction solution to perform the treatment, and 0.5. Mu. Mol of EDTA was used for each 1. Mu.g of DNA fragment, followed by incubation at 70℃for 10 minutes.

Specifically, 14U klenow fragment was used per 1. Mu.g of DNA fragment.

In addition to using the Klenow fragment, T4DNA polymerase may be used in the biotin labeling, 2.5U T4DNA polymerase per 1. Mu.g of DNA fragment, and T4DNA polymerase buffer may be added when heated at 95 ℃.

The reaction solution after the biotin labeling can be directly used, or can be purified by a DNA purification kit or by a mixed solution of chloroform and isoamyl alcohol.

Chloroform and isoamyl alcohol are mixed according to the proportion of 24:1, added into the treated DNA solution according to the proportion of 1:1, oscillated for 2 minutes, centrifuged at high speed for 2 minutes, the supernatant is taken after layering, the biotin-marked DNA fragment is obtained by ethanol precipitation method, and stored in a refrigerator at-20 ℃ for standby use as the biotin-marked DNA of EMSA.

EXAMPLE 2 expression and extraction of target proteins

The gene encoding target protein LasR and the LasR mutant gene with the mutation of the 217 th amino acid, which is the mutation of the gene encoding the mutant LasR protein with the reduced binding capacity with DNA, are respectively integrated on a plasmid (pGEX-6P-1-GST), the recombinant plasmid is transformed into BL21 escherichia coli after being constructed, whether the target gene is correctly integrated on the plasmid is detected by PCR, and the target gene successfully enters into an expression strain.

And (3) oscillating and culturing the BL21 escherichia coli successfully transformed, adding an inducer L-arabinose when the OD600 reaches 0.3-0.5, and inducing for 16 hours at a low temperature of 17 ℃.

After the induction culture, the cells were collected by centrifugation. Centrifuging for 30min with a large centrifuge bottle 1L at a rotational speed of 5000 rm/min; adding 10mL of lysis buffer (containing 1mg/mL of lysozyme and 1X of protein inhibitor), and blowing and mixing with a gun head to lyse the thalli; then crushing the mixture by using a French Pressure Cell high-pressure cell crusher (USA, ASI) at a temperature of 4 ℃ for three times continuously; centrifuging the crushed bacterial solution for 30min by using a high-speed centrifuge tube at 1300rpm/min, and filtering the supernatant by using a filter membrane with the diameter of 0.22 mu m; loading 1mL Glutathione Beads into a proper chromatographic column, balancing with 5 times of column volume of lysis buffer, adding the sample into balanced glutethione Bead for full contact, incubating on a tube rotator for 1-4 h at 4 ℃, improving the recovery rate of target protein, and collecting effluent.

And (3) cleaning by using a cleaning solution with the volume of 10-15 times of the column volume, removing nonspecifically adsorbed impurity proteins, and collecting the cleaning solution. And 5-10 column volumes of eluent are used, and the eluent is collected, namely the target protein component. Sequentially using 3 times of column volume of balance liquid and 5 times of column volume of deionized water to balance the filler, then preserving the filler in equal volume of 20% ethanol, and preserving the filler at 2-8 ℃ to prevent the filler from being polluted by bacteria.

Eluting proteins with different concentrations by SDS-PAGE, staining with Coomassie blue to determine whether the proteins are single or have other impurity proteins, purifying the concentrated proteins by using 30K protein ultrafiltration tube with corresponding size, and determining protein concentration by using protein kit.

SDS-PAGE results of the purified target protein are shown in FIG. 3, wherein lane A corresponds to LasR protein and lane B corresponds to mutant LasR protein. As can be seen from FIG. 3, the target protein was successfully obtained by the present invention, and the subsequent EMSA experiment was performed.

EXAMPLE 3 Biotin-labeled DNA and protein binding EMSA experiments

1. Configuration of EMSA gel

Preparing a glue pouring mold, preparing 5% polyacrylamide gel according to the following formula, sequentially adding the components in sequence, immediately mixing after adding TEMED, pouring into the glue pouring mold, and adding comb teeth to avoid generating bubbles.

5×TBE buffer	1mL
		39:1 acrylamide/bisacrylamide(40％，w/v)	1.7mL
60% glycerol	0.825mL
		10% ammonium persulfate	70μL
TEMED	5μL
		ddH 2 O	6.4mL
Co-production	10mL

2. EMSA binding reaction

EMSA binding reaction: an EMSA reaction system is prepared, the reaction is carried out for 30 minutes at room temperature, 5 mu L of 5 XLoading Buffer is added into a sample system, and the mixture is gently mixed for standby.

20 μl sample reaction system:

10×Binding buffer	2μL
			1. Mu.g/. Mu.l Poly (dI. DC) or 1. Mu.g/. Mu.l salmon sperm DNA	1μL
mexT protein
		0～20ug
Biotin End-Labeled Target DNA			30ng
	Ultrapure Water	Make up to 20 mu L
Co-production			20μL

3. Electrophoresis and transfer membrane

Pre-electrophoresis was performed for 30 minutes with 0.5 XTBE as electrophoresis buffer at 80V, 20. Mu.L of the sample was taken after the pre-electrophoresis was completed, and 100V electrophoresis was stopped until the bromophenol blue dye level was 2 cm below the gel. After electrophoresis, a nylon membrane and a filter paper were prepared, and the sizes thereof were adjusted so that the sizes of the protein strips were consistent. The albumin glue, filter paper, nylon membrane were wetted in 0.5 XTBE buffer. Sequentially stacking filter paper, glue, nylon membrane and filter paper in sequence from bottom to top, placing into an electrotransport groove, and carrying out wet-transfer for 1-2 h by using 0.4A current.

4. Detection of biotin-labeled DNA by crosslinking and chemiluminescence

The ultraviolet crosslinking instrument selects 254nm ultraviolet wavelength, 120J/cm < 2 >, and crosslinking is carried out for 45-60 s. After crosslinking, a proper container is taken to be added with 5 percent of 20mL of maleic acid skimmed milk powder solution sealing liquid, the crosslinked nylon membrane is immersed, the nylon membrane is oscillated for 0.5 to 1h on a horizontal shaking table, the nylon membrane is transferred to 15mL of sealing liquid (7.5 mu LStreptavidin-HRP Conjugate is added in advance), and the nylon membrane is oscillated for 30 minutes on the horizontal shaking table; adding TBST wash buffer for cleaning for 4 times, and preparing chromogenic working solution for use after each time for 6 minutes. Taking out the nylon membrane, sucking excessive liquid with water absorbing paper, placing the nylon membrane with the sample facing upwards on the preservative film, adding ECL luminescent liquid (Millipore luminescent substrate HRP) on the surface of the nylon membrane, enabling the working liquid to completely cover the nylon membrane, placing for 3-5 minutes at room temperature, and detecting an EMSA result under a chemiluminescence detection system.

As shown in FIG. 4, it is clear from the graph that different concentrations of proteins adsorb different amounts of labeled DNA, the more the amount of proteins is, the brighter the upper band is, and the result shows that the biotin labeling method is practical and can be well applied to EMSA experiments.

The invention also uses TdT enzyme marked target DNA fragment and Klenow marked target DNA fragment to carry out EMSA experiment, and adds the same amount of protein and different amounts of signals to carry out EMSA comparison experiment, wherein the specific treatment is shown in tables 1 and 2 respectively. Wherein GST-LasR corresponds to LasR protein, GST-LasR217 corresponds to mutant LasR protein, table 1 was labeled with TdT enzyme, table 2 was labeled with klenow fragment, and EMSA experiments were performed by spotting in the order of left to right in the table.

TABLE 1 labelling with TdT enzyme

TABLE 2 labelling with klenow fragment

The results are shown in FIG. 5, wherein Panel A shows the result of TdT enzyme labeling and Panel B shows the result of klenow fragment labeling. As described above, the binding ability of the mutant LasR protein to DNA is reduced, and if the labeling efficiency is not high, the corresponding band may not be observed in the experiment. As can be seen from FIG. 5, the TdT enzyme-labeled target DNA fragment did not bind well to the mutant LasR protein, while the Klenow fragment labeled DNA was clear in band, free of deletion, relatively higher in gray scale value and greatly improved in sensitivity. The labeling method has higher efficiency and more sensitivity.

Example 4 Nylon Membrane chemiluminescence experiments on differently labeled DNA

Because the operation of the EMSA experiment of protein combination is complex, the pore canal on one membrane is limited, the degree of the DNA marked in different modes cannot be well displayed, and in order to better display, the invention eliminates the influence of factors such as protein, gel running, membrane transferring and the like, simulates the DNA marking experiment of the EMSA, and furthest displays the effect of the DNA marked in different modes.

The present invention was carried out in the same manner as in example 1, using TdT enzyme, klenow fragment and T4DNA polymerase, and using auxiliary DNA fragment of 10A bases at the 3' -end to bind T4DNA polymerase, respectively, for labeling. The labeled DNA was recovered with OMEGA kit and EMSA experiments were performed by spotting an equivalent amount of 1.5 μl of labeled DNA directly onto nylon membranes, reducing the steps of protein binding, running and transferring. The ultraviolet crosslinking instrument selects 254nm ultraviolet wavelength, 120J/cm < 2 >, and crosslinking is carried out for 45-60 s. After the crosslinking is finished, a proper container is taken to be added with 5 percent of 20mL of maleic acid skimmed milk powder solution sealing liquid, the crosslinked nylon membrane is immersed, the nylon membrane is oscillated for 0.5 to 1 hour on a horizontal shaking table, the nylon membrane is transferred to 15mL of sealing liquid (7.5 mu L of strepitavidin-HRP Conjugate is added in advance), and the nylon membrane is oscillated for 30 minutes on the horizontal shaking table; adding TBST wash buffer for cleaning for 4 times, 6 minutes each time, and simultaneously preparing a color development working solution for use. Taking out the nylon membrane, sucking excessive liquid with water absorbing paper, placing the nylon membrane with the sample facing upwards on the preservative film, adding ECL luminescent liquid (Millipore luminescent substrate HRP) on the surface of the nylon membrane, enabling the working liquid to completely cover the nylon membrane, placing for 3-5 minutes at room temperature, and detecting an EMSA result under a chemiluminescence detection system.

As a result, as shown in FIG. 6, it was revealed from FIG. 6 that the clarity of the bands of the respective enzyme-labeled DNAs was 10A bases > T4DNA polymerase > Klenow fragment > TdT enzyme in this order. The gray value comparison result shows that when the biotin labeling method is used for labeling, the efficiency of T4DNA polymerase is highest, and the labeling efficiency can be further improved by adding more A bases at the 3' end of the auxiliary DNA fragment to combine the labeling method.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. A method for biotin-labeling the 3' -end of a DNA fragment, comprising the steps of:

s1, preparing a target DNA fragment and an auxiliary DNA fragment, wherein the auxiliary DNA fragment is 5-12 bp more than the target DNA fragment at the 3' end and contains an A base in the superfluous part;

s2, mixing the target DNA fragment and the auxiliary DNA fragment in the S1 in equal quantity, cracking at a high temperature of 95 ℃ for 5-10 minutes, cooling, adding Klenow fragment or T4DNA polymerase for cutting treatment, simultaneously adding dNTPs, wherein dUTP containing biotin marks is added, and carrying out biotin marks on the 3' -end of the target DNA fragment by filling in.

2. The method according to claim 1, wherein the target DNA fragment and the auxiliary DNA fragment are prepared by means of primer amplification or by means of artificial synthesis in step S1.

3. The method according to claim 1, wherein 14U of Klenow fragment is used per 1. Mu.g of DNA fragment when the Klenow fragment is added for cleavage in step S2.

4. The method according to claim 1, wherein 2.5U of T4DNA polymerase is used per 1. Mu.g of DNA fragment when the cleavage treatment is performed by adding T4DNA polymerase in step S2.

5. The method according to claim 1, wherein the cutting process is performed in step S2 at a process temperature of 37 ℃.

6. The method according to claim 5, wherein the Klenow fragment is added in step S2 for 1 to 4 hours.

7. The method according to claim 5, wherein the time for the cleavage treatment by adding T4DNA polymerase in step S2 is 5 to 10 minutes.

8. The method according to claim 1, wherein 1. Mu.L dNTPs are used per 1. Mu.g of DNA fragment in step S2.

9. The method according to claim 1, wherein the incubation temperature is 25℃and the incubation time is 10 to 20min when the replenishment is performed in step S2.

10. The method according to claim 9, wherein after the equilibration, an aqueous EDTA solution is added to the reaction solution for treatment, and 0.5. Mu. Mol of EDTA is used for 1. Mu.g of DNA fragment, and the reaction solution is incubated at 70℃for 10 minutes.

Images