CN116004551A - Construction and application of porcine reproductive and respiratory syndrome virus live vaccine for regulating CIITA molecule - Google Patents

Abstract

The invention relates to a site-directed mutagenesis porcine reproductive and respiratory syndrome virus, which is characterized in that the expression of a key gene CIITA for regulating and controlling an MHC-II molecular antigen presenting path can be recovered. The mutant porcine reproductive and respiratory syndrome virus mutates the key amino acid site 199 of Nsp4 regulatory CIITA to aspartic acid. Nsp4 can degrade CIITA through ubiquitin proteasome pathway while cutting CIITA,199 sites are key sites for inhibiting CIITA, and V199D mutant virus can reduce inhibition of CIITA after vaccine strain infects bone marrow-derived dendritic cells to a certain extent, so that MHC-II molecule mediated antigen presenting pathway is restored. Compared with the existing commercial vaccine, the vaccine strain can reduce the immunosuppressive property, ensure the immunogenicity and improve the safety.

Description

Construction and application of a porcine reproductive and respiratory syndrome virus live vaccine that regulates CIITA molecules

technical field

The invention belongs to the field of bioengineering, in particular, relates to a mutant plasmid of a virus and a genetic engineering vaccine, more specifically, relates to a vaccine capable of enhancing early adaptive immune response and having effective immunity to porcine reproductive and respiratory syndrome virus Mutant plasmids and genetically engineered vaccines for protection.

Background technique

Porcine Reproductive and Respiratory Syndrome (PRRS), commonly known as "PRRS", clinically causes respiratory disorders in piglets, reproductive disorders such as miscarriage and stillbirth in sows. Since the outbreak of PRRS in my country in 1996, my country's The pig industry has caused huge economic losses. Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the order Mandoviridae, the family Arteriviridae, and the genus Arterivirus. The nucleic acid of PRRSV is non-segmented, single-stranded, positive-strand RNA, about 15kb in size, containing 8 open reading frames (ORFs). ORF1a and ORF1b account for about two-thirds of the entire genome. After expressing two polyproteins pp1a and pp1ab, they undergo a series of processing and cut out 12 viral nonstructural proteins (Nsps). These nonstructural proteins are involved in viral replication and play an important role in gene expression. Among them, NSP4 has 3C-like serine protease activity (3CLSP), which plays an important role in virus replication and immune evasion.

At present, live attenuated vaccine (MLV) immunization is an effective means of preventing PRRS in line with my country's national conditions, but there are still some problems in the clinical prevention and control of PRRS live attenuated vaccine, especially the ineffective humoral (neutralizing Antibodies) and cellular immune responses are major problems restricting the use of PRRS vaccines and interfering with the formulation of prevention and control strategies. After a single immunization with live attenuated PRRS vaccine, it can rapidly induce high-level antibody responses in the body, mainly specific antibodies against N protein, GP5 protein and some non-structural proteins (Nsp1α, Nsp1β, Nsp2 and Nsp7). These antibodies do not have neutralizing activity. The production time of neutralizing antibody is late and the level is low. The low level of neutralizing antibody is not enough to protect pigs against PRRSV attack. At the same time, the cellular immunity caused by immunization is not active, and the immunosuppression produced by PRRSV will cause swine influenza virus (SIV), porcine respiratory coronavirus (PRCV), porcine circovirus (PCV2) and other pathogenic microorganisms secondary infection or co-infection, co-infected pigs showed more serious clinical symptoms and growth than single pathogen infection slow. Studies have found that although neutralizing antibodies are produced late and at low levels after a single vaccine immunization, repeated immunizations can produce high levels of neutralizing antibodies, and high levels of neutralizing antibodies can provide effective immune protection. Although the PRRS vaccine has been in use for nearly 20 years, and the acquired immune response after PRRS vaccine immunization has also been extensively studied, there is still no accurate answer to the immune protection mechanism of the PRRS vaccine, and the delay in research still restricts the development of vaccines and disease prevention. formulation of control strategies.

As the initiation of the acquired immune response, antigen presentation plays a key role in virus recognition, antigen modification processing and effector cell activation. Dendritic cells (DC) as the main antigen-presenting cells are a series of processes to be realized base carrier. Research on the anti-presentation function of DC cells after vaccine immunization is the key to revealing whether PRRS vaccine produces immunosuppression, and it is expected to reveal the reasons for the low level of humoral (neutralizing antibody) and cellular immune responses after vaccine immunization, and then provide a comprehensive explanation for the vaccine. Improvements in immune protection mechanisms and new vaccines provide theoretical support. The preliminary test results of our laboratory showed that the number of CD4+ T cells in peripheral blood was significantly lower than that of the control group 14 days after HuN4-F112 vaccine strain immunized pigs; after HuN4-F112 infected bone marrow-derived dendritic cells (BMDC), MHC -The transcription level of class II transactivator (CIITA) was significantly down-regulated, suggesting that PRRSV vaccine strains may interfere with MHC-II-mediated antigen presentation by regulating CIITA molecules, thereby inhibiting the body's immune response.

CIITA is the most important protein that regulates antigen presentation mediated by MHC-II molecules. CIITA participates in transcription through various mechanisms, such as recruiting transcription factors TFIID and TFIIB to the target gene promoter region to form a transcription initiation complex; inducing the phosphorylation of RNA polymerase II; interacting with P-TEFb; recruiting inducible histones Activator that alters chromatin by acetylation or methylation; recruits pigment remodeling factor BRG1. The regulation of CIITA differs between immature and mature DCs, being regulated by PU.1, IRF8, NF-κB, and SP1 in immature DCs and by PRDM1 in mature DCs. The transcription of CIITA is also regulated by upstream factors CDCA3, RMND5B, CNOT1, MAPK1 and PLEKHA4, and requires phosphorylation and ubiquitination to realize its function. Phosphorylation is an important modification to guide the nuclear localization of CIITA and increase trans-activity. Various residues on the translation initiation factor IF3 of CIITA have been identified as phosphorylation sites, and Ser280 is the center of the phosphorylation active site. Once phosphorylated, monoubiquitination ensues, resulting in increased CIITA transactivity and subsequent increased transcription of MHC class II molecules, the lysine residues Lys-315, Lys-330 and Lys-333 of CIITA, and Phosphorylation site Ser-280, which regulates CIITA ubiquitination, stability and MHC class II expression, this ubiquitination is K63-linked ubiquitination, which enables tandem phosphorylation to enhance the trans activity of CIITA, and for The movement of CIITA from the cytoplasm to the nucleus is very important. While polyubiquitination will lead to the degradation of CIITA by the ubiquitin-proteasome pathway, the lysine residues Lys-141 and Lys-145 of CIITA regulate the K48-linked ubiquitination modification of CIITA, resulting in the recognition and degradation of CIITA by the proteasome. A variety of microorganisms can evade the body's immune response by interfering with the CIITA gene. For example, HIV's transcriptional activator protein interferes with the function of CIITA by binding to cyclin T1, thereby preventing the MHC class II molecules from being released during HIV infection. expression; Helicobacter pylori can inhibit the expression of MHC-II by inhibiting the expression of CIITA, thereby inhibiting antigen presentation; Mycobacterium tuberculosis inhibits the function of CIITA by producing 19kDa lipoprotein, so as to achieve the purpose of evading the body's immune response; CIITA through Activating expression of the p41 isoform of the invariant chain CD74 prevents cathepsin-mediated processing of the Ebola glycoprotein to inhibit viral entry and also blocks the endosomal entry pathway of coronaviruses including SARS-CoV-2.

Since PRRS first appeared, scientists all over the world have carried out research on PRRS vaccines. Numerous data show that neither inactivated PRRS vaccines nor subunit vaccines can provide complete immune protection for pigs, and only live attenuated PRRS vaccines can be effective. Protect pigs against homologous PRRSV attack, and Nsp4 is a conserved non-structural protein, which is easy to kill the virus after mutation, and Nsp4 is not a neutralizing antigen, so there are few studies on Nsp4 in vaccines. This patent aims at the practical problems of low-level humoral (neutralizing antibody) and cellular immune response caused by PRRS vaccine immunization. It is found that 14 days after HuN4-F112 immunization, the number of CD4+ T cells in peripheral blood is significantly reduced, and then it is found that the regulation of MHC- The transcription level of CIITA, a key gene in the antigen presentation pathway of class II molecules, was significantly down-regulated, suggesting that PRRSV vaccine strains may interfere with antigen presentation by regulating CIITA molecules, thereby inhibiting the body's immune response. Further studies have shown that Nsp4 can degrade CIITA through the ubiquitin-proteasome pathway while cleaving CIITA. The 199 site is the key site for inhibiting CIITA. Inhibition of CIITA restores the MHC-II-mediated antigen presentation pathway. Compared with other known commercialized vaccines, the improved vaccine strain reduces the immunosuppressive properties of PRRSV in the early stage of immunization, ensures its immunogenicity and improves its safety, and contributes to the improvement of the immunization program in production. formulate.

Contents of the invention

The object of the present invention is to provide a method for constructing a viral mutant plasmid that can effectively improve the early humoral immunity level and cellular immunity level of porcine reproductive and respiratory syndrome vaccine immunization based on the mechanism research on PRRSV regulation of CIITA.

The invention establishes a mutant plasmid construction method for Nsp4 mutation on the whole PRRSV genome. According to the position of the single restriction site of the Nsp4 fragment in the HuN4-F112 genome and the position of the key amino acid site of Nsp4 regulating CIITA, the PCR amplification primers of the whole genome of HuN4-F112 and the key amino acid site-directed mutagenesis primers of Nsp4 were designed respectively. After obtaining the genomic mutant sequence of the whole genome of HuN4-F112 including Nsp4, T4 ligation was performed with the segmented sequence of the whole genome of the pBluescript SK(+) vector to construct the mutant plasmid pBlue-V199D of the transcriptional regulatory sequence of the whole genome of HuN4-F112 .

The method for constructing the mutant PRRSV plasmid of the key amino acid site that Nsp4 regulates CIITA of the present invention: first obtain the sequence fragment of the whole genome of HuN4-F112 including Nsp4 by amplifying the designed whole genome segmental amplification primers; then pass the fragment After ligation with the intermediate vector, site-directed mutagenesis was performed at the Val199 site in Nsp4 using site-directed mutagenesis primers; finally, the genomic fragment that had been successfully mutated in Nsp4 was ligated to another complete segment that did not contain Nsp4 and was double-digested with SpeI and PmeI. on the long genome. After identification and screening of the successful full-length ligated plasmid, transform Top10 competent cells, extract the plasmid and carry out full-length sequencing, and obtain a full-length infectious clone plasmid pBlue with Nsp4 key site mutation and no mutation in other positions. -V199D, thus establishing the corresponding method.

Using the Nsp4 mutant plasmid pBlue-V199D constructed by the present invention, after linearization, in vitro transcription, and transfection into MARC-145 cells, the packaged virus was continued to pass on Marc-145 cells, and successful rescue was detected after three generations of blind passage. The Nsp4 V199D mutant virus produced.

The porcine reproductive and respiratory syndrome virus Nsp4 V199D that regulates the CIITA molecule, the full-length sequence of Nsp4 V199D is shown in SEQ ID NO.1;

Further, the present invention provides an application of porcine reproductive and respiratory syndrome virus Nsp4V199D that regulates CIITA molecules. The application is the use of a kit for preparing treatment or prevention of porcine reproductive and respiratory syndrome virus, which is used for the preparation of medicaments, preferably a vaccine;

Further, the present invention provides an immunogenic composition or combined vaccine or combination, which includes porcine reproductive and respiratory syndrome virus Nsp4 V199D that regulates CIITA molecules, and optionally, a pharmaceutically acceptable carrier is added.

Description of drawings

Figure 1 shows the effects of different PRRSV nonstructural proteins on CIITA at the transcriptional and protein levels.

Figure 2 is the effect of point mutation Nsp4 with F112 as the backbone on CIITA at the transcriptional and protein levels. His39, Asp64, and Ser118 are the key enzyme active sites of NSP4 protease. The attenuated NSP4 after the enzyme active site mutation no longer has functions , 199 site is the key site for Nsp4 to inhibit CIITA, V199L and V199P have similar effects to V199D, while V199G and V199F seem to lose the ability to cleave CIITA while weakening the ability to inhibit CIITA.

Figure 3 is the result of analyzing the modification path of CIITA by Nsp4 by the inhibitor method, and Nsp4 can degrade CIITA through the proteasome pathway.

Figure 4 shows the detection results of the interaction and colocalization of NSP4 and CIITA. All mutant NSP4 interacted directly with CIITA, and CIITA colocalized with NSP4 and its mutant plasmids in the nucleus of 293T cells.

Fig. 5 is a diagram of the identification electrophoresis results of the full-length genome plasmid of the Nsp4 point mutation F112 infectious clone successfully constructed in the final screening.

Fig. 6 is the detection result of the copy number of the rescued virus obtained by reverse-transcribing the viral RNA in the cell supernatant extracted from the rescued virus to the third generation after the blind passage of the rescued virus into cDNA, and detecting the N protein by absolute fluorescent quantitative PCR.

Figure 7 is the result of indirect immunofluorescence performed on Marc-145 cells infected with rescue virus for 48 hours.

Figure 8 is a comparison of the titer changes between the rescued virus and the parental virus, and a multi-step growth curve drawn.

Figure 9 shows the detection results of the transcription level of bone marrow-derived dendritic cells infected by the V199D mutant virus. At the time point of 12h and 24h, the transcription level of CIITA in the V199D group can be significantly increased, and the upstream regulator SP1 of CIITA can be significantly increased at 24h.

Detailed ways

In the present invention, the Nsp4 point mutation PRRSV plasmid refers to the use of reverse genetic technology to mutate the key site of Nsp4 in the genome of the highly pathogenic PRRSV passage weakened strain HuN4-F112, the mutation point The mutant plasmid is pBlue-V199D, which can not seriously inhibit CIITA while maintaining the normal function of Nsp4.

In the present invention, the Nsp4 point-mutated virus refers to the live virus V199D rescued after transfecting Marc-145 cells with the full-length Nsp4 mutant plasmid pBlue-V199D obtained by genome site-directed mutagenesis technology.

In the present invention, the reverse genetic operation refers to, on the infectious clone backbone of the obtained highly pathogenic PRRSV attenuated vaccine strain HuN4-F112, the base of Nsp4 is carried out after the full-length genome is segmented. Site-directed mutagenesis, and then rebuild the mutant HuN4-F112 full-length infectious clone, so that the infectious clone can assemble biologically active virus particles, and study the changes in the biological characteristics of the mutant virus and the parent virus, and The impact of the Nsp4 mutated PRRSV attenuated strain on CIITA, and the impact on humoral (neutralizing antibody) and cellular immune responses after vaccine immunization.

In the present invention, the Genbank accession number of the highly pathogenic porcine reproductive and respiratory syndrome virus HuN4 is EF635006.

In the present invention, the infectious clone HuN4-F112 of the highly pathogenic porcine reproductive and respiratory syndrome virus attenuated vaccine strain refers to, references Shanru Zhang, Yanjun Zhou, Yifeng Jiang, Guoxin Li, Liping Yan, Hai Yu, Guangzhi The infectious clone constructed by the method of Tong.Generation of an infectious clone of HuN4-F112, anattenuated live vaccine strain of porcine reproductive and respiratory syndrome virus.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that the following examples are only used to illustrate the present invention but not to limit the scope of the present invention.

The experimental methods in the following examples that do not specify specific conditions are usually carried out according to conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989).

In an embodiment of the present invention, the cell line used is Marc-145 cells (African green monkey kidney cell line); the carrier used is pBluescript SK (+) carrier (purchased from Invitrogen); the competent state used is TOP10 competent State cells (purchased from TIANGENE Company); the enzymes used are SpeI-HF, PmeI-HF, T4 DNA Ligase (purchased from NEB Company), PrimeSTAR HS DNA Polymerase (purchased from TAKARA Company), Gold Mix (green) (purchased from Quanshijin Company); kits QIAquick PCR Purification Kit, QIAprep Spin Miniprep Kit, RNeasy Kits, QIAamp Viral RNA Mini Kit (purchased from QIAGENE Company), mMESSAGE mMACHINETM SP6 (purchased from Invitrogen Company); transfection reagent DMRIE-C purchased from From (purchased from Thermo Fisher Company); medium Opti-MEM, DMEM (purchased from Gibco Company).

In the embodiment of the present invention, the construction of the HuN4-F112 mutant plasmid with Nsp4 point mutation is based on the position of the single restriction site containing the Nsp4 fragment in the HuN4-F112 genome and the key amino acid site of Nsp4 regulating CIITA obtained in previous studies The PCR amplification primers of HuN4-F112 whole genome segment and the key amino acid site-directed mutagenesis primers on Nsp4 were designed respectively. After obtaining the genomic mutant sequence of the whole genome of HuN4-F112 including Nsp4, T4 ligation was performed with the segmented sequence of the whole genome of the pBluescript SK(+) vector to construct the mutant plasmid pBlue-V199D of the transcriptional regulatory sequence of the whole genome of HuN4-F112 . The specific process is as follows:

1.1 Primer design

According to the position of NSP4 on the HuN4-F112 full-length infectious clone and the position of the single restriction site in the genome, PCR amplification primers and site-directed mutagenesis primers were designed. The sequences are as follows:

pBlue-F: GGTCGACGGTATCGATAACTAGTGGAAACCTGAACTTTCAACAAAG (SEQ ID NO. 2)

pBlue-R: TCTAGAACTAGTGGATCGCTAGCAGTTTAAACACTGCTCCTTAGTC (SEQ ID NO. 3)

V199D-F: CCCTGCTTGCTGACAAACCCGAACTGGAA (SEQ ID NO.4)

V199D-R: AGTTCGGGTTTGTCAGCAAGCAAGCAGGGCACAAAGATCTGAAG (SEQ ID NO. 5)

The specific construction steps are as follows:

1.2 Amplification of PRRSV Genome Segmentation Products

Using pHuN4-F112 as a template, primers pBlue-F and pBlue-R were used as upstream primers and downstream primers respectively, and PCR was used to amplify the segmented sequence containing Nsp4 in the genome, as follows:

The PCR reaction system is: pHuN4-F112 plasmid (diluted 1:1000) as template 1 μL, upstream and downstream primers (10 μM) 1 μL each, 5×PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, PrimeSTAR HS DNA Polymerase (2.5U/μL) 0.5 μL , add water to 50 μL.

The PCR reaction parameters were: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 2 min, and a total of 40 cycles, followed by extension at 72°C for 5 min.

The PCR reaction product was taken, detected by 1% agarose gel electrophoresis, the product was gel recovered, and then connected to the vector pBluescript SK(+) by homologous recombination.

1.3 Site-directed mutation of Nsp4 key sites

On the fragmented PRRSV genome plasmid constructed in 1.2, use primers V199D-F and V199D-R to mutate the amino acid at position 199 of Nsp4 into aspartic acid by site-directed mutagenesis PCR. The specific operations are as follows:

The PCR reaction system is: PRRSV genome segmented plasmid as template 1 μL, upstream and downstream primer pairs (10 μM) 1 μL each, 5×PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, PrimeSTAR HS DNA Polymerase (2.5U/μL) 0.5 μL, add water to 50 μL (two for each sample system).

The PCR reaction parameters were: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 2 min, and a total of 40 cycles, followed by extension at 72°C for 5 min.

Take a total of 100 μL of PCR reaction products, add 200 μL of absolute ethanol to mix, let stand for 10 min, centrifuge at 4°C and 12000 rpm for 10 min, and discard the supernatant. Suspend with 20 μL of DpnI, the reaction system is 17 μL of ddH ₂ O, 2 μL of CutsmartBuffer, 1 μL of DpnI enzyme, react in a water bath at 37°C for 3 hours, and amplify the target plasmid in Top10 competent cells, and send it to Shanghai Qingke Biotechnology Co., Ltd. Co., Ltd. conducts sequencing verification, screens out the plasmids that have successfully mutated, and reserves them for future use.

1.4 Nsp4 point mutation infectious clone construction

The mutant plasmid sequenced correctly in 1.3 and the full-length infectious cloning plasmid pHuN4-F112 were digested with SpeI and PmeI to obtain a genomic fragment containing the Nsp4 mutation and another fragment not containing Nsp4 in its full length. After the gel was recovered, the fragment concentration was measured, and the two segments were connected by T4 connection according to 1:1. The reaction condition of T4 connection was to connect overnight at 16°C. Pick bacteria to screen positive colonies. During colony screening, gold medal Mix (green) was used to do bacterium liquid PCR, and after positive colonies were screened out, plasmids were extracted, electrophoresed through 1% agarose gel, and compared with positive pHuN4-F112 plasmids, the comparison bands were of the same size (as shown in Figure 1 Shown) after sequencing, screening to obtain Nsp4 point mutation PRRSV positive clone plasmid.

1.5 SwaI linearization of Nsp4 point mutation PRRSV positive clone plasmid

Use SwaI to linearize the Nsp4 point mutation plasmid pV199D and parental plasmid pHuN4-F112. The 500 μL reaction system is: 20 μL SwaI enzyme, 50 μL NEB Buffer 3.1, 20 μg-30 μg plasmid, and the rest supplemented with ddH2O to 500 μL. The reaction conditions were enzyme digestion at 25°C for 12 hours. Referring to the method in the manual, use the QIAquick PCR Purification Kit to purify the digested products to obtain purified linearized products respectively.

1.6 In vitro transcription

Referring to the method in the manual, use the mMESSAGE mMACHINETM SP6 kit to transcribe the purified linearized product in vitro. The in vitro transcription system is 20 μL: 2x NTP/CAP 10 μL, 10x Reaction Buffer 2 μL, EnzymeMix 2 μL, GTP 2 μL, and linearized template 4 μL. The reaction conditions were 37°C, 2 hours.

1.7 Transfection of RNA

The product after in vitro transcription needs to be transfected immediately. Inoculate MARC-145 cells and culture them in a six-well plate, and perform transfection when the cell density reaches 80-90%. The transfection steps are: add 1mL Opti-MEM to each EP tube, then add 5μL transfection reagent DMRIE-C, keep one tube as a negative control, add 20μL of corresponding in vitro transcribed RNA to the other tube, vortex, shake, Discard the medium in the six-well plate, wash it once with PBS, add all the liquid in the corresponding EP tube to each well, discard the liquid after incubating in the incubator for 8 hours, replace it with 2% FBS medium to continue culturing, and observe daily Cytopathy.

After cell lesions appeared, the cell supernatant was collected and passaged. The specific process was as follows: After the MARC-145 cells adhered to the wall in a six-well plate containing DMEM medium containing 10% FBS and grew into a monolayer, the medium was discarded, and washed twice with PBS. After five days of transfection, the supernatant was sucked out, inoculated with the maintenance solution (DMEM containing 2% FBS) in a ratio of 1:10 to inoculate 200 μL of the supernatant, placed at 37°C to continue culturing and using the above method to continue passage, And collect the virus supernatant of the third generation for preservation.

1.8 Fluorescent quantitative PCR and indirect immunofluorescence detection

The third-generation virus supernatant in 1.7 was used to infect Marc-145 cells with an infection dose of 20 μL/well, and at 24h, 48h, 72h, and 96h after infection, the viral RNA in the cell supernatant was extracted, reverse-transcribed into cDNA, and used Fluorescent quantitative PCR was used for detection. The PCR reaction system was: Premix Ex TaqTM (Probe qPCR) 10 μL, PRRSV-N-F and PRRSV-N-F 0.4 μL each, probe 0.6 μL, ddH2O 6.6 μL, cDNA 2 μL. The results of fluorescent quantitative PCR are shown in Figure 2. MARC-145 cells infected for 48 hours were detected by indirect immunofluorescence, fixed with ice methanol for 10 minutes, blocked with 1% BSA at room temperature for 30 minutes, incubated with monoclonal antibody specific to PRRSV nucleocapsid protein (1:800 dilution) at room temperature for 2 hours, and then added FITC The labeled goat anti-rabbit secondary antibody was incubated at room temperature for 1 hour, washed five times with PBS, and observed under a fluorescent microscope. The results are shown in Figure 3. According to the above results, the obtained mutant virus pV199D has infectivity, can successfully transform from a single genome sequence into an active virus particle, and has virus infectivity.

1.9 Drawing of virus multi-step growth curve

The third-generation virus supernatant in 1.7 and the parental strain F112 were tested for TCID ₅₀ /mL, and the Marc-145 cells were infected according to the infection dose of 1 MOI according to the measurement results. After infection, 12h, 24h, 36h, 48h, 60h 1. Collect the cell supernatant at the time point of 72h. The TCID ₅₀ /mL of the virus supernatant at different time points was measured, and finally the multi-step growth curve of the virus was drawn with the virus infection time as the abscissa and the logarithmic value of TCID ₅₀ /mL at different time points as the ordinate. The results are shown in the figure. There is no detailed difference in the growth curves between the V199D mutant virus and F112. The virus titer of the rescued strain basically reached the maximum value of 1.58×10 ⁸ TCID ₅₀ /mL 72 hours after inoculation, and the parental strain F112 reached 6.31×10 ⁷ _TCID50 /mL.

The above-mentioned embodiments are only to describe the technical solution of the present invention, not to limit the protection scope of the present invention. Variations and improvements should fall within the scope of protection defined by the claims of the present invention.

Claims (7)

1. A porcine reproductive and respiratory syndrome virus for regulating CIITA molecules is characterized in that the mutant porcine reproductive and respiratory syndrome virus mutates a key amino acid site 199 of Nsp4 for regulating CIITA into aspartic acid, a wild type HuN is GCTGCCAAA, a vaccine strain HuN-F112 is GCTGTCAAA, and a mutated virus of GCTGACAAA and V199D can reduce the inhibition effect of the vaccine strain on CIITA after infection of bone marrow-derived dendritic cells to a certain extent, so that an MHC-II molecule mediated antigen presentation pathway is restored.

2. A porcine reproductive and respiratory syndrome virus modulating CIITA molecules as claimed in claim 1 wherein the mutation point is in particular V199D of NSP 4.

3. A porcine reproductive and respiratory syndrome virus regulating CIITA molecule as claimed in claim 2 having the full length sequence shown in SEQ ID No. 1.

4. The method for preparing Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) regulating CIITA according to any one of claims 1-3, wherein the method comprises the steps of carrying out full-length sequencing of infectious clone HuN-F112 and identification of key sites for regulating CIITA by using nonstructural protein Nsp4, carrying out PCR amplification on a HuN-F112 genome containing a genomic sequence of Nsp4, designing primers according to the genomic sequence to obtain the fragment, connecting the fragment to an intermediate vector, carrying out site-directed mutagenesis on the key sites of Nsp4, and carrying out connection construction of full-length infectious clone with overall mutation of transcriptional regulatory sequences. Finally, the full-length infectious clone plasmid pBlue-V199D with Nsp4 mutation is obtained.

5. Use of a porcine reproductive and respiratory syndrome virus modulating CIITA molecules as claimed in any one of claims 1 to 3 for the preparation of a kit for the treatment or prophylaxis of porcine reproductive and respiratory syndrome virus for the preparation of a medicament, preferably a vaccine.

6. An immunogenic composition or combination vaccine or combination comprising porcine reproductive and respiratory syndrome virus Nsp 4V 199D modulating CIITA molecules, optionally with the addition of a pharmaceutically acceptable carrier.

7. The nucleotide sequence carrying a molecular marker for distinguishing wild type HuN4, vaccine strain HuN-F112 and mutant strain NSp 4V 199D of porcine reproductive and respiratory syndrome is characterized in that the nucleotide sequence is GCTGC/T/ACAAA, and corresponds to a key site for regulating CIITA by porcine reproductive and respiratory syndrome virus nonstructural protein NSp 4.

Images