CN116003554A - Glyma.14G216500 protein, and coding gene and application thereof - Google Patents

Abstract

The invention discloses Glyma.14G216500 protein, and a coding gene and application thereof. The Glyma.14G216500 protein is a protein of the following a) or b) or c) or d): a) The amino acid sequence is a protein shown in a sequence 1; b) A fusion protein obtained by ligating a tag to the N-terminus and/or C-terminus of the protein represented by the sequence 1; c) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1; d) A protein having 75% or more identity with the amino acid sequence shown in sequence 1 and having the same function. The invention discovers that the over expression of the Glyma.14G216500 can improve the resistance of plants to soybean cyst nematodes by introducing the Glyma.14G216500 gene into target plants.

Description

Glyma.14G216500 protein, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to Glyma.14G216500 protein, and a coding gene and application thereof.

Background

Soybeans are important commercial crops in agricultural production, are an important source of vegetable proteins and edible oils, and can be used as industrial raw materials and high-quality feeds for livestock. However, the current soybean industry situation in China is not optimistic, the demand of soybeans per year in China is reported to be 1.05 hundred million tons, but the native yield in China is only 1600 ten thousand tons. The domestic soybean production can not meet the demand far, and the dependence of the soybean on the outside is as high as 85%. Besides the reason of high production cost and low unit yield, the plant diseases and insect pests are important factors which severely restrict the soybean yield in China.

Soybean cyst nematode disease (Soybean Cyst Nematode, SCN) is one of the devastating diseases of soybean production, severely affecting global soybean yield, quality and economic benefits. It is estimated that economic losses due to soybean cyst nematode damage are over $16.2 billion worldwide, and that soybean cyst nematodes are found in China on more than 150 tens of thousands of hectares of land in northeast and Huang-Huai soybean main production areas each year. SCN is mainly used for infecting soybean roots to cause metabolic disorder and tissue injury of root systems, and root epidermis is often infected by saprophytes and other soil-borne diseases after being burst by females, so that erosion necrosis is caused, and absorption of moisture, nutrients and organic matters in soil by soybeans is necessarily influenced. Correspondingly, the overground part is expressed as dwarf plants, slow development, gradual yellowing of leaves from top to bottom, reduced flowering of plants, reduced pod formation and shrunken pod and seed in severe cases. The field is often yellowing and atrophy of the flaky plants, the root systems of the sick plants are undeveloped, lateral roots are reduced, the growth of main roots is inhibited, white to light yellow lemon-shaped small particles are attached to the surfaces of the root systems after sowing for one month, namely mature females of nematodes. The early stage of disease is limited to a small area, a yellow-green disease nest appears in a disease field, and when the disease is serious, a large Tian Bingzhu is dead in a strip shape, even the whole field is dead and fire-burned, and the disease is called as 'dragon seedling'. The plant disease-resistant variety is the most economical and effective measure for preventing and controlling the pests at present due to the characteristics of wide distribution, serious harm, multiple transmission paths and obvious physiological differentiation. Therefore, it is important to discover disease-resistant genes, and to explore the insect-resistant function of the genes and the molecular regulation mechanism on insect pest response by means of molecular biology and plant genetic transformation.

Disclosure of Invention

The invention aims to provide Glyma.14G216500 protein and a coding gene and application thereof.

In a first aspect, the invention provides a protein.

The protein protected by the invention is derived from soybean and is named as Glyma.14G216500 protein, and the Glyma.14G216500 protein is a protein shown in the following a) or b) or c) or d):

a) The amino acid sequence is a protein shown in a sequence 1;

b) A fusion protein obtained by ligating a tag to the N-terminus and/or C-terminus of the protein represented by the sequence 1;

c) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1;

d) A protein having 75% or more identity with the amino acid sequence shown in sequence 1 and having the same function.

The protein of the b), wherein the tag refers to a polypeptide or protein which is fused and expressed together with the target protein by using a DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

The protein according to c) above, wherein the substitution and/or deletion and/or addition of the one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues or a substitution and/or deletion and/or addition of not more than 9 amino acid residues or a substitution and/or deletion and/or addition of not more than 8 amino acid residues or a substitution and/or deletion and/or addition of not more than 7 amino acid residues or a substitution and/or deletion and/or addition of not more than 6 amino acid residues or a substitution and/or deletion and/or addition of not more than 5 amino acid residues or a substitution and/or deletion and/or addition of not more than 4 amino acid residues or a substitution and/or deletion and/or addition of not more than 3 amino acid residues or a substitution and/or deletion and/or addition of not more than 2 amino acid residues or a substitution and/or deletion and/or addition of not more than 1 amino acid residue.

The protein according to d) above, wherein the identity is the identity of an amino acid sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

The protein of the a), the b), the c) or the d) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

In a second aspect, the invention provides a biomaterial associated with the Glyma.14G216500 protein described above.

The biological material related to the Glyma.14G216500 protein protected by the present invention is any one of the following A1) to A8):

a1 Nucleic acid molecules encoding the above-mentioned Glyma.14G216500 proteins;

a2 An expression cassette comprising A1) said nucleic acid molecule;

a3 A) a recombinant vector comprising the nucleic acid molecule of A1);

a4 A recombinant vector comprising the expression cassette of A2);

a5 A) a recombinant microorganism comprising the nucleic acid molecule of A1);

a6 A) a recombinant microorganism comprising the expression cassette of A2);

a7 A) a recombinant microorganism comprising the recombinant vector of A3);

a8 A recombinant microorganism comprising the recombinant vector of A4).

Further, the nucleic acid molecule of A1) is a gene as shown in the following 1) or 2):

1) The coding sequence is a DNA molecule shown in a sequence 2;

2) A DNA molecule which has 75% or more identity with the nucleotide sequence defined in 1) and which encodes the above Glyma.14G216500 protein.

The nucleotide sequence encoding the Glyma.14G216500 protein of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the isolated Glyma.14G216500 nucleotide sequence of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention as long as they encode the Glyma.14G216500 protein and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 1 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

A2 The expression cassette (Glyma.14G216500 gene expression cassette) refers to DNA capable of expressing Glyma.14G216500 in host cells, which may include not only a promoter that initiates transcription of Glyma.14G216500 but also a terminator that terminates transcription of Glyma.14G216500. Further, the expression cassette may also include an enhancer sequence.

A3 Or A4) the vector may be a plasmid, cosmid, phage or viral vector.

A5 -A8) the microorganism may be a yeast, a bacterium, an alga or a fungus; the bacterium may be agrobacterium.

In a third aspect, the present invention provides a novel use of the Glyma.14G216500 protein or the biomaterial.

The invention protects the application of the Glyma.14G216500 protein or the biological material in regulating and controlling the resistance of plants to soybean cyst nematodes.

The invention also provides the application of the Glyma.14G216500 protein or the biological material in culturing transgenic plants with improved soybean cyst nematode resistance.

The invention also provides application of the Glyma.14G216500 protein or the biological material in cultivating soybean cyst nematode resistant plants.

In the above application, the regulation is improved.

In a fourth aspect, the invention features a method of growing a transgenic plant having increased resistance to soybean cyst nematodes.

The method for cultivating the transgenic plant with improved soybean cyst nematode resistance, which is protected by the invention, comprises the steps of improving the expression quantity and/or activity of the Glyma.14G216500 protein in a target plant to obtain a transgenic plant; the transgenic plant is more resistant to soybean cyst nematode than the plant of interest.

In the above method, the method for increasing the expression level and/or activity of the Glyma.14G216500 protein in the target plant is to overexpress the Glyma.14G216500 protein in the target plant.

Further, the over-expression method is to introduce the gene encoding the Glyma.14G216500 protein into a target plant. The coding gene of the Glyma.14G216500 protein can be a DNA molecule shown in a sequence 2 in a sequence table.

Furthermore, the gene encoding the Glyma.14G216500 protein was introduced into a target plant by a recombinant vector.

In a specific embodiment of the invention, the recombinant vector is a Glyma.14G216500 overexpression vector; the Glyma.14G216500 over-expression vector is obtained by replacing a DNA fragment between BamHI and SacI enzyme cutting sites of the PJL12 vector with a DNA molecule shown in a sequence 2 and keeping other sequences of the PJL12 vector unchanged.

In any of the above applications or methods, the transgenic plant comprises not only the first generation transgenic plant obtained by transforming the Glyma.14G216500 gene into the plant of interest, but also its progeny. For transgenic plants, the gene may be propagated in that species, and may be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, calli, whole plants and cells.

In any of the above applications or methods, the plant may be a monocot or dicot; the dicotyledonous plant may specifically be soybean, such as Tianlong one.

In any of the above applications or methods, the soybean cyst nematode is a soybean cyst nematode No. 3 physiological race.

The invention provides a Glyma.14G216500 protein related to soybean cyst nematode resistance and a coding gene thereof, and by over-expressing the Glyma.14G216500 gene in dicotyledonous plant soybean, the invention discovers that the over-expression of the Glyma.14G216500 gene can improve the soybean resistance to soybean cyst nematode, and the Glyma.14G216500 gene plays an important role in cultivating soybean cyst nematode resistant plant varieties.

Drawings

FIG. 1 is a diagram showing the result of electrophoresis of PCR amplification products.

FIG. 2 is a diagram showing the result of electrophoresis of the double enzyme cleavage products.

FIG. 3 is a diagram showing the result of electrophoresis of bacterial liquid PCR in the first step of example 2.

FIG. 4 is a diagram showing the result of electrophoresis of bacterial liquid PCR in the second step of example 2.

FIG. 5 is a graph showing the results of measuring the expression level of Glyma.14G216500 in transgenic hairy roots.

FIG. 6 is a graph showing the statistics of the number of cysts on transgenic hairy roots.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The PJL12 vector in the examples described below is described in the literature "Li X, huang L, lu J, cheng Y, young Q, wang L, song X, zhou X and Jiao Y X (2018) Large-Scale Investigation of Soybean Gene Functions by Overexpressing a Full-Length Soybean cDNA Library in Arabidopsis front plant Sci.9:631.doi:10.3389/fpls.2018.00631".

The soybean species Tianlong No. I in the examples below is described in the literature "Wang Ruizhen, yang Zhonglu, xin Zhen, zhao Xianwei, zhao Chaosen, xiong Wenhua, peng Yang. Introduction and popularization of high-quality spring soybean Tianlong No. I [ J ]. Soybean science and technology, 2015 (05): 6-10 ].

TY liquid medium formulation (1L) in the following examples: filling water to 1L volume of Tryptone 5g,Yeast extract 3g, and sterilizing at 121 ℃ for 20 minutes after complete dissolution to obtain TY liquid nutrient solution; preparing 1M calcium chloride aqueous solution, sterilizing at 121 ℃ for 20 minutes, and adding 10mL of sterile 1M calcium chloride aqueous solution into each 1L of sterilized TY liquid nutrient solution.

TY solid medium formulation (1L) in the following examples: after the gyritone 5g,Yeast extract 3g and the agar powder 15g are fully dissolved, the volume of the gyritone is 1L, and the gyritone 5g,Yeast extract 3g and the agar powder are sterilized at the high temperature for 20 minutes at the temperature of 121 ℃ to obtain TY liquid nutrient solution; preparing 1M calcium chloride aqueous solution, sterilizing at 121 ℃ for 20 minutes, and adding 10mL of sterile 1M calcium chloride aqueous solution into each 1L of sterilized TY liquid nutrient solution.

Example 1, glyma.14G216500 protein and production of Gene encoding same

1. Extracting total RNA of the root system of the soybean variety Williams 82, and reversely transcribing the total RNA into cDNA.

2. And (3) taking cDNA as a template, designing a primer in the UTR region, and carrying out PCR amplification to obtain a PCR product. The primer sequences were as follows:

Glyma.14G216500-F：CACTGCTCATACTCACACCCAAT；

Glyma.14G216500-R：GAAAACAAGGGCAAGAGTAAGC。

3. the amplified product is cloned to a carrier after purification, and is sent to a sequencing company for sequencing verification after colony PCR detection.

Sequencing results show that the PCR product contains a DNA molecule shown as a sequence 2 in a sequence table, wherein the DNA molecule is a CDS sequence of a Glyma.14G216500 gene, and the amino acid sequence of the coded Glyma.14G216500 protein is shown as a sequence 1 in the sequence table.

EXAMPLE 2 application of Glyma.14G216500 protein in regulating plant resistance to Soy cyst nematode construction of Glyma.14G216500 overexpression vector

1. Primers were designed by primerpremier5.0 and vector homology arms were added to both the upstream and downstream primers, respectively, based on the CDS sequence of glyma.14g216500, and amplified as follows:

OE Glyma.14G216500-F：TCTGATCAAGAGACAGGATCCATGAAGATCCAGTGCGAC；

OE Glyma.14G216500-R：CGATCGGGGAAATTCGAGCTCCTACCATAGAAATCTGGC。

2. extracting total RNA of the root system of the soybean variety Williams 82, reversely transcribing the total RNA into cDNA, and carrying out PCR amplification by using OE Glyma.14G216500-F and OE Glyma.14G216500-R primers to obtain a PCR amplification product (Glyma.14G216500 gene CDS sequence).

The result of electrophoresis of the PCR amplification products is shown in FIG. 1. The results show that: the size of the target gene strip is correct, the target gene strip is bright and single, the amplification efficiency is high, the specificity is good, and the target gene strip is cut and recovered.

3. The PJL12 vector was double digested with restriction enzymes BamHI and SacI to give a double digested product (6219 bp linearized vector). The results of electrophoresis of the double digested products are shown in FIG. 2.

4. The PCR amplified product (target gene) and the double cleavage product (linearized vector) were subjected to homologous recombination using a recombinase (Nanjinouzan Biotechnology Co., ltd., cat# C112), and the following homologous recombination reaction system was configured on ice: 5 XCE II Buffer 4. Mu.L, linearized vector 5. Mu.L, target gene 2. Mu. L, exnase ^TM II 2μL、ddH ₂ O7. Mu.L, and after gentle mixing, reacted at 37℃for half an hour to obtain a recombinant vector.

5. And (3) transforming the recombinant vector into escherichia coli, performing bacterial liquid PCR identification, screening positive clones, and performing sequencing verification on the clones positive to the PCR identification.

The electrophoresis results of bacterial liquid PCR are shown in FIG. 3, and the results show that: the size of the destination stripe is correct. And the sequencing result is completely consistent with the target sequence, which shows that Glyma.14G216500 is successfully connected to the PJL12 vector, and the recombinant vector with correct sequencing verification is named as Glyma.14G216500 over-expression vector.

The Glyma.14G216500 over-expression vector is obtained by replacing a DNA fragment between BamHI and SacI cleavage sites of the PJL12 vector with a DNA molecule shown in a sequence 2 and keeping other sequences of the PJL12 vector unchanged.

2. Transformation of Agrobacterium rhizogenes K599 with Glyma.14G216500 overexpression vector

1. K599 competent cells (Shanghai Biotechnology Co., ltd., product No. AC 1080) were removed from the freezer at-80℃and thawed on ice.

2. 2 mu L of Glyma.14G216500 over-expression vector is added into 70 mu L K599 competent cells, and the light bomb walls are respectively subjected to ice bath for 5min, liquid nitrogen for 5min,37 ℃ water bath for 5min and ice bath for 5min after being uniformly mixed.

3. After 800. Mu.L of liquid TY medium without antibiotics was added to the ultra clean bench, the culture was performed at 28℃and 200rpm for 2 hours with shaking.

4. Centrifuging at 6000rpm for 1min, collecting thallus, discarding supernatant, mixing the rest 100 μl with blowing, and coating on TY solid culture medium containing corresponding antibiotics, and culturing at 28deg.C for 36-48 hr.

5. And (3) selecting a monoclonal to carry out bacterial liquid PCR identification, wherein the bacterial liquid with correct PCR identification is named as an infectious bacterial liquid containing Glyma.14G216500 overexpression vector.

The result of the electrophoresis of bacterial liquid PCR is shown in FIG. 4. Positive clone plates were selected for soybean hairy root transformation experiments to further verify the effect of Glyma.14G216500 overexpression on soybean cyst nematode resistance.

And replacing the Glyma.14G216500 over-expression vector with a PJL12 vector to obtain an infectious bacterial liquid containing the PJL12 vector.

3. Agrobacterium rhizogenes K599 mediated genetic transformation of soybean

1. Seed disinfection: selecting soybean seeds (Tianlong No. 1) with uniform size and full seeds, spreading on an open culture dish, and placing in a vacuum dryer under a fume hood; putting a beaker filled with 200mL of sodium hypochlorite solution into a dryer, slowly adding 50mL of concentrated hydrochloric acid, and immediately covering a cover; and (3) keeping the seeds in chlorine for 3 hours, and then blowing air for half an hour on an ultra-clean workbench to obtain the sterilized seeds.

2. Preparation of soybean seedlings: placing the sterilized seeds into wet vermiculite with the depth of 1-2 cm, culturing in a greenhouse at 28 ℃, selecting healthy seedlings with consistent growth vigor when the seeds burst the surface of the vermiculite after germination for three days, transplanting the healthy seedlings into sterile vermiculite flowerpots with the diameter of 20cm for later use, and transplanting 10 seedlings into each pot.

3. Preparation of an infectious microbe liquid: simultaneously with the cultivation of the soybean seedlings, preparation of an infectious bacterial liquid containing the Glyma.14G216500 overexpression vector is started. Glycerol bacteria identified correctly and stored at 70℃were streaked on plates containing the corresponding antibiotics and incubated at 28℃for 2 days. After picking single colony and shaking and activating, fresh bacterial liquid is coated on a flat plate containing corresponding antibiotics, and the culture is carried out at 28 ℃ for overnight. Meanwhile, the infectious microbe liquid containing the PJL12 vector is used as a control.

4. Conversion of the soybean hairy root: after 5 days of seed germination, soybean seedlings have developed with unfolded green healthy cotyledons and a good growth condition is available for transformation. Collecting thalli from a flat plate by using a sterile gun head, dipping a part of thalli by using a 1mL sterile medical injector, and carrying the needle head with bacteria into the cotyledon node or hypocotyl crisscross bundling near the cotyledon node of the soybean for a plurality of times to bring more thalli to the infected part as much as possible; covering the infected part with wet sterilized vermiculite after the 10 seedlings in the flowerpot are completely infected to maintain a high-humidity environment; culturing in a culture room with illumination at 25-28deg.C for about 20 days under illumination for 14 hr/d, cutting off primary roots 1cm below the affected part, sampling, transplanting into a disposable plastic cup filled with sterile soil, keeping moisture, recovering for two days, gradually opening vent holes, and slowly reducing humidity.

4. Transgenic hairy root expression level detection

The relative expression amount of Glyma.14G216500 in transgenic hairy roots is detected by taking soybean endogenous gene ACTIN as a reference, and the detection primer sequence is as follows:

Glyma.14G216500q-F：GGGGCATATGGGTTCGTTTT；

Glyma.14G216500q-R：GGAGGGAGGACTAATCTGTGG；

ACTIN-F：GCCTTACATGGTTGATTTGATG；

ACTIN-R：GAGCAGAACCTGGGTGTGAAG。

the results show that: the relative expression level of the Glyma.14G216500 gene in the transgenic hairy root (OE-1-OE-15) obtained by the transgenic Glyma.14G216500 over-expression vector is obviously higher than that obtained by the transgenic empty vector, and partial detection results are shown in FIG. 5, wherein CK-1 and CK-2 are transgenic hairy roots obtained by the transgenic empty vector, and OE-1 and OE-2 are transgenic hairy roots obtained by the transgenic Glyma.14G216500 over-expression vector. Transgenic hairy root plants OE-1-OE-15 obtained by selecting a transgenic Glyma.14G216500 overexpression vector are used for subsequent identification of the insect resistance of soybean cyst nematodes.

5. Identification of soybean cyst nematode resistance

1. And (3) nematode subculture: firstly, germinating a soybean disease-causing variety Tianlong No. 1 by adopting a paper roll method, namely, laying soybean seeds on a filter paper strip with the width of 12cm downwards, wetting tap water, rolling up a small white box which is used for filling water, and culturing in an illumination culture room at the temperature of 28 ℃ for about four days to germinate; then transplanting the germinated seeds into a disposable plastic cup filled with soybean cyst nematode disease soil (the disease soil contains soybean cyst nematode No. 3 physiological micro-seeds), and culturing in a 28 ℃ illumination culture chamber for one month, so that light yellow cysts can be observed at the roots.

2. Insect egg acquisition: cutting off overground parts of the plants for nematode subculture, flushing cysts of plant root systems by a high-pressure gun, leaching cysts in soil around the cysts into water, fully stirring and uniformly mixing, sequentially sieving with 10-mesh, 20-mesh and 60-mesh sieve, and further collecting and filtering crude cyst extract into a beaker; purifying and collecting cyst by sucrose centrifugation, subpackaging the cyst crude extract into 50mL centrifuge tube, centrifuging at 2000rpm for 4min, carefully pouring out supernatant, and adding 615 g.L ^-1 Is stirred and mixed uniformly, and is centrifuged at 1000rpm for 2 minutes, and the cyst density is larger than that of water and smaller than that of sucrose, so that the cyst in the supernatant sucrose solution is filtered and collected by a 60-mesh screen; placing a 500 mesh screen below a 60 mesh screen, grinding cysts back and forth on the 60 mesh screen by using rubber until the cysts particles are not seen, lightly leaching the mixture of eggs and J2 larvae on the 500 mesh screen by using a proper amount of sterilized water according to the requirement and the quantity of the cysts, and collecting the mixture into a 200mL beaker; the beaker with egg suspension described above was placed on a magnetic stirrer and several aliquots of 10 μl of egg suspension were aspirated to microscopic counts, and finally diluted to 2000 eggs per ml and J2 larvae.

3. Inoculation of eggs: 15 transgenic chimeric plants with dense hairy roots (transgenic hairy root plants OE-1-OE-15 obtained by transferring Glyma.14G216500 over-expression vectors) are selected and transplanted into sterile soil, the tray is covered with a cover to keep moisture and recover for two days, then the normal growth state is reached, and then fresh eggs of soybean cyst nematodes are inoculated according to the following method: pricking two holes with the depth of about 5cm near the root by using a gun head, and respectively injecting 500 mu L of egg suspension, namely, inoculating 2000 eggs and J2 larvae in each plant, and covering with sterile soil; the inoculated plants are continuously cultivated in an illumination cultivation room at the temperature of between 25 and 28 ℃ for 14h/d illumination and watered at intervals. And simultaneously taking a transgenic chimeric plant obtained by the transgenic empty vector (a transgenic hairy root plant obtained by the transgenic empty vector) as a control.

4. Data statistical analysis: the number of cysts in the soil surrounding the roots of soybean were counted in the cyst development stage 30 days after inoculation. The experiment was repeated for 15 techniques, the mean was taken for analysis and the difference significance analysis was performed using student t-test.

As a result, as shown in FIG. 6, the number of cysts on the transgenic hairy roots overexpressed by Glyma.14G216500 was 109.78, the number of cysts on the control hairy roots was 149.50, and the number of cysts on the transgenic hairy roots after the overexpression of Glyma.14G216500 was reduced by 26.57% compared with the control, reaching a significant level (P < 0.05), indicating that Glyma.14G216500 plays an important role in improving the resistance of soybean to soybean cyst nematodes.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. A protein represented by the following a) or b) or c) or d):

a) The amino acid sequence is a protein shown in a sequence 1;

b) A fusion protein obtained by ligating a tag to the N-terminus and/or C-terminus of the protein represented by the sequence 1;

c) The protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1;

d) A protein having 75% or more identity with the amino acid sequence shown in sequence 1 and having the same function.

2. A biological material related to the protein of claim 1, which is any one of the following A1) to A8):

a1 A nucleic acid molecule encoding the protein of claim 1;

a2 An expression cassette comprising A1) said nucleic acid molecule;

a3 A) a recombinant vector comprising the nucleic acid molecule of A1);

a4 A recombinant vector comprising the expression cassette of A2);

a5 A) a recombinant microorganism comprising the nucleic acid molecule of A1);

a6 A) a recombinant microorganism comprising the expression cassette of A2);

a7 A) a recombinant microorganism comprising the recombinant vector of A3);

a8 A recombinant microorganism comprising the recombinant vector of A4).

3. The biomaterial according to claim 2, characterized in that: a1 The nucleic acid molecule is a gene as shown in the following 1) or 2):

1) The coding sequence is a DNA molecule shown in a sequence 2;

2) A DNA molecule having 75% or more identity to the nucleotide sequence defined in 1) and encoding the protein of claim 1.

4. Use of a protein according to claim 1 or a biomaterial according to claim 2 or 3 for modulating resistance of a plant to soybean cyst nematodes.

5. Use of a protein according to claim 1 or a biomaterial according to claim 2 or 3 for the cultivation of transgenic plants with increased resistance to soybean cyst nematodes.

6. Use of the protein of claim 1 or the biomaterial of claim 2 or 3 for the cultivation of soybean cyst nematode resistant plants.

7. A method of growing a transgenic plant having increased resistance to soybean cyst nematode comprising the step of increasing the expression and/or activity of a protein of claim 1 in a plant of interest to obtain a transgenic plant; the transgenic plant is more resistant to soybean cyst nematode than the plant of interest.

8. The method according to claim 7, wherein: the method for increasing the expression level and/or activity of the protein of claim 1 in a plant of interest is to overexpress the protein of claim 1 in the plant of interest.

9. The method according to claim 8, wherein: the method of overexpression is to introduce the gene coding for the protein of claim 1 into a plant of interest.

10. The use according to any one of claims 4-6 or the method according to any one of claims 7-9, characterized in that: the plant is monocotyledonous plant or dicotyledonous plant; or, the dicot is soybean.

Images