CN115992211A - Serum exosome tsRNA marker and probe for lupus nephritis diagnosis and application thereof - Google Patents

Abstract

The invention provides a serum exosome tsRNA (tRNA-modified small RNA, tsRNA) marker for lupus nephritis diagnosis, a probe and application thereof, belonging to the field of molecular biology; the marker is one or a combination of tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2; the selected exosome tsRNA is remarkably high-expressed in serum exosomes of lupus nephritis patients, has good correlation with clinical indexes of lupus nephritis, and can be used for identifying whether SLE patients have kidney part involvement; the marker can be used for preparing a diagnosis kit and is used for assisting early diagnosis of lupus nephritis in clinic.

Description

Serum exosome tsRNA marker and probe for lupus nephritis diagnosis and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a serum exosome tsRNA marker for lupus nephritis diagnosis, a probe and application thereof.

Background

Lupus Nephritis (LN) is one of the most serious visceral manifestations of Systemic Lupus Erythematosus (SLE), and also one of glomerulonephritis. LNs can be divided into six different tissue types, depending on the different manifestations and severity of SLE kidney involvement. About 65% of SLE patients develop nephritis at a certain stage of the disease, while lupus nephritis occurs for more than 10 years, 25% will develop into end-stage renal disease, which is the key and difficult point of clinical diagnosis and treatment of SLE. Clearly, early diagnosis of LN and timely initiation of treatment are critical in preventing disease progression. The most common methods for clinical diagnosis of LN are 24 hours urine protein quantification and kidney biopsy. However, these methods suffer from the disadvantages of inaccurate time, loss of a portion of the urine sample during sample retention, poor patient compliance with urine protein detection, invasive renal biopsy procedures, and the like. Thus, there is an urgent need to find new biomarkers to distinguish LN from SLE.

tsRNA is derived from tRNA maturation bodies or precursors, and is a novel small non-coding RNA found in recent years and is about 18-40nt long. Depending on the manner of production, tRNA halves (tRNA half s) and tRNA derived fragments (tRNA-derived RNA fragments, tFs) are largely divided into two types. tRNA is the most abundant, extensively modified RNA in vivo, especially the nuclear encoded tRNA, with an average of 13 modifications per molecule of tRNA. Because of the abundant RNA modification, tsRNA has tissue and cell specificity, and participates in various biological functions of organisms through regulating mechanisms such as protein translation, transposon and the like, including stress reaction of cells and tissues, protein translation regulation, epigenetic regulation and the like, and becomes a research hot spot. the abundance of tsRNA in body fluid and exosomes may be superior to that of miRNA, and the tsRNA itself has abundant modified and stable structures, tissue specificity and time sequence specificity, and completely has the characteristics of ideal markers for clinical examination.

However, research on exosome tsRNA in the field of autoimmune diseases, in particular lupus nephritis, has not been reported yet. The serum exosome tsRNA has great development potential and wide application prospect in the aspect of lupus nephritis liquid biopsy diagnosis markers.

Disclosure of Invention

The invention aims to solve the problem of differential diagnosis of patients with systemic lupus erythematosus and lupus nephritis in clinic, and provides a serum exosome tsRNA marker related to lupus nephritis and application of the tsRNA marker in preparation of a lupus nephritis diagnosis kit.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

the invention provides a serum exosome tsRNA marker related to lupus nephritis, which is any one or combination of the following sequences:

tRF-Thr-TGT-4-M3：SEQ ID NO.1；

tRF-Tyr-GTA-1-M2：SEQ ID NO.2。

the invention provides a probe which can specifically capture the serum exosome tsRNA marker related to lupus nephritis. The probe is a TaqMan tsRNA probe customized and synthesized by GenScript company, the sequences of the probe are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, the SEQ ID NO.3 and the SEQ ID NO.5 can specifically capture tRF-Thr-TGT-4-M3 (SEQ ID NO. 1), and the SEQ ID NO.4 and the SEQ ID NO.6 can specifically capture tRF-Tyr-GTA-1-M2 (SEQ ID NO. 2).

The invention provides application of the serum exosome tsRNA marker and the probe in preparation of a lupus nephritis diagnosis kit.

The invention also provides a lupus nephritis diagnosis kit which is used for detecting the expression level of one or more tsRNA markers in serum exosomes.

According to a further technical scheme, the kit comprises the probe.

According to a further technical scheme, the kit also comprises reagents and enzymes which are commonly used in PCR reactions.

Further technical proposal, the reagents and enzymes commonly used in PCR reaction in the kit comprise dNTP/AMV reverse transcriptase, buffer solution and MgCl ₂ DEPC water and Taq DNA polymerase, etc.

Compared with the prior art, the invention has the following advantages and beneficial effects:

(1) Compared with the traditional protein markers and miRNA, the tsRNA existing in serum exosomes has higher stability, is favorable for resisting degradation of RNase in serum, has accurate quantification, and is favorable for improving sensitivity and specificity of disease diagnosis.

(2) The invention researches the diagnosis effect of serum exosome tsRNA in lupus nephritis and explores the clinical value of the serum exotsRNA in lupus nephritis screening. The tsRNA marker screened by the invention can be used for preparing a diagnosis kit, so that the diagnosis of lupus nephritis can be more convenient.

(3) The invention confirms a group of novel exosome tsRNA markers, namely tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 for the first time, is the exosome tsRNA marker for LN diagnosis, and lays a foundation for the deep research of tsRNA in LN.

Drawings

FIG. 1 (A) a volcanic pattern of differential expression of exosomes tsRNAs; (B) High/low expression tsRNAs expression heatmaps of 10 pre-group SLE-LN and SLE-LN;

FIG. 2 shows the expression levels of 5 exosomes tsRNAs between serum exosomes in the systemic lupus erythematosus non-nephritis group and lupus nephritis patient group;

FIG. 3 is a thermal chart of a correlation analysis of 5 exosomes tsRNAs with a patient clinical test index;

fig. 4 is a ROC graph of 2 tsrnas for the respective and combined diagnosis of the systemic lupus erythematosus non-nephritis and lupus nephritis groups.

Detailed Description

The present invention is further illustrated in the following drawings and detailed description, which are to be understood as being merely illustrative of the invention and not limiting the scope of the invention.

Example 1

A serum exosome tsRNA marker associated with lupus nephritis, said tsRNA marker being any one or a combination of the following sequences.

tRF-Thr-TGT-4-M3：SEQ ID NO.1

tRF-Tyr-GTA-1-M2：SEQ ID NO.2

A probe capable of specifically capturing a serum tsRNA marker comprising a lupus nephritis-associated serum tsRNA marker as described above. The probe is a TaqMan tsRNA probe custom synthesized by GenScript biological company, the sequences of the probe are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, the SEQ ID NO.3 and the SEQ ID NO.5 can specifically capture tRF-Thr-TGT-4-M3 (SEQ ID NO. 1), and the SEQ ID NO.4 and the SEQ ID NO.6 can specifically capture tRF-Tyr-GTA-1-M2 (SEQ ID NO. 2).

SEQ ID NO.1(RNA，Homo，tRF-Thr-TGT-4-M3)

AAAUCUCGCUGGGGCCUCCA

SEQ ID NO.2(RNA，Homo，tRF-Tyr-GTA-1-M2)

CGAAUCCGGCUCGAAGGACCA

SEQ ID NO.3 (DNA, artificial probe sequence)

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGAGG

SEQ ID NO.4 (DNA, artificial probe sequence)

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTCC

SEQ ID NO.5 (DNA, artificial probe sequence)

GCGAAATCTCGCTGGGG

SEQ ID NO.6 (DNA, artificial probe sequence)

GCGAATCCGGCTCGAA

The application of the serum exosome tsRNA marker and the probe in the preparation of lupus nephritis diagnosis kit.

A lupus nephritis diagnostic kit for detecting the expression level of one or more of the tsRNA markers described above in serum exosomes.

The kit comprises the probe. The kit also comprises reagents and enzymes which are commonly used in PCR reactions. The reagent and enzyme commonly used in the PCR reaction of the kit comprise dNTP/AMV reverse transcriptase, buffer solution and MgCl ₂ DEPC water and Taq DNA polymerase, etc.

According to the invention, the serum exosomes of lupus nephritis patients and systemic lupus erythematosus nephritis-free patients with gender and age matching are separated, RNA is extracted for tsRNA high-throughput sequencing analysis, a group of exosome tsRNA markers related to lupus nephritis is obtained through preliminary screening of a small sample and clinical verification of a large sample, and the kit for clinical diagnosis of lupus nephritis is developed based on the method, so that the kit can be used for clinical auxiliary diagnosis of lupus nephritis.

The technical scheme for solving the problems comprises the following steps:

(1) Standard-compliant serum specimens were collected according to standard procedures (SOP), and complete clinical medical record information was collected for each specimen.

(2) Screening analysis of serum exosome tsRNA differential expression profile: screening lupus nephritis patients and systemic lupus erythematosus nephritis-free patients matched with the sex age of lupus nephritis patients, separating serum exosomes, analyzing the expression profile of tsRNA in the exosomes by sequencing, screening out tsRNAs with differential expression, and carrying out multi-stage verification through clinical samples.

(3) Real-time fluorescent quantitative analysis (RT-qPCR) was performed on the above-screened exosome tsRNAs to identify tsRNAs associated with lupus nephritis.

(4) Lupus nephritis diagnostic kits were developed based on the above-screened tsRNAs.

Specifically, the method comprises the following steps:

(1) Serum specimens were collected from patients diagnosed with systemic lupus erythematosus nephritis-free (SLE-LN) and Lupus Nephritis (LN) under the systemic lupus erythematosus classification criteria established by the American college of rheumatology in 1997. The study met 111 samples of SLE without nephritis and 113 samples of LN.

(2) The exosomes were extracted from 100 μl of serum using a precipitation kit, and total RNA of the exosomes was further extracted by Trizol (Invitrogen life technologies) method.

(3) And (3) RNA quality detection: the purity and concentration of RNA was detected by agarose gel electrophoresis and qubit.

(4) High throughput sequencing of tsrnas.

(1) Performing PAGE electrophoresis recovery on the RNA;

(2) tsrnas contain a large number of apparent genetic modifications that interfere with the construction of small RNA sequencing libraries. RNA samples were treated with alk b demethylase prior to library establishment. Screening tsRNA using a second generation sequencing system sequencing and high throughput gene expression database big data analysis;

(3) deleting sequences with repeated, mismatched and over-low expression abundance, selecting tsRNA with a difference multiple of more than 10 and P <0.01 for difference analysis;

(5) Quantitative RT-qPCR detection of tsRNA.

(4) Extracting serum exosome total RNA by Trizol method;

(5) reverse transcribed to cDNA using tsRNA stem loop primers synthesized by GenScript;

(6) quantitative PCR was performed on the cDNA using tsRNA forward primers synthesized by GenScript;

(7) and detecting and comparing the difference of tsRNA expression levels in serum exosome samples of lupus nephritis and systemic lupus erythematosus nephritis-free patients.

(6) Preparation of tsRNA diagnostic kit for lupus nephritis

(8) The 2 serum exosomes tsrnas previously screened by sequencing and RT-qPCR constitute diagnostic markers;

(9) reverse transcription and quantification probes specific for tsrnas containing the 2 serum exosomes described above;

contains AMV reverse transcriptase Taq DNA polymerase and MgCl ₂ PCR reagents commonly used for PCR such as DEPC water and dNTP.

(7) Data processing and analysis

All data were counted and analyzed using Excel, graphpad prism 8.0 and SPSS 24.0 software, values expressed as mean ± SEMs, P <0.05 were considered statistically significant. When the normal and equal variances of the samples among the groups are adopted, t-test or single-factor variance analysis is adopted; when the samples among groups are inconsistent with normal distribution, U test or nonparametric test is adopted.

The invention is further illustrated below:

before exploration, the inventor respectively carries out small RNA high-throughput sequencing on 24 cases of systemic lupus erythematosus nephritis-free serum exosomes and 33 cases of lupus nephritis-free serum exosomes, and screening finds that the change difference of 154 tsRNAs in lupus nephritis serum exosomes samples is obvious (the change multiple is more than 10 and P is less than 0.01, as shown in figure 1A).

Based on sequencing results, the inventors selected tsRNAs with increased expression of top 10 in lupus nephritis patients for analysis (fig. 1B), selected 5 tsRNAs and custom synthesized corresponding TaqMan probes by GenScript corporation for detection, including tRF-imit-CAT-1, tRF-Thr-TGT-4-M3, tRF-Ala-AGC-2-M4, tRF-Tyr-GTA-1-M2, and tRF-Gly-CCC-1-M4.

The 5 tsRNAs were further validated using absolute quantification in 20 cases of systemic lupus erythematosus without nephritis and 20 cases of lupus nephritis (see figure 2).

(1) Serum exosome extraction: exosomes in 100 μl of serum samples were extracted using an exosome sedimentation kit, and total RNA in the exosomes was further extracted by Trizol method.

(2) Absolute quantitative analysis: synthesizing a standard substance of the corresponding tsRNAs, drawing a standard curve, detecting by RT-qPCR to obtain a sample CT value, and converting the sample CT value into the absolute concentration of the target tsRNAs by the standard curve. The selected tsRNAs include: tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2, the sequences are shown as SEQ ID No.1 and SEQ ID No.2

Based on the above results, further examination of the 5 tsrnas in serum exosomes from another 87 systemic lupus erythematosus nephritis-free patients and 89 lupus nephritis patients showed significant increases in tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 in lupus nephritis samples, as shown in figure 2.

Further analysis of the correlation of the 5 tsRNAs with the SLEDAI-2K, the result shows that the tRF-Tyr-GTA-1-M2 has better correlation with SLEDAI-2K, the result of which is shown in figure 3.

Further analysis of the subject working characteristic curves (ROC curves) of the tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 on the diagnosis effect of lupus nephritis shows that the two tsRNAs have good diagnosis value on lupus nephritis, and the area under the combined diagnosis ROC curve can reach 0.7950, and the result is shown in FIG. 4.

It should be noted that the foregoing merely illustrates the technical idea of the present invention and is not intended to limit the scope of the present invention, and that a person skilled in the art may make several improvements and modifications without departing from the principles of the present invention, which fall within the scope of the claims of the present invention.

Claims (9)

1. The serum exosome tsRNA marker for lupus nephritis diagnosis is characterized in that the tsRNA marker is any one or more of tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2, and the sequence of the tRF-Thr-TGT-4-M3 is shown as SEQ ID NO. 1; the sequence of the tRF-Tyr-GTA-1-M2 is shown in SEQ ID NO. 2.

2. A probe capable of specifically capturing a tsRNA marker comprising the serum exosome of lupus nephritis of claim 1.

3. A probe according to claim 2, wherein the sequences of the probe are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, the sequences of SEQ ID NO.3 and SEQ ID NO.5 can specifically capture tRF-Thr-TGT-4-M3, and the sequences of SEQ ID NO.4 and SEQ ID NO.6 can specifically capture tRF-Tyr-GTA-1-M2.

4. Use of the serum exosome tsRNA marker of claim 1 in the preparation of a lupus nephritis diagnostic kit.

5. Use of the probe according to claim 2 or 3 in the preparation of a lupus nephritis diagnostic kit.

6. A lupus nephritis diagnostic kit for detecting the amount of expression of one or more of the tsRNA markers of claim 1 in serum exosomes.

7. The lupus nephritis diagnostic kit as claimed in claim 6, wherein: the diagnostic kit comprising the probe of claim 2 or 3.

8. The lupus nephritis diagnostic kit according to claim 6 or 7, wherein: the kit also comprises reagents and enzymes which are commonly used in PCR reactions.

9. The lupus nephritis diagnostic kit as claimed in claim 8, wherein: the reagents and enzymes commonly used in PCR reactions include dNTP/AMV reverse transcriptase, buffer solution, mgCl ₂ DEPC water and TaqDNA polymerase.

Images