CN115992160A - Shuttle vector and construction method and application thereof - Google Patents

Abstract

The invention discloses a shuttle vector, a construction method and application thereof. The shuttle vector comprises a plasmid replicon of escherichia coli and an escherichia coli resistance screening gene; the plasmid replicon of the escherichia coli is R6K, and the escherichia coli resistance screening gene is rpsL gene or pheS gene; the shuttle vector does not contain a temperature sensitive replicon and sacB genes. The shuttle vector can reduce the false positive rate of homologous recombination screening between BAC and the shuttle vector, reduce the dependence on temperature, improve the screening accuracy and simplify the process. The method can be used for modifying the genome of the escherichia coli and introducing specific point mutations into genetic materials outside the genome.

Description

Shuttle vector and construction method and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to a shuttle vector, a construction method and application thereof.

Background

Coli and its derivative are important bioengineering species, which are important model organisms as important materials for life science research. The research on the escherichia coli and the derived strain thereof is not separated from the operation of molecular biology, the introduction of specific point mutation in the genome is the conventional molecular biology operation for researching the gene function, and the main methods at present are a gene editing technology based on CRISPR, a homologous recombination based on lambda-red and a method based on the self-homologous recombination system of the escherichia coli. Both the former two methods require the introduction of foreign proteins, thus being complex, while E.coli has certain limitations on the homologous recombination system, such as high false positive rate and reliance on temperature screening, and the like, which limits the application to a certain extent.

Bacterial Artificial Chromosomes (BACs) and P1 Artificial Chromosomes (PACs) containing large numbers of genomic DNA fragments have been successfully used as transgenes to create biological models of dose-dependent diseases. BACs and PACs can accurately introduce point mutations and/or small rearrangements, which are potentially valuable in transgenic technology. The prior art introduces small changes in BACs, which result in high frequency of point mutations, and this approach involves homologous recombination between the original BAC and the shuttle vector providing the mutation, each recombination step being monitored using forward and/or reverse screening markers, which are resistance genes, sacB genes, temperature sensitive replicons, etc. This approach has been used in the prior art to introduce various point mutations and exogenous genes into BACs, which can be used for the production of transgenic organisms. The sacB gene is the levosucrase gene of bacillus amyloliquefaciens, which, as a counter-selectable marker, prevents the growth of co-integrated BAC-containing clones on sucrose, and thus colonies containing the sacB gene grow very slowly on sucrose. sacB is easy to mutate, and after mutation, no method can play a role of reverse screening mark, so that the false positive rate is high. The temperature-sensitive replicon allows propagation of the plasmid at low temperatures (30-33 ℃) and under replication at high temperatures (43 ℃). In the prior art, most of temperature sensitive replicons on shuttle vectors are pSC101 ts (RepA), and the temperature change is needed to carry out screening in the screening process, so that the operation is complex and not simplified. Therefore, a new shuttle vector is needed at present, which can reduce the false positive rate of homologous recombination screening between BAC and the shuttle vector, reduce the dependence on temperature, improve the screening accuracy and simplify the process.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a shuttle vector, and a construction method and application thereof. The invention upgrades the traditional method based on the homologous recombination system of escherichia coli, replaces the replicon of the shuttle vector with R6K by pSC101 ts, replaces the reverse screening mark with rpsL or pheS gene by sacB gene, and performs function verification on the improvement, thereby developing a novel method which is simple, convenient, saves time and has lower false positive rate. The method can be used for modifying the genome of the escherichia coli and introducing specific point mutations into genetic materials outside the genome.

The invention provides a shuttle vector, which comprises a plasmid replicon of escherichia coli and an escherichia coli resistance screening gene; the plasmid replicon of the escherichia coli is R6K, and the escherichia coli resistance screening gene is rpsL gene or pheS gene; the shuttle vector does not contain a temperature sensitive replicon and sacB genes.

Further, the shuttle vector contains nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4.

Further, the shuttle vector contains nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 5.

The invention also provides a recombinant microbial cell, which contains the shuttle vector.

In one embodiment, the recombinant microbial cell is a recombinant E.coli.

In one embodiment, the recombinant microbial cell hosts E.coli and the shuttle vector is transformed into the host cell.

The invention also provides a construction method of the shuttle vector, which comprises the following steps: the plasmid replicon of the escherichia coli and the escherichia coli resistance screening gene are spliced by using a circular polymerase extension cloning method, and then are transformed into the escherichia coli by an electrotransformation or chemical transformation method. The escherichia coli is any one of DH5 alpha, TOP10, DH10B, DH, BT1, BL21 and MG 1655.

Further, the construction method comprises the following steps: splicing the PCR products of the primer pairs 1-4 by using a cyclic polymerase extension clone, and then converting the PCR products into escherichia coli;

further, the construction method comprises the following steps: splicing the PCR products of the primer pairs 1-2 and 5 by using a cyclic polymerase extension clone, and then converting the PCR products into escherichia coli;

the invention also provides application of the shuttle vector or the recombinant microorganism cell in escherichia coli genome modification.

The invention also provides application of the shuttle vector or the recombinant microorganism cell in introducing specific point mutation on genetic material outside the escherichia coli genome.

In conclusion, compared with the prior art, the invention achieves the following technical effects:

1. the shuttle vector does not contain a temperature-sensitive replicon, so that the dependency on temperature is overcome, and the shuttle vector can be screened at normal temperature.

2. The shuttle vector reduces mutation probability of the reverse screening marker, reduces false positive rate, and can be as low as 0.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a map of the R6K_rpsL plasmid obtained in example 1 of the present invention.

FIG. 2 is a schematic diagram showing the construction of R6K_rpsL plasmid obtained in example 1 of the present invention.

FIG. 3 is a LB solid plate for chloramphenicol and streptomycin in example 1 of the present invention; left: chloramphenicol; right: streptomycin.

FIG. 4 is an electrophoretogram of colony PCR for verifying whether the rpsL gene point mutation is contained in example 1 of the present invention.

FIG. 5 is a map of R6K_pheS plasmid obtained in example 2 of the present invention.

FIG. 6 is a schematic diagram of the construction of R6K_pheS plasmid obtained in example 2 of the present invention.

FIG. 7 is an electrophoretogram of colony PCR for verifying whether the rpsL gene point mutation is contained in example 2 of the present invention.

Detailed Description

In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, shall fall within the scope of the invention.

Studies have shown that R6K is a superior model for studying plasmid DNA replication because it is similar to a system that activates and modulates replication by Rep proteins and DNA sequences containing repeats. However, it is also significantly different from other systems, such as independent and co-dependent origins of replication and Rep dimers that stabilize binding repeats.

Point mutations in the rpsL gene encoding ribosomal protein S12 can result in resistance to streptomycin, resulting in rapid emergence of resistance to this antibiotic during treatment. Spontaneous rpsL mutants in E.coli have been shown to be more sensitive to the ribosome-targeting antibiotics chloramphenicol tetracycline and erythromycin, although they are resistant to streptomycin. Furthermore, the combination of these antibiotics, even at low concentrations, is sufficient to achieve complete growth inhibition of wild-type and rpsL mutants.

pheS have a similar effect to rpsL gene mutation, both of which can be negative selection markers. Studies have indicated that pheS double point mutations (GT 251A & A294G) are more sensitive to 4-chloro-phenalane (4 CP) than single point mutations (A294), with 1mM double point mutations being sufficient to inhibit growth at low concentrations, whereas single point mutations require higher concentrations (5 mM) of 4CP to inhibit growth, and thus use of double mutant PheS is of greater commercial value.

Although some functions of the above genes are found, how to use them has been recently reported. The invention replaces replicons of the shuttle vector with temperature sensitive pSC101 (pSC 101 ts) with R6K and replaces the reverse selection marker with the rpsL or pheS gene with sacB gene. Amplification of R6K requires the use of a pir-containing strain; in the target bacteria, the R6K plasmid cannot replicate due to the absence of pir protein. The invention can reduce complicated experimental steps of transformation by combining R6K and rpsL (or pheS), overcomes the false positive problem caused by sacB screening markers in pSC101 plasmid, and can rapidly screen out target transgenic strains by utilizing reverse screening markers that R6K cannot replicate in common escherichia coli and the complete growth inhibition of wild type rpsL and rpsL mutant strains.

Example 1R6K_rpsL construction and verification of plasmid

The PCR products of the 4 pairs of primers shown in Table 1 were spliced using a circular polymerase extension clone (CPEC, circular polymerase extension cloning) and directly electrotransformed into E.coli.

TABLE 1

PCR conditions:

the primer sequences are as follows (5 '-3'):

BSE_OC000009：AGTTTCGGACGATCTTCATT；

BSE_OC000008：TTACTATACTCGGCTATGAG；

BSE_OA000090：AGAGGTCGTTATCCGGCAGTCTCATAGCCGAGTA TAGTAAGCTAATGCTCTGTTACAGG；

BSE_OA000106：CTCATACGTGTAACTCAACACCACTCTCACGTAGC GGACAAAATTGAAATCAAATAATG；

BSE_OA000082：GCTACGTGAGAGTGGTGTTGAGTTACACGTATGA GGTGAATGGCGGGATCGTTGTATA；

BSE_OA000083：ACTGAGGTTAGAACCAGGCTGTGATACTATGGAG CACCTCTTAAGCCTTAGGACGCTT；

BSE_OA000098：GAGGTGCTCCATAGTATCACAGCCTGGTTCTAACC TCAGTTTGATCGGGCACGTAAGA；

BSE_OC000012：TGAAACTCTTGCCTTGACTT。

the obtained plasmid maps are shown in FIGS. 1 and 2.

The steps of electrotransformation competence are as follows:

(1) 5mL of LB is cultivated at 37 ℃ until OD= -0.4-0.5;

(2) Ice is placed at 4 ℃ for 5min;

(3) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(4) Adding 5mL of 10% glycerol to lightly suspend the thalli, and cleaning;

(5) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(6) Adding 5mL of 10% glycerol to gently suspend the thalli, and cleaning once again (the effect of cleaning once more is cleaner);

(7) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(8) About 50 μl was left for electrotransport.

Verification of successful construction of r6k_rpsl plasmid:

12 strains after electric transformation were randomly selected and coated on LB solid plates of chloramphenicol and streptomycin, respectively, as shown in FIG. 3, the left side was LB plate coated with chloramphenicol, and the right side was LB plate coated with streptomycin. A strain capable of growing on chloramphenicol plates, representing that the strain possesses a constructed r6k_rpsl plasmid, which is a control group; if grown on streptomycin resistant plates, are false positive strains. The results of FIG. 3 show that none of the 12 strains selected were false positive.

Colony PCR was then continued, and it was confirmed whether the strain capable of growing on the chloramphenicol plate was a strain in which the gene was successfully inserted into the chromosome, using the P1 and P4 primers. The primer sequences for P1 and P4 are as follows (5 '-3'):

P1：GGCATCACGGCAATATAC；

P4：TCTGGTCTGGTAGCAATG；

the size of the uninserted fragment is 741bp, the successful insertion is 3979bp, and the electrophoresis result of FIG. 4 shows that all amplified fragments are 3979bp, so that the method of the embodiment is used as negative selection, the success rate is 100%, and the R6K_rpsL plasmid of the embodiment can overcome the false positive problem in resistance selection.

EXAMPLE 2R6K_pheS plasmid construction and verification

In addition to using the rpsL gene as a negative selection marker, the pheS gene can also replace sacB, which is commonly used in the prior art, as a negative selection marker to reduce the false positive rate. The method comprises the following specific steps:

the PCR products from the 3 pairs of primers shown in Table 2 were subjected to direct electrotransfer to E.coli after splicing using the circular polymerase extension clone (CPEC, circular polymerase extension cloning).

TABLE 2

PCR conditions:

the primer sequences were as follows:

BSE_OC000009：AGTTTCGGACGATCTTCATT；

BSE_OC000008：TTACTATACTCGGCTATGAG；

BSE_OA000090：AGAGGTCGTTATCCGGCAGTCTCATAGCCGAGTA TAGTAAGCTAATGCTCTGTTACAGG；

BSE_OA000106：CTCATACGTGTAACTCAACACCACTCTCACGTAGC GGACAAAATTGAAATCAAATAATG；

BSE_OA000108：GCTACGTGAGAGTGGTGTTGAGTTACACGTATGA GGTGAATTGATCGGGCACGTAAGA；

BSE_OC000012：TGAAACTCTTGCCTTGACTT。

the obtained plasmid maps are shown in FIGS. 5 and 6.

The steps for preparing electrotransformation competent cells are as follows:

(1) Inoculating the escherichia coli strain into 5mL of LB culture medium, and culturing at 37 ℃ until OD= -0.4-0.5;

(2) Ice is placed at 4 ℃ for 5min;

(3) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(4) Adding 5mL of 10% glycerol to lightly suspend the thalli, and cleaning;

(5) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(6) Adding 5mL of 10% glycerol to gently suspend the thalli, and cleaning once again (the effect of cleaning once more is cleaner);

(7) Centrifuging at 4000rpm at 4deg.C for 5min, and removing supernatant;

(8) About 50. Mu.L of bacterial liquid was left for electrotransformation.

Verification of successful construction of r6k_phes plasmid:

colony PCR was performed using the P1 and P4 primers (same as in example 1) to verify whether R6K_pheS was inserted into the chromosome, the size of the non-inserted fragment was 741bp, the successful insertion was 4432bp, and the gel diagram of FIG. 7 shows that all amplified fragments were 4432bp, so that the method of this example was used as negative selection with a success rate of 100%. Then, the above 12 strains confirmed to have the pheS gene were spread on an LB solid medium containing 4-chloro-phenylalanine, and negative selection was confirmed, which revealed that all of the 12 strains were able to grow on an LB solid medium containing 4-chloro-phenylalanine.

By combining the above examples, the present invention replaces replicons of shuttle vectors with R6K from temperature sensitive pSC101 (pSC 101 ts), replaces reverse screening markers with rpsL or pheS genes from sacB genes, and performs functional verification on the improvement, thus developing a new method which is simple, saves time and has lower false positive rate. The shuttle vector does not contain a temperature-sensitive replicon, so that the dependency on temperature is overcome, the shuttle vector can be screened at normal temperature, the mutation probability of reverse screening markers is reduced, the false positive rate is reduced, and the false positive rate can be as low as 0. The method can be used for modifying the genome of the escherichia coli and introducing specific point mutations into genetic materials outside the genome.

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

SEQ ID NO.1 (fragment_1 in R6K_rpsL plasmid)

AGTTTCGGACGATCTTCATTAAGTCAAGGCAAGAGTTTCATGTCAGC CGTTAAGTGTTCCTGTGTCACTCAAAATTGCTTTGAGAGGCTCTAAG GGCTTCTCAGTGCGTTACATCCCTGGCTTGTTGTCCACAACCGTTAA ACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAAC TTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTG TTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTT AGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAA CATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGAAACAT GAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCAGA TCGGTTGAACGACGGCTTGTATGTCGGTATGCGGGATCGGTTGAAAG TGAAACGTGATTTCATGCGTCATTTTGAACATTTTGTAAATCTTATTT AATAATGTGTGCGGCAATTCACATTTAATTTATGAATGTTTTCTTAACA TCGCGGCAACTCAAGAAACGGCAGGTTCGGATCTTAGCTACTAGAG AAAGAGGAGAAATACTAGATGCGTAAAGGCGAAGAGCTGTTCACTG GTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCAT AAGTTTTCCGTGCGTGGCGAGGGTGAAGGTGACGCAACTAATGGTA AACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTTCCT TGGCCGACTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGC TCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCA TGCCGGAAGGCTATGTGCAGGAACGCACGATTTCCTTTAAGGATGA CGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACC CTGGTAAACCGCATTGAGCTGAAAGGCATTGACTTTAAAGAGGACG GCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAAT GTTTACATCACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTT TAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGAT CACTACCAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCC AGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCG AACGAGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAG CGGGCATCACGCATGGTATGGATGAACTGTACAAATGACCAGGCATC AAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAT CTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCAC CTTCGGGTGGGCCTTTCTGCGTTTATAAGAGGTCGTTATCCGGCAGT CTCATAGCCGAGTATAGTAA

SEQ ID NO.2 (fragment_2 in R6K_rpsL plasmid)

AGAGGTCGTTATCCGGCAGTCTCATAGCCGAGTATAGTAAGCTAATG CTCTGTTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGAC TGCATATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAA AATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAG CTTTTTTATACTAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTG TTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAT TTCAATTTTGTCCGCTACGTGAGAGTGGTGTTGAGTTACACGTATGA G

SEQ ID NO.3 (fragment_3 in R6K_rpsL plasmid)

GCTACGTGAGAGTGGTGTTGAGTTACACGTATGAGGTGAATGGCGG GATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCCCTAAAATTCG GCGTCCTCATATTGTGTGAGGACGTTTTATTACGTGTTTACGAAGCA AAAGCTAAAACCAGGAGCTATTTAATGGCAACAGTTAACCAGCTGG TACGCAAACCACGTGCTCGCAAAGTTGCGAAAAGCAACGTGCCTGC GCTGGAAGCATGCCCGCAAAAACGTGGCGTATGTACTCGTGTATATA CTACCACTCCTAAAAAACCGAACTCCGCGCTGCGTAAAGTATGCCGT GTTCGTCTGACTAACGGTTTCGAAGTGACTTCCTACATCGGTGGTGA AGGTCACAACCTGCAGGAGCACTCCGTGATCCTGATCCGTGGCGGT CGTGTTAAAGACCTCCCGGGTGTTCGTTACCACACCGTACGTGGTGC GCTTGACTGCTCCGGCGTTAAAGACCGTAAGCAGGCTCGTTCCAAG TATGGCGTGAAGCGTCCTAAGGCTTAAGAGGTGCTCCATAGTATCAC AGCCTGGTTCTAACCTCAGT

SEQ ID NO.4 (fragment_4 in R6K_rpsL plasmid)

GAGGTGCTCCATAGTATCACAGCCTGGTTCTAACCTCAGTTTGATCG GGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTA CCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGC TAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCC AATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAA TGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAG ACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACAT TCTTGCCCGCCTGATGAATGCTCATCCGGAATTTCGTATGGCAATGA AAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACC GTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATA CCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGG CGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAG AATATGTTTTTCGTTTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTT GATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCAC CATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGG CGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGA ATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGG CGTAATTTGATATCGAGCTCGCTTGGACTCCTGTTGATAGATCCAGTA ATGACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCG CCGGGCGTTTTTTATTGGTAGTTTCGGACGATCTTCATTAAGTCAAG GCAAGAGTTTCA

SEQ ID NO.5 (fragment_5 in R6K_pheS plasmid)

GCTACGTGAGAGTGGTGTTGAGTTACACGTATGAGGTGAATTGATCG GGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTA CCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGC TAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCC AATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAA TGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAG ACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACAT TCTTGCCCGCCTGATGAATGCTCATCCGGAATTTCGTATGGCAATGA AAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACC GTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATA CCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGG CGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAG AATATGTTTTTCGTTTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTT GATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCAC CATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGG CGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGA ATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGG CGGGTGGTGGTGGTTCTTCACATCTCGCAGAACTGGTTGCCAGTGC GAAGGCGGCCATTAGCCAGGCGTCAGATGTTGCCGCGTTAGATAATG TGCGCGTCGAATATTTGGGTAAAAAAGGGCACTTAACCCTTCAGATG ACGACCCTGCGTGAGCTGCCGCCAGAAGAGCGTCCGGCAGCTGGT GCGGTTATCAACGAAGCGAAAGAGCAGGTTCAGCAGGCGCTGAATG CGCGTAAAGCGGAACTGGAAAGCGCTGCACTGAATGCGCGTCTGGC GGCGGAAACGATTGATGTCTCTCTGCCAGGTCGTCGCATTGAAAAC GGCGGTCTGCATCCGGTTACCCGTACCATCGACCGTATCGAAAGTTT CTTCGGTGAGCTTGGCTTTACCGTGGCAACCGGGCCGGAAATCGAA GACGATTATCATAACTTCGATGCTCTGAACATTCCTGGTCACCACCC GGCGCGCGCTGACCACGACACTTTCTGGTTTGACACTACCCGCCTG CTGCGTACCCAGACCTCTGGCGTACAGATCCGCACCATGAAAGCCC AGCAGCCACCGATTCGTATCATCGCGTCTGGCCGTGTTTATCGTAAC GACTACGACCAGACTCACACGCCGATGTTCCATCAGATGGAAGGTC TGATTGTTGATACCAACATCAGCTTTACCAACCTGAAAGGCACGCTG CACGACTTCCTGCGTAACTTCTTTGAGGAAGATTTGCAGATTCGCTT CCGTCCTTCCTACTTCCCGTTTGCCGAACCTTCTGCAGAAGTGGACG TCATGGGTAAAAACGGTAAATGGCTGGAAGTGCTGGGCTGCGGGAT GGTGCATCCGAACGTGTTGCGTAACGTTGGCATCGACCCGGAAGTTT ACTCTGGTTTCGGCTTCGGGATGGGGATGGAGCGTCTGACTATGTTG CGTTACGGCGTCACCGACCTGCGTTCATTCTTCGAAAACGATCTGCG TTTCCTCAAACAGTTTAAATAATTTGATATCGAGCTCGCTTGGACTCC TGTTGATAGATCCAGTAATGACCTCAGAACTCCATCTGGATTTGTTCA GAACGCTCGGTTGCCGCCGGGCGTTTTTTATTGGTAGTTTCGGACGA TCTTCATTAAGTCAAGGCAAGAGTTTCA。

Claims (9)

1. A shuttle vector comprising a plasmid replicon of e.coli and an e.coli resistance selection gene; the plasmid replicon of the escherichia coli is R6K, and the escherichia coli resistance screening gene is rpsL gene or pheS gene; the shuttle vector does not contain a temperature sensitive replicon and sacB genes.

2. The shuttle vector according to claim 1, wherein the shuttle vector comprises the nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No. 4.

3. The shuttle vector according to claim 1, wherein the shuttle vector comprises the nucleotide sequences shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No. 5.

4. A recombinant microbial cell comprising the shuttle vector of any one of claims 1 to 3.

5. A method of constructing a shuttle vector as claimed in any one of claims 1 to 3, comprising the steps of:

the plasmid replicon of the escherichia coli and the escherichia coli resistance screening gene are spliced by using a circular polymerase extension cloning method, and then are transformed into the escherichia coli by an electrotransformation or chemical transformation method.

6. The method of constructing a shuttle vector according to claim 5, comprising the steps of:

splicing the PCR products of the primer pairs 1-4 by using a cyclic polymerase extension clone, and then converting the PCR products into escherichia coli;

7. the method of constructing a shuttle vector according to claim 5, comprising the steps of:

splicing the PCR products of the primer pairs 1-2 and 5 by using a cyclic polymerase extension clone, and then converting the PCR products into escherichia coli;

8. use of the shuttle vector of any one of claims 1 to 3 or the recombinant microbial cell of claim 4 in the genome modification of e.

9. Use of the shuttle vector of any one of claims 1 to 3 or the recombinant microbial cell of claim 4 to introduce specific point mutations on genetic material outside the e.coli genome.

Images