CN115976287A

CN115976287A - Method for detecting and distinguishing orthopoxviruses for non-diagnostic purposes, device and application thereof

Info

Publication number: CN115976287A
Application number: CN202310129611.5A
Authority: CN
Inventors: 谭文杰; 霍恕婷; 吴长城; 赵莉; 陈昱达
Original assignee: National Institute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention
Current assignee: National Institute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention
Priority date: 2023-02-17
Filing date: 2023-02-17
Publication date: 2023-04-18

Abstract

The invention provides a method for detecting and distinguishing orthopoxviruses for non-diagnostic purposes, a detection device and application thereof. In order to further test the sensitivity of the method, the invention further uses digital PCR to determine the lowest detection limit. The lowest detection limits of the three channels were determined by 119 copies/. Mu.L, 183 copies/. Mu.L and 8.6X 10 of fluorescent quantitative PCR ³ The PFU/mL is reduced to 0.484 copy number/mu L,0.352 copy number/mu L and 0.352 copy number/mu L, and the detection sensitivity of the method is greatly improved. And again the specificity of the detection of the invention was verified by digital PCR method.

Description

Method for detecting and distinguishing orthopoxviruses for non-diagnostic purposes, device and application thereof

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to a method for detecting and distinguishing orthopoxviruses for non-diagnosis purposes, a detection device and application thereof.

Background

Monkeypox (monkeypox), an infectious zoonosis, belongs to the family orthopoxviridae, the subfamily chordopoxvirinae, the genus orthopoxvirus. Monkeypox is predominantly prevalent in tropical rainforests of middle and west africa. Since 2003 it appeared in the western hemisphere, later studies found that monkeypox presented two branches, the west non-branch (now clade IIa, clade IIb) and the congo branch (now clade I). The sequence homology of the west non-branch and congo branch was 99%. West african branches are less virulent than congo branches, with milder rashes and fewer lesions appearing after infection. Studies have shown that intraperitoneal injection of West African strain into severely combined immunodeficient BALB/c mice shows a longer average survival time than injection of Congo strain.

36412 monkey pox cases are diagnosed in laboratories worldwide from 1/1 to 10/6 in 2022. On day 23 of 7/23 of 2022, world health organization announced that monkeypox constitutes an emergent public health event of international concern. Therefore, in the current situation of monkey pox epidemics, it is necessary to develop new diagnostic methods to rapidly and accurately detect and distinguish different branches of monkey pox virus.

The laboratory diagnosis of monkeypox is very important because the clinical manifestations of infection with monkeypox are very similar to those of other "pox-like" diseases, such as smallpox and chicken pox. Virus isolation is reliable and specific, but risks exposure; serological tests are prone to false positives due to cross-reactivity between orthopoxviruses; PCR reactions have a high sensitivity and require very small sample volumes. However, the traditional PCR method needs to combine the technologies of restriction fragment length polymorphism analysis or agarose gel electrophoresis, first-generation sequencing and the like, and is time-consuming and labor-consuming. Thus, rapid and sensitive Taqman probe-based methods are in force.

The existing method for distinguishing the simian pox virus West Africa strain and the Congo strain mainly utilizes the specificity deletion of the West Africa strain or the Congo strain. Such as: the simian pox virus Simo strains are detected by using the deletion of the simian pox virus West Africa strain C3L gene, and the simian pox virus Simo strains are detected by using the deletion of 3bp of the simian pox virus Simo strain G2R gene; the method is characterized in that a West African strain A-type inclusion body protein gene is 453bp more than that of a Congo strain, and the sizes of bands are distinguished according to the traditional polymerase chain reaction combined with a restriction endonuclease method; two specific reverse primers are designed by using that the protein gene of the West African A-type inclusion body is 453bp more than that of the Congo plant. The main existing problems are that: time consuming (ii) a; need to be directed to different genes; two pairs of primers, etc. are often required; the Simplex poxvirus West non-branch and Congo branch can not be detected and distinguished in the same reaction.

Disclosure of Invention

Therefore, the present invention aims to overcome the defects in the prior art and provide a method for detecting and distinguishing orthopoxviruses for non-diagnostic purposes, a detection device and applications thereof. The invention relates to a digital PCR method capable of simultaneously and rapidly detecting and distinguishing monkey pox virus clade I, monkey pox virus clade II and other orthopoxviruses.

Before setting forth the context of the present invention, the terms used herein are defined as follows:

the term "PCR" refers to: polymerase chain reaction.

The term "dPCR probe Master mix" refers to: digital PCR master mix.

The term "clade I" refers to: monkeypox virus conoguo branch.

The term "clade II" means: monkeypox virus west african branch.

The term "FAM" refers to: carboxyfluorescein.

The term "CY5" means: and (5) sulfocyanine 5.

The term "HEX" refers to: hexachlorobutadiene fluorescein.

The term "BHQ1" refers to: black hole quencher 1.

The term "BHQ2" refers to: black hole quencher group 2.

The term "PUC57 vector" refers to: recombinant E.coli PUC57 plasmid vectors.

The term "PBR332 vector" refers to: the PBR332 plasmid vector is constructed by three parent plasmids of pSF2124, pMB1 and pSC101 through a complicated recombination process.

The term "PUC18 vector" means: the PUC18 plasmid vector is a vector suitable for DNA sequencing by a dideoxy method, and has an ampicillin resistant gene and no exogenous fragment.

The term "PUC19 vector" refers to: the pUC19 plasmid vector is identical to the pUC18 plasmid vector except that the Multiple Clone Site (Multiple Clone Site) portion is reverse complementary.

The term "PGEM-T" refers to: PGEM-T plasmid vector.

The term "dPCR reaction buffer" refers to: digital PCR reaction buffer.

The term "Taq polymerase" refers to: is the first discovered thermostable DNA polymerase, with a molecular weight of 65kD, originally extracted from a strain of Thermobacillus aquaticus (Thermus aquaticus) isolated from hot springs by Saiki et al.

The term "AmpErase enzyme" refers to: is a 26kDa ultrapure recombinase, is coded by uracil N-glycosylase genes in escherichia coli, and directly expresses wild-type enzyme by being inserted into an escherichia coli host.

The term "dATP" refers to: deoxyadenosine triphosphate.

The term "dCTP" means: deoxycytidine triphosphate.

The term "dGTP" means: deoxyguanosine triphosphate.

The term "dTTP" means: deoxythymidine triphosphate.

The term "dUTP" refers to: deoxyuridine triphosphate.

To achieve the above objects, a first aspect of the present invention provides a method for detecting and differentiating orthopoxviruses for non-diagnostic purposes, said method comprising the steps of:

(1) Constructing plasmids, and synthesizing an upstream primer and a downstream primer;

(2) Diluting the plasmid constructed in the step (1) and then configuring a reaction system, wherein the reaction system comprises: dPCR probe Master mix, upstream primer, downstream primer, probe and template DNA; and

(3) Detecting and distinguishing the orthopoxvirus by a digital PCR method;

wherein: the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

The method according to the first aspect of the present invention, wherein in the step (2), the plasmid constructed in the step (1) is diluted by a factor selected from one or more of: 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, more preferably selected from one or more of the following: 2 times, 5 times, 10 times, and more preferably 10 times or 2 times.

According to the method of the first aspect of the present invention, in the step (3): the digital PCR method comprises: 3-10min at 50-80 ℃, 12-20min at 80-100 ℃, 5-15s at 80-100 ℃, 30-45 cycles at 50-80 ℃ for 20-40 s, and 50-80 ℃ for 50-70 s, preferably comprising the following steps: 4-8min at 50-70 ℃, 12-18min at 90-100 ℃, 10-15s at 90-100 ℃, 25-35s at 50-70 ℃ for 30-45 cycles, 55-65 s at 50-70 ℃, and the most preferable cycle comprises: 60 ℃ for 5min,95 ℃ for 15min,95 ℃ for 15s,60 ℃ for 30s for 45 cycles, 60 ℃ for 1min.

A second aspect of the invention provides an apparatus for detecting and distinguishing orthopoxviruses, the apparatus comprising:

(A) A primer synthesis and plasmid construction mechanism;

(B) A reaction system configuration mechanism; and

(C) A digital PCR analysis mechanism;

wherein, the reaction system configuration mechanism comprises: the primer sequence of the dPCR probe Master mix is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

The device according to the second aspect of the method of the first aspect of the invention, wherein the vector of the plasmid is selected from one or more of: PUC57 vector, PBR332 vector, PUC18 vector, PUC19 vector, PGEM-T, preferably selected from one or more of the following: PUC57 vector, PUC18 vector, PUC19 vector, most preferably PUC57 vector.

Apparatus according to the second aspect of the method of the first aspect of the invention wherein the probe comprises: a simian pox virus clone I probe, a simian pox virus clone II probe, and at least one other orthopoxvirus probe;

preferably, the sequence of the monkey pox virus clade I probe is shown in SEQ ID NO. 3;

preferably, the sequence of the monkey pox virus clade II probe is shown in SEQ ID NO. 4; and/or

Preferably, the sequence of said other orthopoxvirus probe is as shown in SEQ ID NO 5.

The device according to the second aspect of the method of the first aspect of the present invention, wherein the dPCR probe Master mix comprises: dPCR reaction buffer, taq polymerase, amperase, dATP, dCTP, dGTP, dTTP, dUTP and sodium azide; and/or

The sequence of the template DNA is shown as SEQ ID NO. 6 and/or SEQ ID NO. 7.

The apparatus according to the second aspect of the method of the first aspect of the invention, wherein:

the dosage of the dPCR probe Master mix is 10-15 muL, preferably 10-12 muL, and most preferably 12 muL;

the dosage of the upstream primer is 0.5-2.0 muL, preferably 0.8-1.5 muL, and most preferably 1 muL;

the dosage of the lower upstream primer is 0.5-2.0 muL, preferably 0.8-1.5 muL, and most preferably 1 muL;

the volume ratio of the simian pox virus clone I probe, the simian pox virus clone II probe and the other orthopoxvirus probes is 1:1:1; and/or

The amount of the template DNA is 3 to 10. Mu.L, preferably 5 to 8. Mu.L, and most preferably 5. Mu.L.

In a third aspect the invention provides the use of the device of the second aspect for the manufacture of a medical product for detecting and differentiating orthopoxviruses.

According to the method, device or use of the first, second or third aspect as described above, the orthopoxvirus is a monkeypox virus, preferably a monkeypox virus west african strain and/or a monkeypox virus congo strain.

The dPCR probe Master mix is a PCR reaction mixture. Which contains deoxyuridine triphosphate (dUTP) instead of deoxythymidine triphosphate (dTTP) incorporated into newly synthesized DNA (amplicon). In the first thermal cycling step, the first thermal cycle step, the AmpErase enzyme contained in the reaction mixture will eliminate any contaminated amplicons from the previous PCR run. However, amperase does not eliminate the newly formed amplicon, because it is inactivated upon exposure to temperatures in excess of 55 ℃.

The dPCR probe Master mix includes dPCR reaction buffer, taq polymerase, amperase, dATP, dCTP, dGTP, dTTP, dUTP, sodium azide and proprietary additives.

The breakthrough of the invention is that the prior art can only detect the monkeypox virus, and two reactions are used for respectively detecting a monkeypox virus congo strain (clone I) and a simian strain (clone II), a primer probe for detecting the monkeypox virus congo strain is designed on a C3L gene (the simian strain is deleted at C3L), and a primer probe for detecting the simian pox virus congo strain is designed on a G2R (compared with the simian strain, the congo strain has deletion of 3 bp); probes were designed using either West African or Congo specific deletions. In addition, in part of the prior art, the traditional Polymerase Chain Reaction (PCR) is combined with a restriction enzyme method, and 453bp more inclusion body protein of the West African strain A is utilized than that of the Congo strain to observe the size of bands for distinguishing, comparing and consuming time. In another part of the prior art, an upstream primer and two downstream primers respectively aim at the A-type inclusion body protein genes of the West African strain and the Congo strain, and only two branches can be detected completely, so that the West African strain and the Congo strain of the monkeypox virus cannot be distinguished in the same reaction.

Such orthopoxviruses include monkeypox virus and other orthopoxviruses. The monkeypox virus comprises monkeypox virus clade I and clade II.

The invention can detect the orthopoxvirus, and can simultaneously distinguish a simian pox virus Congo strain (clade I), a West Africa strain (clade II) and other orthopoxviruses in one reaction; the primer probe is designed on the F3L gene of the monkeypox virus, and the probes specific to the West filly strain and the Congo strain are designed by utilizing four adjacent mutations of the West filly strain and the Congo strain on the F3L gene. The multiplex fluorescence quantitative PCR method using the Taqman probe has the advantages of high speed and sensitive detection. Through a pair of primers, two probes respectively aim at F3L genes of a simian pox virus West Africa strain and a Congo strain, and the West Africa strain and the Congo strain can be simultaneously distinguished in the same reaction.

The kit can detect the orthopoxvirus, and can simultaneously detect and distinguish a simian pox virus West Africa strain (clade II), a congo strain (clade I) and other orthopoxviruses. If the sample contains simian pox virus West filly nucleic acid, the FAM channel has an amplification curve, and the other two channels have no amplification curves; if the sample contains the monkeypox virus congo strain nucleic acid, the CY5 channel has an amplification curve, and the other two channels have no amplification curves; if there are other orthopoxvirus nucleic acids in the sample that are not monkeypox, then the HEX channel has an amplification curve and the remaining two channels have no amplification curve. The method has wide application range, can detect the members of the orthopoxvirus, can classify the monkeypox virus, and has extremely high specificity and better sensitivity.

As shown in FIG. 2, when the input template is a simian pox virus West Africa strain (clade II) plasmid, only the FAM channel has an amplification curve, while the other two channels have no amplification curves; when the input template is a monkeypox virus congo strain (clone I) plasmid, only the CY5 channel has an amplification curve, and the other two channels have no amplification curves; when other orthopoxvirus nucleic acids, such as vaccinia virus, are used as templates, only the HEX channel has an amplification curve, while the other two channels have no amplification curves. The lower limit of detection of the simian pox west non-branched plasmid is 119 copies/. Mu.L, the lower limit of detection of the simian pox conus strain plasmid is 183 copies/. Mu.L, and the lower limit of detection of the vaccinia virus is 8.6X 10 ³ PFU/mL。

In order to further test the sensitivity of the method, the invention further uses digital PCR to determine the lowest detection limit. The lowest detection limits of the three channels were determined by 119 copies/. Mu.L, 183 copies/. Mu.L and 8.6X 10 of fluorescent quantitative PCR ³ The PFU/mL is reduced to 0.484 copy number/. Mu.L, 0.352 copy number/. Mu.L and 0.352 copy number/. Mu.L, and the detection sensitivity of the method is greatly improved. And again the specificity of the detection of the invention was verified by digital PCR method.

The specificity of the reaction was again verified by digital PCR technique and the sensitivity of the reaction was greatly improved. The digital PCR can directly quantify the nucleic acid in the sample, and the quantification is accurate. Standard curve quantification (required for multiplex fluorescent quantitative PCR) by standards was not required.

Advantages of digital PCR: the digital PCR technology is based on the principle of 'limited dilution', and averagely distributes a standard PCR reaction system containing a nucleic acid template into tens of thousands of PCR reactions, distributes the PCR reactions into a chip or a microdrop, enables each reaction to contain one template molecule as much as possible, and carries out single-molecule template PCR reaction. After the PCR reaction is finished, counting the amplification signals of each micro-reaction unit, and calculating the copy number of the target molecules in the sample through a Poisson distribution theoretical model. The advantages of digital PCR are: (1) Calculating the initial sample copy number by identifying the number of negative and positive micro-drops after reaction, and carrying out absolute quantitative detection on the sample without depending on a control sample and a standard curve; (2) When the result is judged, the digital PCR only judges the droplet state, namely the droplet state, and does not depend on a Ct value and a threshold line, so that the detection sensitivity to low-abundance samples is high; (3) The distribution principle of the reaction system can greatly reduce the concentration of the inhibitory molecules in the microcells and improve the detection accuracy of the complex background sample. The fluorescent quantitative PCR relatively quantifies target nucleotide molecules by using standard plasmids, and the quantitative result is influenced by the reaction efficiency and the concentration of an inhibitor.

The invention verifies the specificity of the designed primer probe again, greatly reduces the lower limit of detection and improves the sensitivity of reaction.

The nucleotide sequence of the invention is shown in SEQ ID NO. 1-7:

1, SEQ ID NO: 5-.

2, SEQ ID NO:5 'TGGAGAAGCGAGAAGTTAATAAAGC-3' (since 5 '-and-3' cannot be recognized by WIPO Sequence, SEQ ID NO.2 is based on the Sequence described herein).

3, SEQ ID NO: 5'-CY5-TCGTCGGAACTGTACACCATAGTAC-3' BHQ2 (since WIPO Sequence cannot recognize 5 'CY5-and-3' BHQ2, SEQ ID NO.3 is based on the Sequence described herein in the specification).

4, SEQ ID NO:5 '-FAM-TCGTTGGAGCTGTAACCATAGCAC-3' BHQ1 (since 5'FAM and-3' BHQ1 cannot be recognized by WIPO Sequence, SEQ ID NO.4 is based on the Sequence described herein in the specification).

5, SEQ ID NO:5 '-HEX-TCGTCGGAGCTGTACACATAGCAC AC-3' BHQ1 (5 'HEX-and-3' BHQ1 cannot be identified by WIPO Sequence; SEQ ID NO.5 is based on the Sequence described herein in the specification).

SEQ ID NO:6：

ATGGAGAAGCGAGAAGTTAATAAAGCTCTGTATGATCTTCAACGTAGTACTATGGTGTACAGTTCCGACGATACTCCTCCTCGTTGGTCTACGACAATGGATGCTGATACACGGCCTACAGATTCTGATGCTGATGCTATAAT AGATGATGTATCCCGCGAAAAATCAATGAGAGAGGATAATAAGTCTTTTGATGATGTTATTCCGGTTAAAAAAATTATTTATTGGAAAGGTGTTAACCCTGTCACCGTTATTAATGAGTACTGCCAAATAACTAGGAGAGATTGGTCTTTTCGTATTGAATCAGTGGGGCCTAGTAACTCTCCTACATTTTATGCCTGTGTAGACATTGACGGAAGAGTATTCGATAAGGCAGATGGAAAATCTAAACGAGATGCTAAAAATAATGCAGCTAAATTGGCTGTAGATAAACTTCTTAGTTATGTCATCATTAGATTCTGA。

SEQ ID NO:7：

ATGGAGAAGCGAGAAGTTAATAAAGCTCTGTATGATCTTCAACGTAGTGCTATGGTTTACAGCTCCAACGATACTCCTCCTCGTTGGTCTACGACAATGGATGCTGATACACGGCCTACAGATTCTGATGCTGATGCTATAATAGATGATGTATCCCGCGAAAAATCAATGAGAGAGGATCATAAGTCTTTTGATGATGTTATTCCGGTTAAAAAAATTATTTATTGGAAAGGTGTTAACCCTGTCACCGTTATTAATGAGTACTGTCAAATAACTAGGAGAGATTGGTCTTTTCGTATTGAATCAGTGGGGCCTAGTAACTCTCCTACATTTTATGCCTGTGTAGACATTGACGGAAGAGTATTCGATAAGGCAGATGGAAAATCTAAACGAGATGCTAAAAATAATGCAGCTAAATTGGCTGTAGATAAACTTCTTAGTTATGTCATCATTAGATTCTGA。

The method of the invention for detecting and differentiating orthopoxviruses for non-diagnostic purposes may have, but is not limited to, the following beneficial effects:

1. the kit can detect the orthopoxvirus, and can simultaneously detect and distinguish a simian pox virus West Africa strain (clade II), a congo strain (clade I) and other orthopoxviruses. If the sample contains simian pox virus West filoba nucleic acid, the FAM channel has an amplification curve, and the other two channels have no amplification curve; if the sample contains the monkeypox virus congo strain nucleic acid, the CY5 channel has an amplification curve, and the other two channels have no amplification curves; if other orthopoxvirus nucleic acids than monkeypox are present in the sample, the HEX channel has an amplification curve and the remaining two channels have no amplification curve. The method has wide application range, can detect the members of the orthopoxvirus, can classify the monkeypox virus, and has extremely high specificity and better sensitivity.

2. In order to further test the sensitivity of the method,the invention further uses digital PCR to determine the lowest detection limit. The lowest detection limits of the three channels were determined by 119 copies/. Mu.L, 183 copies/. Mu.L and 8.6X 10 of fluorescent quantitative PCR ³ The PFU/mL is reduced to 0.484 copy number/mu L,0.352 copy number/mu L and 0.352 copy number/mu L, and the detection sensitivity of the method is greatly improved. And again the specificity of the detection of the invention was verified by digital PCR method.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows a schematic sequence alignment of amplification target regions of monkeypox viruses clone I, clone II and other orthopoxviruses; the sequence of the MPXV _ UK _ P2 strain is the reference genomic sequence. The nucleotide positions of the reference genomic amplification target region on the whole genomic sequence are shown. The "dots" in the figure represent the same nucleotides as the reference genomic sequence, and the mutations are labeled "a", "T", "C", or "G". Arrows indicate the direction and sequence of the upstream primer, downstream primer and Taqman probe.

FIG. 2 shows confirmation of the specificity of the double fluorescent quantitative PCR reaction; amplification curves when different types of templates are put in; the 5' ends of the three probes designed according to FIG. 1 carry the fluorescence of FAM, CY5 or HEX, respectively. Wherein, FIG. 2A is an amplification curve when different copy numbers of West African strain plasmids with gradient dilution are put in; FIG. 2B is an amplification curve when different copy numbers of Congo strain plasmids were dosed at a gradient dilution; FIG. 2C is an amplification curve when an orthopoxvirus nucleic acid represented by a vaccinia virus Tiantan strain nucleic acid is administered; FIG. 2D is an amplification curve when nucleic acids of a case infected with a West African pox virus strain were administered.

FIG. 3 shows sensitivity validation of multiplex fluorescent quantitative PCR reactions; the coordinates of the standard curves of different branched plasmids of the monkeypox virus and the vaccinia virus are logarithmic values of copy numbers of different dilution gradient plasmids or logarithmic values of titer of the vaccinia virus, and the ordinate is a cycle threshold of the fluorescent quantitative PCR; also shown in FIG. 3 are the linear regression equations and R ² . FIG. 3A is a standard curve of different dilutions of monkeypox west unbranched plasmid; FIG. 3B shows different dilutionsA standard curve for monkeypox congo branched plasmids; FIG. 3C is a standard curve for different dilutions of vaccinia virus.

FIG. 4 shows the result of the numerical PCR quantitative determination of the monkey pox congo strain plasmid.

FIG. 5 shows the result of the numerical PCR quantitative determination of the plasmid of Simplepox West.

FIG. 6 shows the results of digital PCR quantitative detection of vaccinia virus Tiantan strain (other orthopoxvirus nucleic acids).

Detailed Description

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative and not limitative of the remainder of the disclosure in any way whatsoever.

This section describes generally the materials used in the tests of the present invention, as well as the test methods. Although many materials and methods of operation are known in the art for the purpose of carrying out the invention, the invention is nevertheless described herein in as detail as possible. It will be apparent to those skilled in the art that the materials and methods of operation used in the present invention are well within the skill of the art in this context, if not specifically mentioned.

The reagents and instrumentation used in the following examples are as follows:

reagent:

2 XTaq Pro U + Probe qPCR Mix, purchased from Nanjing Novowed Biotech GmbH.

The instrument comprises:

digital PCR instrument from Roche pharmaceutical, model number Digital

System。

Example 1 sequence alignment and primer Probe design

From the NCBI downloaded 138 orthopoxvirus genome sequences including monkeypox virus clade I, clade II and other orthopoxviruses. A partial representative sequence alignment is shown in figure 1. The sequence of the monkey pox virus MPXV _ UK _ P2 strain is a reference genome sequence. At positions 46422-46446 of the MPXV _ UK _ P2 whole genome, the simian pox virus clade I and clade II are four base differences compared, while the other orthopoxviruses are two base differences compared to the simian pox virus. Probes for monkey pox virus clone I, clone II and other orthopoxviruses were designed at this position, wherein the probe sequence for monkey pox virus clone I was 5'CY5-TCGTCGGAACTGTACACCATAGTAC-3' BHQ2, the probe sequence for monkey pox virus clone II was 5'FAM-TCGTTGGAGCTGTAAACCATAGCAC-3' BHQ1, and the probe sequence for other orthopoxviruses was 5 'HEX-TCGTCGGAGCTGTACATAGCAC-3' BHQ1. At the position of the reference genome 46313-46339 upstream of the probe, the forward primer sequence conserved by both the monkeypox virus and other orthopoxviruses was designed to be 5. The reverse primer sequence designed to be conserved in monkeypox virus and other orthopoxviruses at the position of reference genomes 46467-46491 downstream of the probe was 5. In one system, a forward primer, a reverse primer and three probes are added simultaneously, so that different monkeypox virus types or other orthopoxviruses can be detected and distinguished.

FIG. 1 is a schematic diagram showing the sequence alignment of amplified target regions of monkeypox viruses clade I, clade II and other orthopoxviruses; the sequence of the MPXV _ UK _ P2 strain is the reference genomic sequence. The nucleotide positions of the reference genomic amplification target region on the whole genome sequence are shown in FIG. 1. The "dots" in the figure represent the same nucleotides as the reference genomic sequence, and the mutations are labeled "a", "T", "C", or "G". Arrows indicate the direction and sequence of the upstream primer, downstream primer and Taqman probe. As can be seen from FIG. 1, the upstream and downstream primers were designed in regions where both the monkeypox virus and other orthopoxvirus sequences are conserved. The probe sequences designed for simian pox viruses clone I and clone II differ by 4 contiguous nucleotides, while the probe sequences designed for other orthopoxviruses differ by two nucleotides from each of simian pox virus clone I and clone II.

Example 2: multiplex fluorescent quantitative PCR amplification detection and differentiation of different types of monkeypox and other orthopoxviruses

This example uses the probe sequence of the monkeypox virus clone I of example 1:5'

CY5-TCGTCGGAACTGTACACCATAGTAC-3' BHQ2; probe sequence for monkeypox virus clade II: 5 'FAM-TCGTTGGAGCTGTAACCATAGCAC-3' BHQ1; probe sequences for other orthopoxviruses: 5 'HEX-TCGTCGGAGCTGTACACATAGCAC-3' BHQ1. Monkey pox virus and other orthopoxviruses are conserved forward primer sequences: 5 'ATCCTCTCTCTCATTGATTTTTTTCGCGGGA-3'. Reverse primer sequences conserved for both monkeypox virus and other orthopoxviruses: 5 'TGGAGAAGCGAGAAGTTAATAAAGC-3'.

A20. Mu.L reaction system for PCR reaction included 10. Mu.L of 2 XTAQA Pro U + Probe qPCR Mix, 0.4. Mu.L of upstream primer (primer concentration 10. Mu.M), 0.4. Mu.L of downstream primer (primer concentration 10. Mu.M), 0.4. Mu.L of monkeypox virus Congo strain Probe (Probe concentration 10. Mu.M), 0.1. Mu.L of monkeypox virus West African strain Probe (Probe concentration 10. Mu.M), 0.4. Mu.L of other orthopoxvirus Probe (Probe concentration 10. Mu.M), 2. Mu.L of template DNA, 6.3. Mu.L of sterile enzyme-free water. The PCR program included: 2min at 37 ℃ (digestion contaminated), 30s at 95 ℃ (pre-denaturation), 95 ℃ for 10s at 45 cycles, and 30s at 60 ℃ (cycling reaction). The FAM, CY5 and HEX channels are opened simultaneously. And (4) judging the standard: if the FAM channel has an amplification curve, the template is a simipoxvirus West Africa strain; if the CY5 channel has an amplification curve, the template is a monkeypox virus congo strain; if the HEX channel has an amplification curve, the template is other orthopoxviruses which are not monkeypox viruses.

FIG. 2 shows the specificity verification of multiplex fluorescent quantitative PCR reaction; amplification curves when different types of templates are put in; the 5' ends of the three probes designed according to FIG. 1 carry the fluorescence of FAM, CY5 or HEX, respectively. Wherein, A is an amplification curve when different copy numbers of West African strain plasmids with gradient dilution are added; b is an amplification curve when different copy numbers of Congo strain plasmids which are diluted in a gradient manner are added; c is an amplification curve when an orthopoxvirus nucleic acid represented by a vaccinia virus Tiantan strain nucleic acid is put; d is an amplification curve when nucleic acid of a case infected with a simipoxvirus west Africa strain in Africa region is administered; the result shows that when the West African strain plasmid template is put into the kit, only the FAM channel has an amplification curve, and the other two channels have no amplification curves; when the congo strain plasmid template is put into the device, only the CY5 channel has an amplification curve, and the other two channels have no amplification curves; when the vaccinia virus Tiantan strain nucleic acid is put into the device, only the HEX channel has an amplification curve, and the other two channels have no amplification curves; when the simian pox virus west nonbranch nucleic acid is put into infection, only the FAM channel has an amplification curve, and the other two channels have no amplification curves. The results demonstrate the good specificity of this experiment.

The multiplex fluorescent quantitative PCR results for two cases a and b of true infection with simian pox virus west african strain are shown in table 1, which lists the cycling thresholds for the three fluorescent channels. The types of specimens tested in case a were herpes fluid, oropharyngeal swab, nasopharyngeal swab and whole blood; the sample type for case b was serum. As can be seen from Table 1, only the FAM channel had an amplification curve and a cycle threshold, while the remaining two channels were negative, confirming the specificity and usability of the invention.

TABLE 1 multiplex fluorescent quantitation PCR results for two cases a and b of true infection of Simplepox Virus West African Strain

Type of sample	FAM	CY5	HEX
				Herpes liquid a	22.39	negative	negative
Oropharynx swab a	29.46	negative	negative
				Nasopharyngeal swab a	34.09	negative	negative
Whole blood a	35.45	negative	negative
				Serum b	31.95	negative	negative

Example 3: multiplex fluorescent quantitative PCR minimum detection limit determination

This example uses the probe sequence of the monkeypox virus clone I of example 1: 5'CY5-TCGTCGGAACTGTACACCATAGTAC-3' BHQ2; probe sequence for monkeypox virus clade II: 5 'FAM-TCGTTGGAGCTGTAACCATAGCAC-3' BHQ1; probe sequences for other orthopoxviruses: 5 'HEX-TCGTCGGAGCTGTACACATAGCAC-3' BHQ1. Forward primer sequences conserved for both monkeypox virus and other orthopoxviruses: 5 'ATCCTCTCTCTCATTGATTTTTTTCGCGGGA-3'. Monkeypox virus and other orthopoxviruses conserved reverse primer sequences: 5 'TGGAGAAGCGAGAAGTTAATAAAGC-3'.

3.1 plasmid construction, amplification and extraction

Synthesizing the sequence gene amplified by the upstream and downstream primers of the fluorescent quantitative PCR, constructing the sequence gene on a plasmid PUC57 vector, then transforming the sequence gene by E.coli DH5 alpha competent cells, coating a flat plate, selecting a single clone and amplifying a large amount of sequences. Extracting plasmid with endotoxin-free plasmid macroextraction kit, packaging, and freezing at-20 deg.C.

3.2 plasmid or Virus dilution

Extracting the packaged plasmid, and measuring DNA concentration with nanodrop according to formulaThe copy number was calculated as/ml (copy number) = (6.02x 10 (23) copies/mole) x (concentration)/(MW g/mol). Wherein the plasmid concentration of the monkeypox virus clade I is 638 ng/. Mu.L, and the converted copy number is 1.83 multiplied by 10 ¹¹ copies/. Mu.L. The plasmid was diluted sequentially by 10-fold gradient to 1.83X 10 ¹ In this case, 2-fold dilutions were performed, with the copy number corresponding to the highest dilution being 4.575 copies/. Mu.L. The plasmid copy number of the multiple fluorescent quantitative PCR experiment is 1.83 multiplied by 10 ⁹ copies/μL，1.83×10 ⁸ copies/μL，1.83×10 ⁷ copies/μL...1.83×10 ¹ Copies/. Mu.L, 9.15, 4.575 Copies/. Mu.L for 11 gradients. The plasmid concentration of the monkeypox virus clade II was 413.5 ng/. Mu.L, and the copy number was 1.19X 10 ¹¹ copies/. Mu.L. The plasmid was sequentially diluted 10-fold by gradient to 1.19X 10 ¹ In this case, 2-fold dilutions were performed, with the highest dilution corresponding to a copy number of 2.975 copies/. Mu.L. The plasmid copy number of the multiple fluorescent quantitative PCR experiment is 1.19 multiplied by 10 ⁹ copies/μL，1.19×10 ⁸ copies/μL，1.19×10 ⁷ copies/μL...1.19×10 ¹ Copies/. Mu.L, 5.95 coppies/. Mu.L, 2.975 coppies/. Mu.L for a total of 11 gradients. The titer is 8.6X 10 ⁸ PFU/ml vaccinia virus Tiantan strain to extract nucleic acid, and the nucleic acid is diluted sequentially by 10 times or 2 times. The virus titer of the multiplex fluorescent quantitative PCR experiment is 8.6 multiplied by 10 ⁸ PFU/ml，8.6×10 ⁷ PFU/ml，8.6×10 ⁶ PFU/ml...8.6×10 ² PFU/ml，430PFU/ml，215PFU/ml。

3.3 multiplex fluorescent quantitative PCR

The plasmid DNA diluted in concentration gradient was used as template for PCR amplification, three duplicate wells were made for each concentration, and multiplex fluorescence quantitative PCR was performed according to the method and procedure in example 2 to obtain amplification curves and cycle thresholds for different fluorescence channels.

3.4 minimum detection Limit determination

Fitting the copy number corresponding to plasmids with different dilution concentration gradients to a linear regression equation with a cycle threshold, calculating the slope and intercept, and the correlation coefficient R ² . The copy number corresponding to the highest dilution conversion of the amplification curve and the cycle threshold of all three multiple wells is the lowest copy number of the channelAnd (4) detection limit. For simian pox virus clade I, when the plasmid copy number is 1.83X 10 ² Since copies/. Mu.L can be detected in all three replicate wells and not all replicate wells can be detected in high dilution, the lowest detection limit of the simian pox virus clade I is 183 copies/. Mu.L. For simian pox virus clade II, when the plasmid copy number is 1.19X 10 ² Since copies/. Mu.L can be detected in all three replicate wells and not all replicate wells can be detected in high dilution, the lowest detection limit of the simian pox virus clade I is 119 copies/. Mu.L. For other vaccinia virus Tiantan strains of orthopoxvirus but not monkeypox virus, when the virus titer is 8.6X 10 ³ PFU/ml, three replicates were detected and all three replicates at high dilution were not detected, thus the minimum detection limit for other orthopoxviruses other than monkeypox was 8.6X 10 ³ PFU/ml。

FIG. 3 is a sensitivity validation of multiplex fluorescent quantitative PCR reactions; the coordinates of the standard curves of different branched plasmids of the monkeypox virus and the vaccinia virus are logarithmic values of copy numbers of different dilution gradient plasmids or logarithmic values of titer of the vaccinia virus, and the ordinate is a cycle threshold of the fluorescent quantitative PCR; the linear regression equation and R are also shown ² . A is the standard curve of different dilutions of monkeypox west non-branched plasmids; b is a standard curve of the monkeypox congo branched plasmids with different dilutions; c is a standard curve of vaccinia virus with different dilutions; the results showed that the lower limit of detection of the simipox west non-branched plasmid was 119 copies/. Mu.L, the lower limit of detection of the simipox Congo strain plasmid was 183 copies/. Mu.L, and the lower limit of detection of the vaccinia virus was 8.6X 10 ³ PFU/mL。

Example 4: digital PCR minimum detection limit determination

CY5-TCGTCGGAACTGTACACCATAGTAC-3' BHQ2; probe sequence for monkeypox virus clade II: 5 'FAM-TCGTTGGAGCTGTAACCATAGCAC-3' BHQ1; probe sequences for other orthopoxviruses: 5 'HEX-TCGTCGGAGCTGTACACATAGCAC-3' BHQ1. Forward primer sequences conserved for both monkeypox virus and other orthopoxviruses: 5 'ATCCTCTCTCTCATTGATTTTTTTCGCGGGA-3'. Reverse primer sequences conserved for both monkeypox virus and other orthopoxviruses: 5 'TGGAGAAGCGAGAAGTTAATAAAGC-3'.

The West African strain plasmid and Congo strain plasmid constructed in the embodiment 3 are diluted by 10 times or 2 times and then are configured according to the following system: the reaction system included 12. Mu.L of 2 XDPCR probe Master mix, 1. Mu.L of forward primer (primer concentration 10. Mu.M), 1. Mu.L of reverse primer (primer concentration 10. Mu.M), 0.5. Mu.L of Simplex monkey pox virus probe (probe concentration 10. Mu.M), 0.5. Mu.L of West African monkey pox virus probe (probe concentration 10. Mu.M), 0.5. Mu.L of other orthopoxvirus probe (probe concentration 10. Mu.M), 5. Mu.L of template DNA, 1.5. Mu.L of sterile enzyme-free water. The PCR program included: 60 ℃ for 5min,95 ℃ for 15min,45 cycles for 95 ℃ for 15s,60 ℃ for 30s,60 ℃ for 1min. The copy number detected in all three multiple wells is the final lowest detection limit.

TABLE 2 Hemopsis Macaca strain plasmid digital PCR quantitation results

(Note: wherein N/A represents a null value)

TABLE 3 monkey pox West African plasmid digital PCR quantitation results

(Note: wherein N/A represents a null value)

TABLE 4 vaccinia virus Tiantan strain (other orthopoxvirus nucleic acids) digital PCR quantitation results

(Note: wherein N/A represents a null value)

As shown in Table 2, when Congo strain plasmids were introduced at successively lower concentrations, the copy number of CY5 channel gradually decreased, and the minimum detection limit was 0.484 copies/. Mu.L. As shown in Table 3, when West African plasmid strains with successively lower concentrations were introduced, the copy number of the FAM channel gradually decreased, and the minimum detection limit was 0.352 copy number/. Mu.L. As shown in Table 4, when TTV nucleic acids were introduced at successively lower concentrations, the copy number of the HEX channel gradually decreased, and the minimum detection limit was 0.352 copy number/. Mu.L. Compared with the detection method in the prior art, the digital PCR method greatly reduces the lower limit of detection and greatly improves the sensitivity.

Although the present invention has been described to a certain extent, it is apparent that appropriate changes in the respective conditions may be made without departing from the spirit and scope of the present invention. It will be understood that the invention is not limited to the described embodiments, but rather, to be included within the scope of the claims, including equivalents of each element described.

Claims

1. A method for detecting and differentiating orthopoxviruses for non-diagnostic purposes, comprising the steps of:

(3) Detecting and distinguishing the orthopoxvirus by a digital PCR method;

2. The method of claim 1, wherein: in the step (2), the dilution factor of the plasmid constructed in the step (1) is selected from one or more of the following factors: 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, more preferably selected from one or more of the following: 2 times, 5 times, 10 times, and more preferably 10 times or 2 times.

3. The method according to claim 1 or 2, wherein in step (3): the digital PCR method comprises: 3-10min at 50-80 ℃, 12-20min at 80-100 ℃, 5-15s at 80-100 ℃, 30-45 cycles at 50-80 ℃ and 50-80 ℃ for 50-70 s, preferably comprising the following steps: 4-8min at 50-70 ℃, 12-18min at 90-100 ℃, 10-15s at 90-100 ℃, 25-35s at 50-70 ℃ for 30-45 cycles, 55-65 s at 50-70 ℃, and the most preferable cycle comprises: 60 ℃ for 5min,95 ℃ for 15min,95 ℃ for 15s,60 ℃ for 30s for 45 cycles, 60 ℃ for 1min.

4. An apparatus for detecting and distinguishing orthopoxviruses, the apparatus comprising:

(A) A primer synthesis and plasmid construction mechanism;

(B) A reaction system configuration mechanism; and

(C) A digital PCR analysis mechanism;

5. The method according to any one of claims 1 to 3 or the apparatus according to claim 4, characterized in that: the vector of the plasmid is selected from one or more of the following: a PUC57 vector, a PBR332 vector, a PUC18 vector, a PUC19 vector, PGEM-T, preferably selected from one or more of the following: a PUC57 vector, a PUC18 vector, a PUC19 vector, and most preferably a PUC57 vector.

6. The method or device of any one of claims 1 to 5, wherein the probe comprises: a simian pox virus cladeI probe, a simian pox virus clade II probe, and at least one other orthopoxvirus probe;

preferably, the sequence of the monkeypox virus cladeI probe is shown in SEQ ID NO. 3;

7. The method or apparatus of any one of claims 1 to 6, wherein the dPCR probe Master mix comprises: dPCR reaction buffer, taq polymerase, amperase, dATP, dCTP, dGTP, dTTP, dUTP and sodium azide; and/or

The sequence of the template DNA is shown as SEQ ID NO. 6 and/or SEQ ID NO. 7.

8. The method or apparatus of any of claims 1 to 7, wherein:

the ratio of the simian pox virus cladeI probe, the simian pox virus cladeI probe and the other orthopoxvirus probes is 1:1:1; and/or

9. Use of a device according to any one of claims 4 to 8 for the preparation of a medical product for detecting and differentiating orthopoxviruses.

10. The method, device or use according to any one of claims 1 to 9 wherein the orthopoxvirus is a monkeypox virus, preferably a monkeypox virus west african strain and/or a monkeypox virus congo strain.