CN115976053B - Duck grass gene related to drought stress and application thereof - Google Patents

Abstract

The invention discloses a drought stress related cogongrass gene and application thereof, wherein the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. After research, the expression level of the gene is reduced after the drought stress of the festuca arundinacea is given. The gene is over-expressed in yeast and arabidopsis, and the tolerance of the yeast and the arabidopsis to drought stress is reduced, so that the expression quantity of the gene is inversely related to the drought stress, and the inversely related characteristic can be used for preparing the high-drought stress-resistant festuca arundinacea, so that the development and the utilization of high-quality gramineous forage grass festuca arundinacea can be promoted, and the development and the utilization of traditional forage grass can be remarkably contributed.

Description

Duck grass gene related to drought stress and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a cogongrass gene related to drought stress and application thereof.

Background

The festuca arundinacea belongs to the Poaceae (Poaceae) Poaceae (Festucoideae) festuca (Dactylis) and is a perennial cold season type cluster pasture widely cultivated worldwide. The festuca arundinacea has the advantages of high yield of leaves, yin resistance, strong adaptability, good palatability, high nutritive value and the like, can be used for green feeding, hay preparation or silage, is one of gramineous pastures widely distributed in the world, and is produced for about 14000t festuca arundinacea seeds worldwide each year, and accounting for 3.3% of the pastures in the world. Currently, about 40% of the world suffers from drought stress. The growth process of the festuca arundinacea shows biological characteristics of drought intolerance, and researches related to drought stress tolerance of the festuca arundinacea are less, and the traditional pasture improvement technology is slow in effect and long in period, so that the application of the traditional pasture improvement technology in production is severely limited, and therefore an effective method is urgently needed to be provided, and duck Mao Zhu lines with high drought stress resistance can be prepared and screened out, so that the purposes of shortening breeding time and improving breeding efficiency are achieved, and development and utilization of high-quality pasture festuca arundinacea are further promoted.

Disclosure of Invention

The invention aims to provide a drought stress-related duck Mao Jiyin, the expression quantity of which is inversely related to drought stress, and the gene can be used for preparing the high drought stress-resistant cogongrass by the characteristics of the negative correlation, so that the problem of poor drought tolerance of the cogongrass can be solved, the development and the utilization of high-quality gramineous forage grass cogongrass can be promoted, the development and the utilization of traditional forage grass can be remarkably contributed, and the application value is remarkable.

In order to achieve the aim, the invention provides a drought stress related duck Mao Jiyin, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

The invention also provides a protein encoded by the drought stress related cogongrass gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

The invention also provides a recombinant vector containing the nucleotide sequence of the cogongrass gene.

The invention also provides a recombinant engineering bacterium containing the recombinant vector.

The drought stress related cogongrass gene provided by the invention can be used for the yeast drought stress tolerance, especially can be used for improving the yeast drought stress tolerance and preparing the yeast with strong drought stress tolerance.

The drought stress related cogongrass gene provided by the invention can be used for the drought stress resistance of arabidopsis thaliana, and can be particularly used for improving the drought stress tolerance of arabidopsis thaliana and preparing arabidopsis thaliana with strong drought stress tolerance.

The drought stress related cogongrass gene provided by the invention can be used for the drought stress resistance of cogongrass, and particularly can be used for preparing a duck Mao Zhu line with enhanced drought stress tolerance.

The drought stress related cogongrass gene and the application thereof solve the problem of poor drought tolerance of cogongrass and have the following advantages:

The gene provided by the invention shows negative regulation on drought resistance, which suggests that the gene knockout technology can be utilized to reduce the expression quantity of the gene in the festuca arundinacea so as to improve the drought resistance of the festuca arundinacea. For the defects of slow effect and long period of the traditional pasture improvement technology, the method can shorten the breeding time, improve the breeding efficiency, promote the development and utilization of high-quality gramineous pasture festuca arundinacea, and has remarkable application value.

Drawings

FIG. 1 shows an amplification electrophoresis of gene DG7C04019.1 in the present invention.

FIG. 2 shows the result of expression of gene DG7C04019.1 of the present invention under drought stress.

FIG. 3 shows the results of drought stress tolerance of yeast overexpressing DG7C04019.1 in the present invention.

FIG. 4 shows the results of Arabidopsis thaliana identification over-expressed DG7C04019.1 in the present invention.

FIG. 5 shows germination of Arabidopsis thaliana overexpressed DG7C04019.1 under drought stress according to the present invention.

FIG. 6 shows the germination rate statistics of Arabidopsis thaliana overexpressing DG7C04019.1 according to the present invention.

FIG. 7 shows root length variation of Arabidopsis thaliana overexpressed DG7C04019.1 under drought stress according to the present invention.

FIG. 8 is a statistical quantification of root length of Arabidopsis thaliana overexpressed DG7C04019.1 under drought stress according to the present invention.

FIG. 9 shows the results of comparison of dehydration experiments and detection of related indicators for over-expression DG7C04019.1 of the present invention and wild-type Arabidopsis.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Description: the reagent consumables specifically described in the experiment are all conventional reagent consumables, and the methods not specifically described are all conventional operation methods in the field.

Example 1

1. Gene cloning

1.1 Gene extraction

The material selected by the invention is the festuca arundinacea variety 2006-1, which is planted in Wenjiang school district of Sichuan agricultural university. Taking tender leaves as materials to extract total RNA. The total RNA extraction kit of plant of Tiangen (Beijing) Biochemical technology Co., ltd is selected for RNA extraction, and the operation is carried out by referring to the attached instruction book. After RNA extraction, integrity was checked by 1% agarose gel electrophoresis, and RNA concentration and purity were determined using an ultra-micro spectrophotometer. The reverse transcription was carried out using PRIMESCRIPT II A st Strand cDNA Synthesis Kit from TaKaRa, incorporated by reference.

1.2 Amplification of fragments of interest

The genomic cDNA obtained by inversion in 1.1 was used as a template, amplified by a primer set shown below using a vazyme company 2X Phanta Max MasterMix (Dye Plus) kit, and the procedure was as described in the accompanying specification:

The primers used are as follows (5 '. Fwdarw.3'):

F(SEQ ID NO.3)：ATGGCGCCGCCACAGGAA；

R(SEQ ID NO.4)：CTATTTCTGATTCTTGCTCTTCTCGG。

The amplification system was 50. Mu.L, containing 25. Mu.L of 2X PhantaMax MasterMix (Dye Plus), 2. Mu.L of upstream and downstream primers (10. Mu.M), 4. Mu.L of cDNA template, 17. Mu.L of ddH ₂ O.

The amplification procedure is as follows:

Pre-denaturation at 95℃for 3min;

denaturation at 95℃for 15s, annealing at 55℃for 15s, extension at 72℃for 1min (35 cycles);

extending at 72℃for 5min.

1.3 Recovery and sequencing of the Gene of interest

The amplified products were electrophoresed and recovered, and an appropriate amount of 10 Xloading buffer was added to each reaction tube, followed by electrophoresis on a 2% agarose gel. Electrophoresis was performed in 0.5 XTBE buffer at 5-10V/cm, and the electrophoresis was terminated, and the result was photographed in a gel imaging system as shown in FIG. 1, in which lane M is DNALADDER. Lanes 1-5 are five PCR repeated electrophoresis samples, respectively, and the banding result shows that the size of the gene is about 750 bp.

The target band in FIG. 1 was recovered using GK2042 (JieRui organism) agarose gel DNA recovery kit, and the specific steps are as follows:

1) Carefully cutting the DNA target strip, and placing the DNA target strip into a 1.5mLEP pipe;

2) 400. Mu.L of binding B was added to the tube and placed in a 70℃water bath until the gel was completely dissolved;

3) 100. Mu.L of isopropanol was added to the tube, left at room temperature for 1 minute, centrifuged at 5000rpm for 1 minute and passed through the column;

4) Repeating the step 3 once;

5) Washing was performed twice with 500. Mu. Lwashbuffer 12000/12000 rmp and centrifuged at 10000rmp for 1 min.

6) 40. Mu.L of double distilled water was added to the column, left at 37℃for 2 minutes, and collected by centrifugation at 12000rmp for 1 minute.

The recovered gene was subjected to sequencing, and the nucleotide sequence of the gene was shown below, the amino acid sequence thereof was shown below, and the gene was designated DG7C04019.1.

The nucleotide sequence is shown as SEQ ID NO.1 (5 '. Fwdarw.3'):

ATGGCGCCGCCACAGGAACGGGACTACATCGGGCTGTCGCCGGCGGCGGCGGCAGCCACGGAGTTGCGCTTGGGGCTACCTGGCACGGAGGCTGCTGAGGTGGAGGGCGGTGGAGCGGCGGCGCCGTTGACGCTGGAGCTTCTTTCAAAGGGCGGAGCCAAACGCGGGTTTGCCGGCGCAGCGGGAGGCAAGGCGGTGGCGGAGGAGCAGGAGGACGACGAGAAGAAGAAGGCGCAAGCGCCGGCCGCAAAGGCACAGGTGGTAGGATGGCCACCAATCCGCAGTTACAGGAAGAACACCATGGCAACGAACCTATCTGCTCCGAGAAGCAAAGACGAGGTCGAGGCAAAGCAGGCGCCAGTGCAAGGGTGCCTTTATGTCAAGGTTAGTATGGATGGTGCGCCTTACCTCAGGAAGGTGGATCTTAAGATGTACAAGAACTACAAGGACCTCTCTCTGGAGCTGGAGAAGAAGTTCAGCTGCTTTACTGTTGGTCATGGTGAATCAAATGGTAAATCAGGAAGAGATGGCTTATCTGATTGCCGACTGATGGATCTTAAAAGCGGAGCTGAACTTGTGCTCACTTATGAGGACAAGGATGGCGATTGGATGCTTGTTGGTGATGTTCCATGGCGAATGTTCACAGACAGCTGTAGGAGGATGAGGATCATGAAGGGGTCAGATGCAGTGGGCCTTGCTCCGAGAGCCACCGAGAAGAGCAAGAATCAGAAATAG.

The amino acid sequence is shown as SEQ ID NO.2:

MAPPQERDYIGLSPAAAAATELRLGLPGTEAAEVEGGGAAAPLTLELLSKGGAKRGFAGAAGGKAVAEEQEDDEKKKAQAPAAKAQVVGWPPIRSYRKNTMATNLSAPRSKDEVEAKQAPVQGCLYVKVSMDGAPYLRKVDLKMYKNYKDLSLELEKKFSCFTVGHGESNGKSGRDGLSDCRLMDLKSGAELVLTYEDKDGDWMLVGDVPWRMFTDSCRRMRIMKGSDAVGLAPRATEKSKNQK.

2. Functional analysis

2.1 Duck grass stress treatment

To verify the expression trend of gene DG7C04019.1 under drought conditions, the Duck grass variety "2006-1" was selected for sand culture in 16h (23 ℃) day/8 h (18 ℃) darkness. And (3) carrying out 20% polyethylene glycol treatment (PEG 6000) when the festuca arundinacea seedlings grow to 3-4 leaf stages, taking leaf samples at 0h, 2h, 4h and 8h respectively, rapidly putting the leaf samples into liquid nitrogen for freezing, and taking 3 repeats of each sample.

RNA extraction and reverse transcription were performed on the treated samples, and RNA and reverse transcription were tested as described above. Fluorescence quantification was performed using Bio-RAD CFX Connet from Bio-RAD, USA, and the quantification kit was chosen to be MonAmpTM from Primeirnmic science and technology (Beijing)GREEN QPCR Mix (None ROX). The fluorescent quantitative primers are as follows (5 '. Fwdarw.3'):

DG7C04019.1-F(SEQ ID NO.5)：GCTCCGAGAAGCAAAGACGA；

DG7C04019.1-R(SEQ ID NO.6)：GCTCCAGAGAGAGGTCCTTG。

The expression level of the gene was calculated by the 2 ^-ΔΔCT method using β -action as an internal reference gene and the internal reference primer as shown below. The quantitative results are shown in fig. 2, which shows that DG7C04019.1 has lower expression level in 20% peg6000 simulated drought stress.

Actin-F(SEQ ID NO.7)：TCACGAAGCGACATACAACT；

Actin-R(SEQ ID NO.8)：TCCACTGAGAACAACATTACC。

2.2 Yeast expression verification

To preliminarily identify DG7C04019.1 functions, a DG7C04019.1 fragment of the pre-clone was selected, a pYES2 yeast vector was ligated, hind III and Xba I were selected as cleavage sites, and PCR was performed to ligate homology arms containing the cleavage sites, and amplification primers containing homology arms were as follows (5 '. Fwdarw.3'):

pYES2-DG7C04019.1-F(SEQ ID NO.9)：

ctatagggaatattaagcttATGGCGCCGCCACAGGAA；

pYES2-DG7C04019.1-R(SEQ ID NO.10)：

acatgatgcggccctctagaTTTCTGATTCTTGCTCTTCTCGG。

And adopting a ClonExpress Ultra One Step Cloning kit kit of vazyme organism (Nanjing) to connect the DG7C04019.1 gene connected with the homology arm and the linearized (double-enzyme-cut) pYES2 yeast vector to construct the over-expression recombinant vector plasmid pYES2-DG7C04019.1. The recombinant vector plasmid was transferred into a Saccharomyces cerevisiae strain (INVScI, MATA his 3.DELTA.1leu2 trp1-289 ura3-52/MAT alpha his 3.DELTA.1leu2 trp1-289 ura 3-52) by CARRIERDNA (Coolaber, china) with the empty pYES2 vector plasmid as a control. The transformed yeast is coated on SD-Ura culture medium, cultured for 48-72 h at 28 ℃, monoclonal is selected for PCR, and the primers are universal primers with the sequences shown as follows (5 '. Fwdarw.3'):

pYES2-F(SEQ ID NO.11)：AATATACCTCTATACTTTAACGTC；

pYES2-R(SEQ ID NO.12)：GCGTGAATGTAAGCGTGAC。

Amplified products were sequenced for verification, and positive colony transformed yeasts identified correctly were selected and cultured in liquid SD-Ura medium containing 2% galactose, centrifuged at 150rpm and diluted at a multiple of 10. The diluted yeast suspensions were plated on YPG media containing 0M, 1.5M and 2.5M sorbitol (Sorbitol) and incubated at 28 ℃. The results are shown in FIG. 3, which shows that DG7C04019.1 gene overexpression can reduce the tolerance of yeast to drought stress.

2.3 Functional verification in Arabidopsis thaliana

2.3.1 Construction of the overexpression vector

Kpn I/Xba I is used as an insertion site and an amplification primer is synthesized according to the map design of the vector pCAMBIA1300-35S, and the specific sequence is as follows (5 '. Fwdarw.3'):

DG7C04019.1-pCAMBIA1300-35S-F(SEQ ID NO.13)：

acgggggacgagctcggtaccATGGCGCCGCCACAGGAA；

DG7C04019.1-pCAMBIA1300-35S-R(SEQ ID NO.14)：

acgtaacatgtcgactctagaTTTCTGATTCTTGCTCTTCTCGG。

And (3) taking the DG7C04019.1-purpose fragment in the above 1.3 as a template, carrying out PCR reaction to obtain a homologous arm gene containing pCAMBIA1300-35S enzyme cutting sites, and recovering the correct PCR fragment.

Simultaneously, the vector pCAMBIA1300-35S plasmid is subjected to double digestion with Kpn I/Xba I:

40. Mu.L enzyme digestion system: mu.L of plasmid, 4. Mu.L of 10 Xrestriction buffer, 4. Mu.L of 10 XBSA, and 1. Mu.L of each of the two restriction enzymes were treated in a water bath at 37℃for about 1 hour.

The PCR amplified fragment is recovered by agarose gel, then mixed with the double enzyme digestion recovered empty vector, and connected with EasyGenoDNA recombinant system (#VI 201-02, tiangen organism), 10 mu L recombinant system is: mu.L of 2X EasyGenoAssemblyMix, 2.5. Mu.L of digested vector DNA, 2.5. Mu.L of DNA fragment.

The reaction system is added into a 250 mu L EP tube, the E.coli coated plate is transformed after being put into a water bath at 50 ℃ for 30 minutes, the bacteria are picked up after being put into an incubator at 37 ℃ for 16 hours, the sequencing is carried out, and the recombinant vector plasmid extracted correctly after the sequencing is put into a-20 ℃ for long-term storage.

2.3.2 Arabidopsis transformation

(1) Agrobacterium transformation: the competent GV3101 was removed in a refrigerator at-80℃and thawed on ice for 3min, 4. Mu.L of the recombinant plasmid of correct sequence in 2.3.1 was added and left on ice for 5min. The EP tube was placed in liquid nitrogen for quick freezing for 1min, water bath at 37℃for 5min, ice bath for 2min, 800. Mu.L of liquid LB medium without resistance was added, and the culture was carried out for 3h at 28℃with shaking table at 150 rpm/min. Centrifugation at 8000rpm/min for 1min, removal of 600. Mu.L of supernatant, suspension, plating onto solid LB medium (containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL rifampicin), and culturing in 28℃incubator upside down for 48h. Monoclonal was picked and identified by PCR using the vector universal primer, the universal primer sequence being as follows (5 '→3'):

pCAMBIA1300-F(SEQ ID NO.15)：CTATCCTTCGCAAGACCCTTC；

pCAMBIA1300-R(SEQ ID NO.16)：CGCGATCCAGACTGAATGC。

(2) Planting arabidopsis thaliana: wild type Arabidopsis thaliana (Col-0) was sterilized with 70% ethanol and 3% sodium hypochlorite, and the sterilized Arabidopsis thaliana was plated on a 1/2MS medium.

(3) Transplanting: transplanting the seedlings of the wild arabidopsis into soil after the seedlings grow to the four-leaf stage, and selecting flowerpots with the diameter of 9cm, wherein 2-3 seedlings are planted in each flowerpot. Culturing transferred Arabidopsis thaliana in Arabidopsis thaliana growth chamber with illumination intensity of 2000-3000lx, illumination time of 14h/day and humidity of 40-60%.

(4) Removing the top: the plants are irrigated by Hoagland nutrient solution at fixed time, buds are cut off and wait for infection when the arabidopsis is flowering for the first time, and watering is carried out the day before the infection to enable the arabidopsis to fully absorb water.

(5) Preparing a soaking dye solution: agrobacterium was resuspended in a 1/2MS solution containing 5% sucrose to a final OD ₆₀₀ of 0.8 and surfactant silwet-77 (0.05%) was added and well grown Arabidopsis was selected for infestation.

(6) Dip dyeing: the flower surface portion of Arabidopsis thaliana was immersed in the Agrobacterium suspension for about 15s, and the invader solution was gently swirled.

(7) Dark culture: and (5) bagging the plant subjected to dip dyeing, and culturing for 16-24h in a dark room with a high humidity state.

(8) Culturing after dip dyeing: watering every other day to ensure sufficient water.

(9) Seed collection: the seeds are ripe, and the seeds can be harvested after the fruits are naturally cracked.

(10) Transgenic seed selection: the seed obtained after the dip-dyeing was cultured on a plate containing hygromycin (25. Mu.g/mL). After about 1 week, the growth condition of Arabidopsis thaliana is observed, and positive seedlings can grow normally without being affected by hygromycin. Therefore, whether the transgenic positive seeds are the transgenic positive seeds or not is judged according to the growth condition of the arabidopsis thaliana.

(11) Cultivation of transgenic plants: after germination on the plates for 2 weeks, the positive plants were transferred to soil for further culture.

(12) And (3) verifying the expression quantity of the T3 generation homozygous strain: after the T3 generation transgenic plant grows to 3 weeks, RNA extraction is carried out, DG7C04019.1 gene expression levels of 3 homozygous line positive seedlings (OE 1, OE2 and OE 3) are verified, the result is shown in figure 4, and the result shows that the expression level of the over-expression positive seedlings is much higher than that of the wild type, so that the three positive seedlings are plant seedlings with over-expression genes.

2.3.3 Drought resistance verification of Arabidopsis thaliana

(1) Germination test: the 3T 3 transgenic Arabidopsis lines obtained in 2.3.2 and the sterile seeds of wild type Arabidopsis were sown on 1/2MS medium containing 0mM, 200mM, 300mM, 400mM Mannitol (Mannitol), respectively. The mannitol can be used for simulating drought resistance tests of plants. Germination rates were calculated 10 days after seed sowing, 3 replicates per concentration treatment trial. The germination of seedlings is shown in FIG. 5, wherein a, b, c, d in the graph is the germination of plants at 0mM, 200mM, 300mM, 400mM mannitol, respectively, and the germination rate results are shown in FIG. 6, wherein the same two lower case letters indicate no significant change between the two data. The different two letters indicate a significant difference in data. The result shows that the germination rate of DG7C04019.1 gene over-expressed plants is lower than that of wild plants, especially when the plants are subjected to drought stress of 400mM mannitol, the germination rate of the plants is obviously reduced.

(2) Root length experiment: the T3 transgenic line and the wild type Arabidopsis were sown on 1/2MS medium for 7 days, and then transferred to 1/2MS medium containing 0mM, 200mM, 300mM, 400mM mannitol for 7 days to measure root length. Each concentration treatment test was performed in 3 replicates. The root length of seedlings is shown in FIG. 7, wherein a, b, c, d is the root length of plants at 0mM, 200mM, 300mM and 400mM mannitol, respectively, and the statistical quantitative result of root length is shown in FIG. 8. The result shows that the root length of DG7C04019.1 gene over-expressed plant is lower than that of wild type.

(3) Dehydration test: phenotype was observed for 3 weeks of overexpression and rehydration of wild-type arabidopsis for 4 days after 14 days of water loss. The phenotyping results are shown as a in fig. 9.

Meanwhile, the leaf water loss rate, relative water content, conductivity, MDA content, chlorophyll fluorescence and chlorophyll content were measured before the water loss treatment and at 10 days of water loss.

Water loss rate: and 6-10 leaves are taken and placed on weighing paper for weighing, the weighing is carried out once every 0.5 hour until the weighing is finished for 3 hours, and the weight of each weighing is recorded. Wherein the water loss rate = (weight before water loss-weight after water loss)/weight before water loss is 100%. The water loss results of the wild type Arabidopsis thaliana (Col-0) and the transgenic Arabidopsis thaliana (OE 1, OE2, OE 3) are shown in FIG. 9B, and it is understood that the water loss of the two other strains except OE3 is higher than that of the wild type strain.

Relative water content: fresh weight (freshweight, FM) of about 0.2g is weighed, the leaves are soaked in water for 5 to 6 hours, the leaves are fully saturated by water, and the water on the surfaces is removed for re-weighing (saturation weight, TM). And placing the leaves into an oven for de-enzyming at 105 ℃ for 30 minutes, and then adjusting 70 ℃ for drying to constant weight (DRY WEIGHT, DM), wherein the relative water content is 100 percent. Statistics of relative moisture content as shown in C of fig. 9, it was found that the relative moisture content of arabidopsis of the overexpressed gene was significantly lower than that of the wild-type under drought stress.

Conductivity: the fresh weight of the sample was about 0.1g, the sample was wiped clean, wrapped in paper, placed in a test tube, 20mL of deionized water was added to allow the sample to be fully immersed in water, and the initial conductivity S1 was measured after leaving the incubator at room temperature for 24 hours. The final conductivity S2 was then measured by boiling water bath for 15min, cooling to room temperature, wherein conductivity = S1/S2 x 100%. As shown in D in fig. 9, it was found that the conductivity of arabidopsis thaliana over-expressing the gene was significantly higher than that of the wild type under drought stress.

MDA content: the MDA content was measured by using an MDA detection kit from Biyun Tian, and the experimental method was carried out with reference to the built-in instructions, and the measurement results are shown as E in FIG. 9, and it was found that the MDA content of Arabidopsis with over-expressed genes was higher than that of the wild type under drought stress.

Chlorophyll fluorescence: chlorophyll fluorescence of plant leaves was measured using PocketPEA Chlorophyll fluorimeter apparatus and the measurement results are shown as F in fig. 9, where Fv/Fm ratio represents the potential maximum light and capacity of plants, and it was found that under drought stress potential the potential maximum light and capacity of arabidopsis overexpressing genes was lower than that of wild type.

Chlorophyll content: the test method was carried out by using a kit for detecting the chlorophyll (chlorophyll) content of plants from Soy Corp. As shown in G in FIG. 9, it was found that the total chlorophyll content of Arabidopsis thaliana over-expressed genes was lower than that of the wild type, both under normal and drought conditions.

Description: the same two lowercase letters in the figures indicate that there is no significant change between the two data. The different two letters indicate a significant difference in data.

According to the dehydration phenotype result and the detection result of a plurality of indexes, the DG7C04019.1 gene shows a negative regulation effect under drought stress, so that a theoretical basis is provided for knocking out the gene to improve drought resistance of the festuca arundinacea, and development and utilization of high-quality gramineous forage grass festuca arundinacea are promoted.

While the present invention has been described in detail through the foregoing description of the preferred embodiment, it should be understood that the foregoing description is not to be considered as limiting the invention. Many modifications and substitutions of the present invention will become apparent to those of ordinary skill in the art upon reading the foregoing. Accordingly, the scope of the invention should be limited only by the attached claims.

Claims (5)

1. The drought stress related duck Mao Jiyin is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

2. The protein encoded by the drought stress related cogongrass gene as set forth in claim 1, wherein the amino acid sequence of the protein is set forth in SEQ ID No. 2.

3. A recombinant vector comprising the nucleotide sequence of the cogongrass gene as set forth in claim 1.

4. A recombinant engineering bacterium comprising the recombinant vector according to claim 3.

5. The use of the cogongrass gene according to claim 1, wherein the cogongrass gene is overexpressed in yeast or arabidopsis to reduce the tolerance of the yeast or arabidopsis to drought stress.