CN115975814A

CN115975814A - Polyketide and preparation method and application thereof

Info

Publication number: CN115975814A
Application number: CN202211077335.4A
Authority: CN
Inventors: 罗奇; 程霞; 马佛培; 鲁贵湖
Original assignee: Southern Medical University
Current assignee: Southern Medical University
Priority date: 2022-09-02
Filing date: 2022-09-02
Publication date: 2023-04-18

Abstract

The invention discloses a polyketide and a preparation method and application thereof. The polyketide is separated from a fermentation product of Aspergillus fumigatus SMU01 in a Taiwan, wherein the Aspergillus taichungensis SMU01 in the Taiwan is preserved in Guangdong province microorganism culture collection with the preservation number of GDMCC NO:62752 and the preservation date of 2022, 08 months and 30 days. The polyketide of the scheme of the invention has the effects of promoting Th9 cell proliferation, increasing IFN-gamma and TNF-a secretion and increasing IL-9 expression, can be effectively used for enhancing the anti-tumor effect of Th9 cells, and has important value for development and application of anti-tumor drugs.

Description

Polyketide and preparation method and application thereof

Technical Field

The invention belongs to the technical field of medical compounds, and particularly relates to a polyketide and a preparation method and application thereof.

Background

CD4 ⁺ T helper cells play an important role in adoptive immunity by mediating cellular and humoral immunity. Except for the cooperative activation of CD8 with dendritic cells ⁺ T cells to kill pathogens or tumors directly, CD4 ⁺ T cells also activate macrophages to destroy pathogens in their vesicles. In addition, CD4 ⁺ T cells can promote B cell immunity and modulate antibody production by providing cytokines and costimulatory signals at the site of origin, facilitating the switching of antibody types. Recent studies have shown that CD4 ⁺ T cells also have cytotoxic capacity, suggesting that they may play a more direct role in pathogen and tumor clearance.

Th9 cells are newly defined CD4 ⁺ T cell subsets, secrete large amounts of interleukin-9 (IL-9). Compared with other Th subgroups, th9 cell has obvious antitumor effect besides auxiliary B cell and proinflammatory effect. It has been reported that CD4 ⁺ Th9 cells and CD8 ⁺ IL-9 production by Tc9 cells is critical in the clearance of tumors from IL-9 production. Research shows that Th9 cell has unique antitumor effect through killing late stage tumor and antigen losing tumor. Therefore, further enhancement of the antitumor effect of Th9 cells is a promising new strategy in cancer immunotherapy. The effective components with corresponding pharmacological effects are obtained by microbial fermentation, and the method has important value for development and application of antitumor drugs.

Disclosure of Invention

The present invention has been made to solve at least one of the above-mentioned problems occurring in the prior art. Therefore, the invention provides an aspergillus SMU01 strain in a Taizhong.

The invention also provides a product containing the strain.

The invention also provides a polyketide.

The invention also provides a preparation method of the polyketide.

The invention also provides the application of the bacterial strain, products containing the bacterial strain or the polyketide.

In one aspect of the invention, a strain is provided, wherein the strain is Aspergillus taishanensis (Aspergillus taichungensis) SMU01, which is deposited in the Guangdong province culture Collection of microorganisms with the deposit number of GDMCC NO:62752 and the deposit date of 2022, 08 months and 30 days.

In some embodiments of the invention, the aspergillus SMU01 in the stage is isolated from periplaneta americana bodies.

In some embodiments of the invention, the strain has the amino acid sequence of SEQ ID NO:1, or a sequence of ITS.

In a second aspect of the present invention, there is provided a product comprising at least one of (1) to (6):

(1) The above-mentioned strain;

(2) A microbial inoculum containing the strain;

(3) Viable bacteria solution containing the strain;

(4) A killed bacterial solution containing the strain;

(5) A metabolite containing the above strain;

(6) Contains extract of the above strain.

In some embodiments of the invention, the product is a pharmaceutical or a food product.

In some embodiments of the invention, the pharmaceutical product further comprises a pharmaceutically acceptable carrier and/or a pharmaceutically acceptable excipient.

In some embodiments of the invention, the pharmaceutically acceptable carrier comprises at least one of a diluent, excipient, filler, binder, disintegrant, absorption enhancer, surfactant, adsorbent carrier, lubricant, sweetener, and flavoring agent.

In some embodiments of the invention, the excipient comprises water.

In some embodiments of the invention, the bulking agent comprises at least one of starch and sucrose.

In some embodiments of the invention, the binder comprises at least one of a cellulose derivative, an alginate, a gelatin, and a polyvinylpyrrolidone.

In some embodiments of the invention, the humectant comprises glycerin.

In some embodiments of the invention, the disintegrant comprises at least one of agar, calcium carbonate, and sodium bicarbonate.

In some embodiments of the invention, the absorption enhancer comprises a quaternary ammonium compound.

In some embodiments of the invention, the surfactant comprises cetyl alcohol.

In some embodiments of the invention, the adsorbent carrier comprises at least one of kaolin and bentonite.

In some embodiments of the invention, the lubricant comprises at least one of talc, calcium stearate, magnesium stearate, and polyethylene glycol.

According to a third aspect of the present invention, there is provided a polyketide compound having a structural formula as shown in formula (I):

according to a fourth aspect of the present invention, there is provided a process for the preparation of the polyketide compound described above, the process comprising the steps of: fermenting and culturing the aspergillus SMU01 in the fermentation platform to obtain a fermentation product; extracting the fermentation product to obtain an extract; separating and purifying the extract to obtain the product.

In some embodiments of the invention, the fermentation culture comprises the step of adding a seed solution of aspergillus SMU01 in the stage to the fermentation medium.

In some embodiments of the invention, the preparation of the seed liquid of aspergillus SMU01 in the station comprises: inoculating the aspergillus SMU01 slant strain in the platform into a solid culture medium for activation to obtain an activated aspergillus SMU01 strain in the platform, inoculating the activated strain into a liquid culture medium, and culturing for 2-5 days to obtain a seed solution.

In some embodiments of the present invention, the activated strain is inoculated into the liquid culture medium under the culture conditions of the rotation speed of 100-350 r/min and the culture temperature of 25-30 ℃.

In some embodiments of the invention, the solid medium comprises a medium suitable for the cultivation of fungi.

In some embodiments of the invention, the solid medium comprises PDA medium.

In some embodiments of the invention, the liquid medium comprises a medium suitable for fungal culture.

In some embodiments of the invention, the liquid culture medium comprises PDA liquid culture medium.

In some embodiments of the invention, the formulation of the fermentation medium comprises rice 40-80 g, glucose 0.1-0.4 g, yeast extract 0.2-0.5 g, and H ₂ O 60～100mL。

In some embodiments of the invention, the fermentation time is 20 to 36 days.

In some embodiments of the invention, the fermentation time is 24 to 30 days.

In some embodiments of the invention, the temperature of the fermentation is between 24 and 32 ℃.

In some embodiments of the present invention, the rice fermentation medium contains rice in an amount of 6 to 8g/mL.

In some embodiments of the invention, the PDA medium is 100-300 g potato and 10-30 g glucose per liter water.

In some embodiments of the invention, the step of extracting comprises crushing the fermentation product, soaking the crushed fermentation product in a first organic phase, and removing the organic phase to obtain an aqueous phase; and extracting the water phase with a second organic phase for 1-5 times, and combining the extraction solutions to obtain the extract.

In some embodiments of the invention, the first organic phase is methanol, ethanol or isopropanol.

In some embodiments of the invention, the second organic phase is ethyl acetate, dichloromethane, or chloroform.

In some embodiments of the invention, the soaking time is 10 to 16 hours.

In some embodiments of the invention, the ratio of the added volumes of the aqueous phase and the second organic phase is (1-2): (1-3).

In some embodiments of the invention, the organic phase is removed by concentration under reduced pressure.

In some embodiments of the present invention, the separation and purification comprises subjecting the extract to normal phase silica gel column chromatography, MCI column chromatography, gel resin, thin layer chromatography, and high performance liquid chromatography in this order.

In some embodiments of the present invention, the step of separating and purifying the normal phase silica gel column chromatography comprises eluting with a first eluent to obtain the first component after the step of adding the extract to the normal phase silica gel column chromatography.

In some embodiments of the invention, the first eluent is at a volume ratio of (0 to 100): (100-0) dichloromethane and methanol solution.

In some embodiments of the invention, the first eluent is a mixture of 70 to 100:0 to 30 parts of dichloromethane and methanol solution.

In some embodiments of the invention, the first component is eluted through an MCI column with a second eluent to obtain a second component.

In some embodiments of the invention, the second eluent is a mixture of 20 to 100: 80-0 gradient of methanol and water solution.

In some embodiments of the invention, the second component is eluted through a gel resin with a third eluent to obtain a third component.

In some embodiments of the invention, the gel resin is a Toyopearl HW-40F column.

In some embodiments of the invention, the third eluent is a methanol solution.

In some embodiments of the present invention, the step of separating and purifying by thin layer chromatography comprises passing the third component through a thin layer chromatography dot plate, using dichloromethane and methanol solution with a volume ratio of (8-12) to (1-3) as developing solvent, and collecting a fraction with an Rf of 0.3 as a fourth component.

In some embodiments of the present invention, the step of separating and purifying by high performance liquid chromatography comprises eluting with a fourth eluent after the fourth component is added to the high performance liquid chromatography column to obtain the polyketide.

In some embodiments of the invention, the fourth eluent is a mixture of 60 to 70:30 to 40: 0.005-0.05 of methanol, water and formic acid solution.

In some embodiments of the invention, the high performance liquid chromatography is semi-preparative high performance liquid chromatography.

In a fifth aspect of the invention, the use of aspergillus SMU01, a product or a polyketide as defined above in the above mentioned stage for the preparation of an anti-tumor product is proposed. Besides directly killing tumor cells expressing specific antigens in a targeted manner, th9 cells can also stimulate monocytes recruited into tumors to release a type I interferon through various ways so as to activate a host autoimmune system to kill the tumor cells with lost antigens, and finally the aim of completely eradicating the tumors is achieved.

In some embodiments of the invention, the use is in the preparation of a product for promoting proliferation of Th9 cells.

In some embodiments of the invention, the application is in the preparation of CD 8-facilitated antibodies ⁺ Use in a product for T cell proliferation.

In some embodiments of the invention, the use is in the preparation of an IL-9 expression promoter.

In some embodiments of the invention, the use is in the preparation of an IL-9 expression promoter in Th9 cells.

In some embodiments of the invention, the use is in the preparation of an IFN-gamma and/or TNF-a secretion promoting agent.

In some embodiments of the invention, the use is in the preparation of an IFN- γ and/or TNF-a secretion promoting agent in Th9 cells.

According to some embodiments of the invention, there are at least the following benefits: the polyketide Aspergillus taichungensis SMU01 is separated from Aspergillus taichungensis SMU01 in a scheme of the invention, and the polyketide Aspergillus taichunol A is found to promote Th9 and CD8 ⁺ The effects of increasing T cell proliferation, increasing IFN-gamma and TNF-a secretion and increasing IL-9 expression can be effectively used for enhancing the anti-tumor effect of Th9 cells, and has important value for the development and application of anti-tumor drugs.

Drawings

The invention is further described with reference to the following figures and examples, in which:

FIG. 1 is a diagram showing the identification of ITS sequences in example 1 of the present invention;

FIG. 2 is a graph showing the results of two-dimensional nuclear magnetic COSY, HMBC, and ROESY spectroscopy in example 3 of the present invention;

FIG. 3 is a graph of the results of the quantum chemical ECD calculations in example 3 of the present invention;

FIG. 4 shows a flowchart of example 3 of the present invention ¹³ C NMR calculation result chart;

FIG. 5 is a graph showing the results of flow cytometry in example 4 of the present invention;

FIG. 6 is a graph showing the results of detection of IL-9 expression in example 4 of the present invention;

FIG. 7 is a graph showing the results of the CFSE dilution assay in example 4 of the present invention, wherein A, B is a graph showing the results of the percentage analysis of CFSE proliferating cells detected by flow cytometry; c is a test result chart of the secretion effect of IFN-gamma and TNF-a in Th9 cells.

Detailed Description

The idea of the invention and the resulting technical effects will be clearly and completely described below in connection with the embodiments, so that the objects, features and effects of the invention can be fully understood. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and those skilled in the art can obtain other embodiments without inventive effort based on the embodiments of the present invention, and all embodiments are within the protection scope of the present invention.

The media and the preparation thereof referred to in the following examples are as follows:

potato dextrose aqueous medium: boiling 200g of potato in 500mL of pure water for 20min, filtering to obtain potato juice, adding 20g of glucose, adding water to 1000mL, and sterilizing with 110 deg.C high-pressure steam for 25 min.

Fermentation medium: weighing rice 60g, glucose 0.3g, yeast extract 0.3g, adding H ₂ O80mL, and autoclaving at 110 deg.C for 25 min.

Example 1 obtainment of Aspergillus taichungensis SMU01

1. Isolation of Aspergillus taichungensis SMU01 Strain

The specific method for isolating Aspergillus taichungensis SMU01 strain is as follows: the method comprises the following steps of sampling 10 American cockroaches (from southern medical university Baiyun school district, identified by authoritative classification experts of the institute of animal research) for 1min, soaking the 10 American cockroaches in 75% ethanol, taking the cockroaches under aseptic operation conditions, transferring the cockroaches to 10% sodium hypochlorite for soaking for 5min, and rinsing the cockroaches 10 times with sterile water to achieve the effect of sterilizing the surfaces of the cockroaches (in order to check the surface sterilization effect, the sterilized sterile water which is cleaned at the last time is coated on a plate and cultured for 2d at 30 ℃, if no bacterial colony appears, the surface sterilization of the cockroaches is proved to be thorough, and the result obtained by the endophyte is credible). The air-dried worms were dissected from their abdomen, eviscerated, and ground in a sterile mortar. A small amount of sterile water was added to a 15mL sterile centrifuge tube, and the strain was isolated by dilution plating PDA medium (containing 50. Mu.g/mL ampicilin and 50. Mu.g/mL kanamycin) and identified as Aspergillus taichungensis SMU01 by ITS sequence.

2. Identification of Aspergillus taichungensis SMU01 Strain

(1) 16s rDNA Gene sequence identification

The strain Spergillus taichungensis SMU01 is subjected to ITS sequence identification, an ITS sequence identification chart is shown in figure 1, and the strain ITS sequence is as follows: GGAAGGATCATTACCGAGTGAGGGTTTCTCTGAAGCCCAACCTCCCACCCGTGTATACCGTACCCTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGACCTCGCGTCCCCGGGCCCGCGCCCGCCGAAGACCCCAACACGAACACTGTCTGAAAAGTGCAGTCTGAGTCGATTGTTACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCGGTACCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGCAGGCCCGGCCGGCGCCAGCCGACCAACCCAACCATTTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC (SEQ ID NO. 1).

The screened ITS sequence amplification data of the fungus is submitted to GenBank, NCBI is utilized to carry out homology comparison to obtain similar sequence information, and finally Aspergillus taichungensis is determined to be Aspergillus taishanensis, and the homology score is 99.8.

Through the identification results, aspergillus taichungensis SMU01 strain is determined to be Aspergillus oryzae, which has been deposited in Guangdong province microbial strain collection center (GDMCC for short, china center for microbial strain collection in Guangdong province, no. 59, no. 5, of Miyaolu Miyao No. 100, guangzhou city) at 8-30 th 2022, and the deposit number is GDMCC NO:62752.

Isolation of the Compound of example 2

This example prepared a polyketide isolated from the fermentation broth of Aspergillus taichungensis SMU01, the specific process being:

(1) Preparation of spore suspension: inoculating Aspergillus taichungensis SMU01 slant strain to PDA solid culture medium, inoculating to potato glucose aqueous liquid culture medium (100 mL) after fungus spores grow, and culturing for 3 days with a shaker (200 r/min,28 ℃) to obtain spore suspension.

(2) Seed culture of the fungus Aspergillus taichungensis SMU 01: inoculating 3ml of spore suspension obtained in step (1) into fermentation medium (60 g of rice, 0.3g of glucose, 0.3g of yeast extract, adding H ₂ O80 mL), and collecting the fermentation product after standing and culturing at room temperature (26 ℃) for 28 days.

(3) Crushing the fermented product (including thallus and rice solid culture medium) with a wall breaking machine to obtain a paste mixture, soaking in 100% methanol for 12h, repeatedly extracting for five times, mixing the extractive solutions, concentrating under reduced pressure to remove methanol, and collecting water phase; extracting the water phase with ethyl acetate (volume ratio 1:1), and concentrating to obtain 108.0g ethyl acetate extract (containing thallus and fermented product).

(4) Separating the total extract by silica gel column chromatography, specifically: mixing normal phase silica gel (100-200 mesh) with dry method, loading into conventional silica gel column, performing normal temperature reduced pressure column chromatography, sequentially adding dichloromethane: methanol volume ratio of 100, 95, 5, 90, 10, 80, 20, 70. Collecting dichloromethane: the sample rinsed with methanol at a volume ratio of 90; fraction fr.c was separated by MCI column, eluting with a gradient of methanol/water (volume ratio 20-100, 2L each) to give six fractions (fr.c 1-fr.c 6); wherein the fraction fr.c2 obtained by gradient elution with methanol/water (v/v, 40-60-50) is separated on a Toyopearl HW-40F column (with methanol as eluting solvent), spotted by thin layer chromatography, purified with dichloromethane: methanol =10 as a developing solvent, wherein R _f The value about 0.3 is combined as component fr.c21. C21 was further purified by semi-preparative HPLC (YMC-Pack ODS-se:Sup>A column,250 × 10,5 μm,12 nm) eluting isocratically with methanol/water/formic acid (v/v/v, 64, 36 _R ＝21.5min，3mL/min)。

Structural analysis of the Compound of example 3

The new compound Aspertaichunol a was subjected to structural test analysis to obtain the following experimental data:

(1) One-dimensional nuclear magnetic data analysis

Aspertacichunol A, colorless gum, high resolution Mass Spectrometry (HRESIMS) gives [ M-H ] at M/z 319.1910] ^- Ionic peak, binding ¹³ CNMR data sheet (shown in Table 1), the molecular formula is presumed to be C ₁₉ H ₂₈ O ₄ The unsaturation degree was 6. The signal on the hydrogen spectrum shows a four methyl group [ delta ] _H 1.201(s,H ₃ -11),1.62(d,J＝4.9Hz,H ₃ -16),1.57(d,J＝2.2Hz,H ₃ -18),1.198(d,J＝7.1Hz,H ₃ -19)]And two olefinic methylene groups [ delta ] _H 5.41(m,H-14)，5.42(m,H-15)]。 ¹³ C NMR and HSQC spectra showed 19 carbon signals including four methyl groups, two methylene groups, nine methylene groups (two oxidized and two olefins) and four aprotic carbons (one aliphatic, two olefins and one carboxyl group). These NMR data indicate that the compound may be a polyketide.

TABLE 1

The polyketide has a structural formula of Aspertacichunol A, which is shown in a formula (1):

(2) Planar structure determination

The planar structure of Aspertaichunol a was mainly determined by analyzing two-dimensional nuclear magnetic data. Two-dimensional nuclear magnetic data is shown in FIG. 2, from which it can be seen that the compound ¹ H- ¹ The H COSY spectrum shows H-2/H-3/H-4/H-5/H ₃ Correlation of-19 and H-8/H-9/H-10/H-12/H-13/H-14. HMBC spectra show the correlation of H2/C-3, C-6 and H-5/C-2, C-7 confirming the presence of a five-membered ring with two hydroxyl groups. HMBC spectra also showed H ₃ 18 and C-6 (. Delta.) _C 143.8)/C-7(δ _C 132.8 Relatedness, the attachment of the methyl group to C-7 was confirmed. Furthermore, the HMBC spectra also show a correlation between H-2 and C-5/C-6, and between H-8 and C-11 (. Delta.) (delta.) _C 10.5 ) and H ₃ -11 and C-1 (. Delta.) _C 45.8)/C-8(δ _C 60.1)/C-10(δ _C 47.5 ) and H ₃ -18 correlates with C-8, indicating the presence of a five-membered ring with bridgehead double bonds (anti Bredt system). This clearly indicates bicyclo [3.3.0 ]]The octane carbon skeleton shares a C-2-C-6 bond. By applying to HMBC lightFurther analysis of the spectra found H-9 with C-7, C-8, C-17 (. Delta.) (delta.) _C 178.5 Relatedly, the association of H-8 with C-17 indicates the presence of a C-8-C-9 bond and the attachment of a carboxyl group to C-9. Furthermore, in ¹ H- ¹ H-9/H-10/H-12/H-13/H-14, H-10/H-16 correlation was observed on the H COSY spectrum, and H-10 and C-12/C-13, H-13 and C-14 (. Delta.) in the HMBC spectrum _C 132.3)/C-15(δ _C 126.0 Correlation as well as H-13 and C-14/C-15 correlation confirmed the presence of short aliphatic chains. In addition to the 5/5 ring system, two double bonds and one carboxylic acid group account for five unsaturations, one unsaturation forming compound 1.HMBC spectra show that H-10 correlates with C-1/C-2/C-11, binding to C-1 (. Delta.) _C 45.8 And C-10 (. Delta.) _C 47.5 Chemical shifts) reveal the existence of quaternary rigid structures in nature. Thus, the planar structure of Aspertacichunol A is shown in FIG. 2.

(3) ROESY spectral analysis

The relative configuration of the stereogenic centers of 1 was further determined by analysis of the ROESY spectrum. The results are shown in FIG. 2, from which it can be seen that H-3 and H-5, H-2 and H-4, H-4 and H ₃ -19、H ₃ -19 is related to the ROESY of H-2, indicating H-2, H-4 and H ₃ The-19 is in the alpha configuration, while the H-3, H-5 are in the beta configuration. Furthermore, H-3/H ₃ -11 and H-8/H ₃ ROESY correlation of-11, indicating that these protons are spatially adjacent, further considering the naturally rigid tricyclo [6.2.0.02,6 ] in this compound]A decane carbon skeleton, and thus the relative configuration of C-1 and C-8 can be easily determined. Furthermore, H-9/H ₂ -13、H ₃ -11/H ₂ -12 and H ₃ -11/H ₂ The ROESY correlation between-13 confirms the relative configuration of C-9 and C-10. Finally, Δ ¹⁴ Type E of the double bond is represented by H-14/H ₃ A ROESY correlation determination of 16. Therefore, the relative configuration of the chiral carbons in Aspertaichunol a was determined to be 1s × 2r × 3s × 4s × 5r × 8r × 9r × 10r ″. In conclusion, we proceed through quantum chemical ECD and ¹³ c NMR calculations determined the absolute configuration of compound Aspertaichunol A as 1S,2R,3S,4S,5R,8R,9R,10R (as shown in FIGS. 3 and 4).

Example 4 use of polyketide Aspertacichunol A for increasing IL-9 expression in Th9 cells

This example provides the use of the polyketide Aspertarichunol A for increasing the expression of IL-9 in Th9 cells, and the specific experimental steps are as follows:

(1)CD4 ⁺

t cell acquisition: c57BL/6 mice from 6 to 8 weeks were selected for spleen isolation to a 70 μ M sieve, the tissue was ground rubber-faced with a 5mL syringe, the sieve was rinsed with PBS and the cell suspension was transferred to a 15mL centrifuge tube. Centrifuging at 1500rpm at 4 deg.C for 5min, and removing supernatant. Adding erythrocyte lysate, lysing at room temperature for 2min, stopping lysing with PBS, centrifuging at 4 deg.C at 1500rpm for 5min, removing supernatant, and resuspending cells. Sorting to obtain CD4 by using a stem cell sorting kit ⁺ />

T cells.

(2) Differentiation of Th9 cells in vitro: anti-CD 3 monoclonal antibody was coated and after overnight at 4 ℃, cultured using Th9 polarized medium supplemented with 20nM of Comp1 (Aspertacichunol A), IL-4 (10 ng/mL), TGF-. Beta.s (1 ng/mL), anti-IFN-. Gamma.monoclonal antibody (20. Mu.g/mL) and anti-CD 28 monoclonal antibody (1. Mu.g/mL)

CD4 ⁺ CD62L ⁺ After 3 days of T cells, the cells are cultured in liquid-changing wells>

CD4 ⁺ CD62L ⁺ T cells, 20nM Comp1 was added again as experimental group when the culture medium was changed; the control group differs from the experimental group in that it does not contain Comp1 (as Ctrl group), and markers on the cell surface and in the intracellular core are detected by flow cytometry and enzyme-linked immunosorbent assay (ELISA) on the third or fourth day of culture, and IL-9 expression in Th9 cells.

(3) Proliferation of T cells: the Th9 cells obtained in step (2) were incubated with PBS solution containing CFSE at a final concentration of 1.25. Mu.M for 20min at 37 ℃ and then washed thoroughly, and proliferation of T cells was measured by the relative CFSE dilution method.

The results of the experiments are shown in FIGS. 5-6, from which it can be seen that purified CD4 is present with or without Comp1 ⁺ Differentiation of T cells into Th9 cells, and detection by flow cytometry or enzyme-linked immunosorbent assay (ELISA), comp1 (Aspertaichunol a) stimulation significantly increased IL-9 expression in Th9 cells<0.01。

The results of the CFSE dilution assay are shown in FIG. 7, where FIGS. A and B show the percentage of CFSE-proliferating cells detected by flow cytometry when the Th9 cells (Tc 1 cells) were polarized at 20nM 1CFSE for 3 days, and it can be seen from FIG. A that the Th9 cells were 1-time treated and their proliferation ability was enhanced, and from FIG. B that Comp1 also promoted CD8 ⁺ T cells proliferated, and FIG. C shows the expression levels of IFN-g and TNF-a in Th9 cells with or without addition of Comp1 at 20nM on day 4, and it can be seen from FIG. C that Comp1 also promotes secretion of IFN-. Gamma.and TNF-a in Th9 cells.

The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

Claims

1. A strain is Aspergillus taichungensis SMU01 in Taizhong, is preserved in Guangdong province microorganism culture collection center, has a preservation number of GDMCC NO:62752, and has a preservation date of 2022, 08 and 30 days.

2. A product characterized by comprising at least one of (1) to (6):

(1) The strain of claim 1;

(2) A microbial agent comprising the strain of claim 1;

(3) A viable bacterial solution comprising the strain of claim 1;

(4) A killed bacterial solution containing the strain of claim 1;

(5) A metabolite comprising the strain of claim 1;

(6) An extract containing the strain of claim 1.

3. A polyketide compound having a structural formula (I):

4. a process for the preparation of a polyketide compound as claimed in claim 3, wherein the process comprises the steps of: fermenting and culturing the strain of claim 1 to obtain a fermentation product; extracting the fermentation product to obtain an extract; separating and purifying the extract to obtain the product.

5. The method of claim 4, wherein the fermentation culture comprises a step of adding a seed solution of Aspergillus SMU01 in the stage to a fermentation medium; preferably, the preparation of the seed solution of the aspergillus SMU01 in the table comprises the steps of inoculating slant strains of the aspergillus SMU01 in the table into a solid culture medium for activation to obtain activated strains of the aspergillus SMU01 in the table, inoculating the activated strains into a liquid culture medium, and culturing for 2-5 days to obtain the seed solution.

6. The method of claim 4, wherein the extracting step comprises crushing the fermentation product, soaking in a first organic phase, and removing the organic phase to obtain an aqueous phase; extracting the water phase second organic phase for 1-5 times, and combining the extraction liquid to obtain an extract; preferably, the first organic phase is methanol, ethanol or isopropanol and the second organic phase is ethyl acetate, dichloromethane or chloroform.

7. The preparation method according to claim 4, wherein the separation and purification comprises the steps of sequentially subjecting the extract to normal phase silica gel column chromatography, MCI chromatography, gel resin, thin layer chromatography and high performance liquid chromatography.

8. Use of any of the strains of claim 1, the products of claim 2 and the polyketides of claim 3 for the preparation of an anti-tumor product.

9. Use of any one of the strain of claim 1, the product of claim 2 and the polyketide of claim 3 in the manufacture of a product for promoting proliferation of Th9 cells and/or CD8+ T cells.

10. Use of any one of the strain of claim 1, the product of claim 2 and the polyketide of claim 3 in the preparation of an IL-9 expression promoter, an IFN- γ secretion promoter and/or a TNF-a secretion promoter.