CN115961001A - Single base positioning analysis method for 5-methylcytosine in DNA mediated by DNA methyltransferase binding cytosine deaminase - Google Patents

Abstract

The invention provides a single base positioning analysis method and a kit for 5-methylcytosine in DNA mediated by DNA methyltransferase binding syncytial pyrimidine deaminase, wherein the method comprises the following steps: performing carboxymethylation labeling reaction on the DNA to be detected by adopting DNA methyltransferase, and performing denaturation treatment to inactivate the DNA methyltransferase to terminate the reaction to obtain the carboxymethylation labeled DNA; carrying out deamination reaction on the carboxymethylation labeled DNA by adopting cytosine deaminase, and then carrying out high-temperature inactivation treatment to inactivate the cytosine deaminase so as to terminate the reaction, thereby obtaining a deamination DNA sample; carrying out PCR reaction on the deamination DNA sample to obtain an amplification product; sequencing the amplification product to obtain the site information of the 5-methylcytosine. The method does not depend on bisulfite treatment, has high selectivity and simple operation, and can directly obtain the single base resolution positioning information of 5-methylcytosine in DNA.

Description

Single base positioning analysis method for 5-methylcytosine in DNA mediated by DNA methyltransferase binding cytosine deaminase

Technical Field

The invention belongs to the technical field of biology, and relates to a single base positioning analysis method and a kit for 5-methylcytosine in DNA mediated by DNA methyltransferase binding syncytial pyrimidine deaminase.

Background

5-methylcytosine (5 mC) is the most common epigenetic modification in mammals. 5mC plays an important role in regulating gene expression. Alterations in DNA methylation profiles at either the local or global level are associated with a variety of biological and pathological processes, such as embryonic development, X chromosome inactivation, and tumorigenesis. In the mammalian genome, 5mC is predominantly present in CG dinucleotide sequences, catalyzed by DNA methyltransferases (DNMTs) using S-adenosyl-L-methionine (SAM) as the methyl donor.

In the mammalian genome, cytosine in about 70-80% of CG dinucleotide is methylation modified, and accurate detection of 5mC is of far-reaching significance in disease diagnosis. Currently, the detection of 5mC is divided into two categories, including detection of the total content of 5mC and sequencing analysis. The existing methods for detecting the whole content of 5mC in DNA mainly comprise liquid chromatography/mass spectrometry (LC/MS), thin-layer chromatography (TLC) and electrochemical detection. These methods generally require hydrolytic digestion of the DNA and do not provide information on the position of 5mC in the DNA sequence. Among 5mC sequencing methods, immunoprecipitation-based sequencing methods have been used for the localization of 5mC in DNA, such as methylated DNA immunoprecipitation sequencing (MeDIP-seq) and methyl CpG binding domain sequencing (MBD-seq). However, these immunoaffinity enrichment based methods fail to detect 5mC at single base resolution and favor the enrichment of hypermethylated regions. Restriction enzyme based methods (such as MRE-seq and Methyl-MAPS) enable single base resolution analysis of 5mC, but their dependence on sequence specific endonucleases limits CG coverage and incomplete cleavage may lead to high false positive results.

Bisulfite sequencing (BS-seq), in which cytosine is deaminated to uracil after bisulfite treatment, but 5mC resists deamination, with no conversion, has been widely used for 5mC localization analysis today. C and 5mC can be distinguished by sequencing because they are read as thymine and cytosine, respectively. However, BS-seq requires harsh chemical deamination conditions, resulting in degradation of up to 99.9% of the DNA. Subsequently, a TET-assisted pyridine borane sequencing (TAPS) method was developed for sequencing of 5mC. In TAPS, 5mC is oxidized by the TET protein to 5-carboxycytosine (5 caC), and then 5caC is reduced by pyridine borane to dihydrouracil. The dihydrouracil pairs with adenine in subsequent PCR amplification, thus enabling the conversion of 5mC to thymine, thereby enabling the sequencing of 5mC. Recently, an EM-seq method has been developed to map 5mC. In EM-seq, human apolipoprotein B mRNA editing catalytic subunit 3A (APOBEC 3A, A3A) deaminase is used to deaminate cytosine to uracil; whereas 5mC is oxidised by TET protein to 5caC, the converted 5caC being resistant to A3A deamination. This technique relies on enzymatic deamination of DNA and therefore does not require bisulfite treatment. However, EM-seq involves the preparation of three enzymes and two different sequencing libraries, which is complicated. Furthermore, both TAPS sequencing and EM-seq sequencing involve oxidation of 5mC to 5caC by TET protein, however, TET protein cannot completely oxidize 5-mC to 5caC, resulting in false negative results.

Therefore, there is a need to develop a method for detecting 5mC without bisulfite treatment, single base resolution and quantitation.

Disclosure of Invention

In order to solve the technical problem, the invention provides a single base positioning analysis method of 5-methylcytosine in DNA mediated by DNA methyltransferase binding cytosine deaminase, which does not depend on bisulfite treatment, has high selectivity and is simple to operate.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided a method for DNA methyltransferase binding to cytosine deaminase mediated single base mapping of 5-methylcytosine in DNA, the method comprising:

performing carboxymethylation labeling reaction on the DNA to be detected by adopting DNA methyltransferase, and performing denaturation treatment to inactivate the DNA methyltransferase to terminate the reaction to obtain the carboxymethylation labeled DNA;

carrying out deamination reaction on the carboxymethylation labeled DNA by adopting cytosine deaminase, and then carrying out high-temperature inactivation treatment to inactivate the cytosine deaminase so as to terminate the reaction, thereby obtaining a deaminated DNA sample;

carrying out PCR reaction on the deamination DNA sample to obtain an amplification product;

sequencing the amplification product to obtain the site information of the 5-methylcytosine.

Further, the conditions of the carboxymethylation labeling reaction are as follows: the double-stranded DNA is reacted for 0.5 to 6 hours at 30 to 45 ℃ in a reaction system containing Tris-HCl 5 to 20mM, pH 7.0 to 8.5, naCl 20 to 100mM, dithiothreitol 0.2 to 2mM, EDTA0.2 to 2mM, carboxy-S-adenosyl-L-methionine 80 to 640mM, and M.MpeI-N374K protein 1 to 10 MuM.

Further, the method for the denaturation treatment comprises the following steps: DNA is incubated at a high temperature of 90-98 ℃ for 2-30 minutes in the presence of 0-60% DMSO.

Further, the conditions of the deamination reaction are as follows: the DNA is reacted in a reaction system containing 10 to 30mM of 2- (N-morpholine) ethanesulfonic acid, 0.05 to 0.5 percent of Triton X-100, 5.5 to 7.5 percent of pH and 1 to 10 mu M of A3A protein at 30 to 45 ℃ for 0.5 to 4 hours.

Further, the conditions of the high-temperature inactivation treatment comprise: incubating in water bath at 92-98 deg.C for 5-20 min.

In a second aspect of the invention there is provided the use of a combination of a DNA methyltransferase and a cytosine deaminase in an assay for single base resolution mapping of 5-methylcytosine in DNA.

In a third aspect of the invention, there is provided a kit for single base resolution mapping of 5-methylcytosine in DNA, the kit comprising a DNA methyltransferase and a cytosine deaminase.

Further, the kit further comprises:

reaction system for carboxymethylation using DNA methyltransferase: tris-HCl 5-20 mM, pH 7.0-8.5, naCl 20-100 mM, dithiothreitol 0.2-2 mM, EDTA 0.2-2 mM, carboxy-S-adenosyl-L-methionine 80-640 mM, M.MpeI-N374K protein 1-10 μ M;

a reaction system for deamination by using cytosine deaminase: the DNA is reacted in a reaction system containing 10 to 30mM of 2- (N-morpholine) ethanesulfonic acid, 0.05 to 0.5 percent of Triton X-100, 5.5 to 7.5 percent of pH and 1 to 10 mu M of A3A protein at 30 to 45 ℃ for 0.5 to 4 hours.

One or more technical solutions in the embodiments of the present invention at least have the following technical effects or advantages:

the principle of the single base positioning analysis method of 5-methylcytosine in DNA mediated by DNA methyltransferase is shown in figure 1, a mutant M.MpeI-N374K of the DNA methyltransferase is shown in the figure, carboxyl-S-adenosyl-L-methionine is used as an auxiliary factor, and carboxymethyl is selectively transferred to C5 position of cytosine in CG dinucleotide to form 5-carboxymethyl cytosine. After cytosine deaminase A3A protein treatment, 5-carboxymethylcytosine is resistant to deamination and is therefore amplified to cytosine in a subsequent polymerase chain reaction amplification whereas the target analyte 5mC cannot be labelled by DNA methyltransferase and can be fully deaminated by A3A and amplified to thymine in a subsequent polymerase chain reaction. Therefore, only 5-methylcytosine can be read as thymine in the final sequencing. Has the following advantages:

(1) The method is simple and convenient to operate, and complex sample pretreatment is not needed;

(2) The DNA sample does not need to be treated by bisulfite, the reaction condition is mild, the DNA can not be greatly degraded, and the single base resolution positioning information of 5-methylcytosine in the DNA can be directly obtained;

(3) The DNA dosage of the invention is small, and the 5mC can be subjected to positioning analysis only by 100ng of genomic DNA.

(4) The invention does not need TET protein to oxidize 5mC, thereby avoiding the problem of false negative result caused by incomplete TET oxidation.

(5) The DNA methyltransferase has high efficiency (> 90%) for transferring carboxymethyl, and is beneficial to the accurate analysis of 5mC.

(6) The cytosine deaminase 5mC has high deamination efficiency (97%), has low deamination efficiency (< 0.1%) to 5mC, is beneficial to the positioning analysis of 5mC, and has high positioning analysis accuracy.

(7) The method can be widely applied to the research of 5mC modification positioning and quantification in DNA, and is helpful to further research on the biological function of 5mC.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the description below are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a schematic view of the present invention. In the present invention, C is labelled with a carboxymethyl group by m.mpei-N374K, resulting in 5camC, which is resistant to deamination of the A3A protein, whereas 5mC is unlabelled and can be converted by A3A to T. Thus, only 5mC can be read as T at the time of sequencing.

FIG. 2 shows the efficiency of detecting the labeling of synthetic DNA strand (49-CG-FAM) by DNA methyltransferase M.MpeI Wild Type (WT) and mutant (N374K) in the present invention by denaturing polyacrylamide gel electrophoresis.

FIG. 3A is a graph showing the comparison of 5camC content before and after carboxymethylation labeling and deamination treatment of an artificially synthesized DNA strand detected by LC-MS/MS in the present invention.

FIG. 3B is a comparison graph of 5mC content before and after carboxymethylation labeling and deamination treatment of an artificially synthesized DNA strand containing a 5mC modification by LC-MS/MS detection in the present invention.

FIG. 4A is a reading of Sanger sequencing of an artificially synthesized DNA strand of the present invention without 5mC modification (DNA-C) and 5mC modified DNA strand (DNA-5 mC) after treatment with M.MpeI-N374K carboxymethylation marker and A3A protein, wherein C in DNA-C is not mutated after treatment with carboxymethylation marker and A3A protein and is read as C; 5mC in DNA-5mC is mutated into T after carboxymethylation marker and A3A deamination.

FIG. 4B shows the correlation of the T/(C + T) peak height ratio at the TCG site, measured by the method of the present invention, with the theoretical 5mC content after mixing the artificially synthesized DNA strand without 5mC modification (DNA-C) and the 5mC modified DNA strand (DNA-5 mC) at different ratios.

FIG. 4C is a graph showing the correlation between the T/(C + T) peak height ratio at the CCG site and the theoretical 5mC content, measured by the method of the present invention, after mixing artificially synthesized DNA strands without 5mC modification (DNA-C) and 5mC modified DNA strands with different ratios (DNA-5 mC).

FIG. 4D is a graph showing the correlation of the T/(C + T) peak height ratio at the GCG site with the theoretical 5mC content, measured by the method of the present invention, after mixing artificially synthesized DNA strands without 5mC modification (DNA-C) and 5mC modification (DNA-5 mC) at different ratios.

FIG. 4E shows the correlation of the T/(C + T) peak height ratio at the ACG site, measured by the method of the present invention, with the theoretical 5mC content after mixing the artificially synthesized DNA strand without 5mC modification (DNA-C) and the 5mC modified DNA strand (DNA-5 mC) at different ratios.

FIG. 5A shows the single base resolution detection of 5mC of RARB gene promoter in human lung cancer and paracancerous tissue DNA by the method of the present invention. The negative control is the result of direct deamination of genomic DNA by the A3A protein.

FIG. 5B shows the quantitative results of the 5mC content of 9 CG sites in promoter region of RARB gene of DNA of paralung cancer and lung cancer tissues by the method of the present invention. um, unmethylated. n.s., no significant difference; * p <0.05 (n = 3); * P <0.01 (n = 3); * P <0.001 (n = 3).

FIG. 5C is a correlation analysis of RARB gene promoter region 5mC content of DNA adjacent to lung cancer by the method of the present invention and bisulfite sequencing. The result shows that the correlation between the two is good, and the Pearson correlation coefficient is 0.937.

FIG. 5D shows the correlation analysis of the content of 5mC in the promoter region of RARB gene in DNA of lung cancer tissue by the method of the present invention and bisulfite sequencing. The results show that the correlation between the two is good, and the Pearson correlation coefficient is 0.916.

FIG. 6 is a graph showing the evaluation of DNA degradation in the method of the present invention and in the bisulfite sequencing method. After subjecting the DNA of various initial amounts to the method of the present invention and the commercial bisulfite method (QIAGEN), PCR amplification was carried out, and the amplification products were separated and detected on 1.5% agarose gel.

Detailed Description

The present invention will be specifically explained below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented thereby. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

In order to solve the technical problems, the embodiment of the invention provides the following general ideas:

according to an exemplary embodiment of the present invention, there is provided a method for DNA methyltransferase binding to cytosine deaminase mediated single base mapping of 5-methylcytosine in DNA, the method comprising:

s1, performing carboxymethylation labeling reaction on the DNA to be detected by adopting DNA methyltransferase, and performing denaturation treatment to inactivate the DNA methyltransferase to terminate the reaction to obtain the carboxymethylation labeled DNA;

in the above-mentioned step S1, the first step,

the conditions of the carboxymethylation labeling reaction are as follows: the double-stranded DNA is reacted at 30 to 45 ℃ for 0.5 to 6 hours in a reaction system containing 5 to 20mM Tris-HCl, 7.0 to 8.5 pH, 20 to 100mM NaCl, 0.2 to 2mM dithiothreitol, 0.2 to 2mM EDTA, 80 to 640mM carboxy-S-adenosyl-L-methionine and 1 to 10 mu M DNA methyltransferase (M.MpeI-N374K protein). In a specific embodiment, the concentration of the m.mpeg i-N374K protein is determined specifically based on the activity of the actual protein. The condition of the carboxymethylation labeling reaction is favorable for ensuring the activity of DNA methyltransferase and the efficiency of the carboxymethylation labeling reaction

The method for the denaturation treatment comprises the following steps: DNA is incubated at a high temperature of 90-98 ℃ for 2-30 minutes in the presence of 0-60% DMSO. The denaturation treatment facilitates the subsequent deamination reaction.

Preferably, the DNA methyltransferase is M.MpeI-N374K protein with an amino acid sequence shown as SEQ ID NO. 1.

A CG-specific methyltransferase m.mpei was found in Mycoplasma pendans. It was found that a mutant of m.mpeg i (m.mpeg i-N374K protein) can transfer a carboxymethyl group from carboxy-S-adenosyl-L-methionine (caSAM) to cytosine at CG, forming 5-carboxymethylcytosine (5 camC). By virtue of the unique properties of 5camC, we propose a method to sequence 5mC in DNA by methyltransferase labeling in combination with A3A deamination without bisulfite treatment, single base resolution and quantitative detection of 5mC.

S2, carrying out deamination reaction on the carboxymethylation labeled DNA by adopting cytosine deaminase, and then carrying out high-temperature inactivation treatment to inactivate the cytosine deaminase so as to terminate the reaction, thereby obtaining a deaminated DNA sample;

in the above-mentioned step S2, the step,

the conditions of the deamination reaction are as follows: the DNA is reacted at 30 to 45 ℃ for 0.5 to 4 hours in a reaction system containing 10 to 30mM of 2- (N-morpholine) ethanesulfonic acid, 0.05 to 0.5% of Triton X-100, 5.5 to 7.5% of pH, and 1 to 10 mu M of A3A protein. The buffer solution composed of the components is selected for the reason that the activity of deaminase and the efficiency of deamination reaction can be ensured.

The conditions of the high-temperature inactivation treatment comprise: incubating in water bath at 92-98 deg.C for 5-20 min. The reaction conditions are favorable for inactivating cytosine deaminase, thereby being favorable for the subsequent PCR amplification process.

In a preferred embodiment, the cytosine deaminase is an A3A protein with an amino acid sequence as shown in SEQ ID No. 2.

S3, carrying out PCR reaction on the deamination DNA sample to obtain an amplification product;

in the PCR reaction, a specific primer is used for amplifying the DNA after the carboxymethyl protection and deamination. And carrying out agarose gel electrophoresis on the amplification product, cutting and purifying, and carrying out Sanger sequencing. Corresponding primers need to be designed according to different DNA to be detected.

S4, sequencing the amplification product to obtain the site information of the 5-methylcytosine.

If the DNA fragment with the specific sequence is obtained by PCR amplification, the amplification product can be directly subjected to Sanger sequencing; if PCR amplification forms a DNA library, the amplification products are subjected to high throughput sequencing.

As a specific implementation mode, the method comprises the following specific operation steps:

(1) Synthesizing carboxyl-S-adenosyl-L-methionine.

(2) Preparing a stock solution of high-concentration M.MpeI-N374K reaction buffer solution: 100mM Tris-HCl, 7.0-8.5 pH, 500mM NaCl, 10mM dithiothreitol and 10mM EDTA.

(3) Preparing a stock solution of A3A reaction buffer solution with high concentration: 200mM 2- (N-morpholine) ethanesulfonic acid (MES), 1% triton X-100, pH 5.5-7.5.

(4) The m.mpeg i-N374K protein was expressed and purified.

(5) The A3A protein was expressed and purified.

(6) DNA was extracted from the biological sample, and RNA in the DNA was removed by RNaseA enzyme.

(7) Taking 100ng of extracted DNA, carrying out ultrasonic fragmentation treatment, wherein the fragmentation size is 300-500bp.

(8) Freeze-drying the fragmented DNA of step (7), adding 2. Mu.L of water, 0.5. Mu.L of carboxy-S-adenosyl-L-methionine (final concentration 80-640 mM) synthesized in step (1), 0.5. Mu.L of M.MpeI-N374K reaction buffer prepared in step 2, and 2. Mu.L of M.MpeI-N374K protein, and reacting at 30-45 ℃ for 0.5-6 hours. After the reaction is finished, the sample is heated to 75-98 ℃ to denature for 2-30 minutes so as to inactivate the protein.

(9) Adding 2-12 mu L DMSO into the DNA in the step (8), adding water to 16 mu L DMSO, incubating in a water bath at 90-98 ℃ for 2-30 minutes, and immediately transferring to an ice water bath for quenching. Adding 2 mu L of A3A reaction buffer solution prepared in the step (1), adding 2 mu L of A3A protein (the final concentration is 1-10 mu M), and reacting for 0.5-4 hours at 30-45 ℃. After the reaction is finished, the sample is heated to 75-98 ℃ for denaturation for 2-30 minutes to inactivate the protein.

(8) And carrying out PCR reaction to obtain an amplification product, and then sequencing and analyzing.

According to another exemplary embodiment of the present invention, there is provided a use of a combination of a DNA methyltransferase and a cytosine deaminase in an assay for single base resolution mapping of 5-methylcytosine in DNA.

According to another exemplary embodiment of the present invention, there is provided a kit for single base resolution mapping of 5-methylcytosine in DNA, the kit comprising: DNA methyltransferases and cytosine deaminases.

The kit further comprises:

reaction system for carboxymethylation using DNA methyltransferase: tris-HCl 5-20 mM, pH 7.0-8.5, naCl 20-100 mM, dithiothreitol 0.2-2 mM, EDTA 0.2-2 mM, carboxy-S-adenosyl-L-methionine 80-640 mM, M.MpeI-N374K protein 1-10 μ M;

a reaction system for deamination by using cytosine deaminase: the DNA is reacted in a reaction system containing 10 to 30mM of 2- (N-morpholine) ethanesulfonic acid, 0.05 to 0.5 percent of Triton X-100, 5.5 to 7.5 percent of pH and 1 to 10 mu M of A3A protein at 30 to 45 ℃ for 0.5 to 4 hours.

The effects of the present application will be described in detail below with reference to examples and experimental data. Unless otherwise specified, the technical means used in the examples include extraction of nucleic acids, enzymatic hydrolysis and polymerase chain reaction, which are conventional means well known to those skilled in the art.

Example 1 discrimination of Cytosine from 5-methylcytosine Using artificially synthesized DNA strands

A. Synthesis of carboxy-S-adenosyl-L-methionine

For carboxymethylation labeling with DNA methyltransferase m.mpei-N374K, a carboxymethyl donor, carboxy-S-adenosyl-L-methionine (caSAM) was first synthesized. The synthesis method comprises the following steps: 10mg of S-adenosyl-L-homocysteine was dissolved in 1.7mL of 150mM aqueous ammonium bicarbonate, mixed, and 340mg of iodoacetic acid was added to react at 37 ℃ for 24 hours. Then, 12mL of ice methanol was added, left to stand at-80 ℃ for 12 hours, centrifuged at 2000rpm at 4 ℃ for 30 minutes, washed twice with ice methanol, and centrifuged to separate a precipitate. And finally purifying by liquid chromatography to obtain pure casAM.

B. Carboxymethylation signature validation

In order to verify the carboxymethylation efficiency of the DNA methyltransferase M.MpeI-N374K in the invention, a 49bp DNA chain marked by FAM is selected to react with M.MpeI-N374K protein and caSAM, and the reaction efficiency is verified by combining restriction enzyme digestion with polyacrylamide gel electrophoresis.

(1) 49bp DNA chain sequence

5′-AATTATTAAAAATATATAAAACCGGATTAAATATAATATAAATATAATT-FAM-3′

3′-TTAATAATTTTTATATATTTTGGCCTAATTTATATTATATTTATATTAA-5′

(2) Carboxymethyl labeling of 49bp DNA strand

A total reaction volume of 5. Mu.L, containing 2. Mu.L of 1. Mu.M 49bp DNA strand, 0.5. Mu.L of the camAM synthesized in step (1) (final concentration 320 mM), 0.5. Mu.L M.MpeI-N374K reaction buffer (Tris-HCl 100mM, pH 8.0, naCl 500mM, dithiothreitol 10mM, EDTA 10 mM) and 2. Mu.L M.MpeI-N374K protein (final concentration 3.2. Mu.M), was reacted at 37 ℃ for 4 hours. After the reaction was completed, the sample was heated to 95 ℃ and denatured for 5 minutes to inactivate the protein.

(3) Verification of carboxymethylation efficiency by combination of restriction enzyme digestion and polyacrylamide gel electrophoresis

HpaII (NEB) is a restriction enzyme sensitive to 5mC and specifically recognizes and cleaves CCGG sequences, but HpaII cannot cleave when the second C in CCGG is replaced by 5mC. Similarly, hpaII also fails to cleave when the second C in CCGG is replaced by 5-carboxymethylcytosine (5 camC). Therefore, carboxymethylation efficiency can be assessed by detecting whether the DNA strand is protected from cleavage by HpaII (fig. 2).

After the DNA reacted in the above step (2) was annealed slowly to recover double strands, 2. Mu.L of HpaII reaction buffer (NEB) and 1. Mu.L of HpaII (NEB) were added, and water was added thereto to 20. Mu.L, followed by reaction at 37 ℃ for 1 hour. After the reaction was complete, the sample was heated to 95 ℃ for 5 minutes to denature the protein. The reaction product was separated and detected by electrophoresis on a 20% denaturing polyacrylamide gel. As shown in FIG. 2, the wild type M.MpeI has no carboxymethyl-transferring activity when casAM is used as a carboxymethyl donor, while the methylation efficiency of its mutant M.MpeI-N374K is very high (> 91%).

C. Liquid chromatography tandem mass spectrometry analysis of deamination efficiency of 5-carboxymethyl cytosine and 5-methyl cytosine

According to previous studies, cytosine deaminase A3A is able to deaminate C and 5mC with high efficiency, whereas the oxidation products of 5mC, such as 5caC, are able to strongly inhibit deamination. Based on this, the present invention demonstrated deamination activity of 5-carboxymethylcytosine (5 camC).

(1) Carboxymethylation signatures

The DNA template required for the reaction was 49bp DNA unmodified and containing 5mC modification.

Unmodified 49bp DNA:

5′-AATTATTAAAAATATATAAAACCGGATTAAATATAATATAAATATAATT-3′/3′-TTAATAATTTTTATATATTTTGGCCTAATTTATATTATATTTATATTAA-5′。

5mC modified 49bp DNA:

5′-AATTATTAAAAATATATAAAAC ^5m CGGATTAAATATAATATAAATATAATT-3′/3′-TTAATAATTTTTATATATTTTGG ^5m CCTAATTTATATTATATTTATATTAA-5′。

a total reaction volume of 5. Mu.L containing 1. Mu.L of 1. Mu.M unmodified 49bp DNA, 1. Mu.L of 1. Mu.M 5mC modified 49bp DNA, 0.5. Mu.L casAM (final concentration 320 mM), 0.5. Mu.L M.pepI-N374K reaction buffer (Tris-HCl 100mM, pH 8.0, naCl 500mM, dithiothreitol 10mM, EDTA 10 mM) and 2. Mu.L M.pepI-N374K protein (final concentration 3.2. Mu.M) was reacted at 37 ℃ for 4 hours. After the reaction was completed, the sample was heated to 95 ℃ and denatured for 5 minutes to inactivate the protein.

(2) DNA strand deamination

mu.L of DMSO was added to the DNA strand, water was added to 16. Mu.L, and the mixture was incubated in a water bath at 95 ℃ for 10 minutes, followed by immediate transfer to an ice water bath to quench the fire. Mu. L A3A reaction buffer (200mM MES,1% Triton X-100, pH 6.5) was added, 2. Mu. L A3A protein (final concentration 6. Mu.M) was added, and the reaction was carried out at 37 ℃ for 2 hours. After the reaction was complete, the sample was heated to 95 ℃ for 5 minutes to denature the protein.

(3) Liquid chromatography tandem mass spectrometry analysis of deamination efficiency of 5camC and 5mC

And (3) carrying out enzymolysis on the DNA treated by the A3A to obtain nucleoside, and analyzing the change of the content of 5camC and 5mC before and after the A3A treatment by using a liquid chromatography tandem mass spectrometry. As shown in fig. 3A-3B, the 5camC content did not significantly decrease after a3A treatment, yet 99.9% of the 5camC remained; and after A3A treatment, the content of 5mC is obviously reduced, and the deamination efficiency reaches 97%. This result indicates that the A3A protein can deaminate 5mC efficiently, but cannot deaminate 5 camC.

Sanger sequencing validation the method of the invention was used to distinguish between C and 5mC

The differential deamination of 5mC and 5camC by the A3A protein provides us with an opportunity to investigate the method of the invention using Sanger sequencing for single base resolution analysis of 5mC in DNA.

(1) Synthesis of 216bp DNA Strand

For Sanger sequencing, a 216bp DNA strand containing no modification and 5mC modification (designated DNA-C and DNA-5mC, respectively) was first synthesized, reacted with the A3A protein and the deamination rate was verified by mass spectrometry and Sanger sequencing.

To a 50. Mu.L reaction system, 0.5ng of pUC19 plasmid DNA (containing the amplification sequence of interest, purchased from Onck., ltd.), 5. Mu.L of 10 Xreaction buffer, 2.5U of Taq DNA polymerase (Takara), 2. Mu.L of 10. Mu.M forward primer (sequence 5'-AGTGACGCTGAGCTTGACGTCGCGC-3'), 2. Mu.L of 10. Mu.M reverse primer (sequence 5'-CCAACATTCCACTAACAATTACTCTCT-3'), 1. Mu.L of dATP, dGTP, TTP and dCTP (each at 2.5 mM) were added. When a 5mC modified DNA strand is synthesized, dCTP may be replaced with 5 mdCTP.

The Polymerase Chain Reaction (PCR) procedure was: (1) denaturation at 95 ℃ for 2min; (2) denaturation at 95 ℃ for 15s; (3) annealing at 52 ℃ for 20s; (4) extension at 72 ℃ for 30s; repeating the steps (2) to (4) for 35 times; extension at 72 ℃ for 5min. The PCR product was recovered and purified using a kit (Omega Bio-Tek Inc., norcross, GA, USA). The concentration of the synthesized DNA was quantified using a microspectrophotometer.

The sequence of the synthesized 216bp DNA-C is shown in SEQ ID NO. 3; the sequence of the synthesized 216bp DNA-5mC is shown in SEQ ID NO. 4.

AGTGACGCTGAGCTTGACGTCGCGCGATGAGAGGTGATTATGAGTATGTATAGTGTTAGGAAGAGTGTAGTAATAGGATGAAGATGATTATATGATCGATGGTCCGTATGCGTAGAATACGTTGTTGTAGTGATTATAATGGAGTGAGAATGTAGATGAGTGGAGTAGGTAGTAAGATGTAGTGGTGACAGAGAGTAATTGTTAGTGGAATGTTGG(SEQ ID NO.3)；

AGTGACGCTGAGCTTGACGTCGCGCGATGAGAGGTGATTATGAGTATGTATAGTGTTAGGAAGAGTGTAGTAATAGGATGAAGATGATTATATGAT ^5m CGATGGT ^5m C ^5m CGTATG ^5m CGTAGAATA ^5m CGTTGTTGTAGTGATTATAATGGAGTGAGAATGTAGATGAGTGGAGTAGGTAGTAAGATGTAGTGGTGA ^5m CAGAGAGTAATTGTTAGTGGAATGTTGG(SEQ ID NO.4)。

(2) Carboxymethylation labeling and deamination of artificially synthesized DNA strand

And (3) performing carboxymethylation reaction on 10ng of DNA-C or DNA-5mC under the same reaction condition as the step B (2). Then, A3A deamination is carried out under the same conditions as the step C (2).

(3) Sanger sequencing analysis

After carboxymethylation labeling and A3A treatment of 2 artificially synthesized DNA strands, PCR amplification was performed using specific primers (forward primer: 5'-AGTGACGTTGAGTTTGACGTC-3'; reverse primer: 5'-CCAACATTCCACTAACAATTACTCTCTA-3'). The amplification procedure was: denaturation at 95 ℃ for 30s;35 cycles comprising denaturation at 95 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 68 ℃ for 1min; extension at 68 ℃ for 5min. The amplification products were directly subjected to Sanger sequencing.

The results in FIG. 4A show that after M.MpeI-N374K and A3A treatment, all 5mC in DNA-5mC was read as T. In contrast, all C at the CG site in DNA-C were read as C after M.MpeI-N374K and A3A treatments. Since only the C at the CG site is carboxymethylated by M.MpeI-N374K, the C at the non-CG site (the first cytosine at the CCGG site) is also deaminated and read as T. These results indicate that in the method of the invention, C and 5mC at the CG site are read as C and T, respectively, indicating that the method of the invention can distinguish C and 5mC at the CG site in DNA well.

We next quantitatively assessed the 5mC level of a single CG site using the method of the invention. We prepared various mixtures of DNA-C and DNA-5mC at different ratios, with DNA-5 mC/(DNA-C + DNA-5 mC) at 0%, 33%, 66% and 100% mole percent. In the present invention, C and T generated in the sequence represent the original C and 5mC. Thus, the measured T/(C + T) ratio may show a 5mC level for individual CG sites. As shown in FIGS. 4B-4E, sanger sequencing results showed 5mC water as determined from the original TCG, CCG, GCG and ACG sequencesThe average is proportional to the theoretical percentage of 5mC (TCG: slope =0.85 ² =0.96; CCG: slope =0.95,r ² =0.95; GCG: slope =0.77,r ² =0.98; ACG: slope =0.88,r ² = 0.95), indicating that the method of the invention is capable of quantitatively detecting 5mC at a single CG site.

Example 2 quantitative analysis of 5mC in specific sites of human genomic DNA

We next applied the method of the invention to quantify the level of 5mC at a particular site in genomic DNA. We analyzed 5mC levels in the Retinoic Acid Receptor Beta (RARB) gene promoter region, which is a tumor suppressor gene known to modulate many biological processes. Hypermethylation of the RARB gene promoter is considered to be an important factor in predicting early recurrence of non-small cell lung cancer (NSCLC). The method for 5mC positioning analysis in the genome specifically comprises the following steps:

A. a pair of NSCLC paralung cancer and lung cancer tissues were collected, and genomic DNA was extracted using tissue DNA kit (Omega) according to the manufacturer's recommended protocol.

B. The genomic DNA was fragmented into fragments with an average size of 300-500bp using an ultrasonic homogenizer (Scientz).

C. Then 100ng of the fragmented DNA was carboxymethylated labelled and A3A deaminated with M.MpeI-N374K as described in example 1. As a control, 100ng of fragmented DNA was subjected directly to A3A deamination.

D. Amplifying the deaminated DNA by PCR, wherein an amplification system comprises:

TABLE 1

RARB-F：5’-GGTTAGGAGGGTTTATTTTTTGTTAA-3’；

RARB-R：5’-AATCATTTACCATTTTCCAAACTTACT-3’。

The amplification procedure was:

TABLE 2

E. The amplification products were directly subjected to Sanger sequencing.

F. For comparison to bisulfite sequencing, the bisulfite was deaminated using a commercial kit (QIAGEN), followed by PCR amplification using primers RARB-F and RARB-R, and Sanger sequencing of the amplified product.

The method of the invention is adopted to analyze the promoter Chr3 of the RARB gene: 25,428,373-25,428,436 region CG site at level of 5mC (FIG. 5A). The present invention uses m.mpei-N374K and caSAM as cofactors for carboxymethylation of genomic DNA from tumors or lung tissue adjacent to tumors, followed by A3A treatment and Sanger sequencing. To exclude interference from other DNA cytosine modifications (e.g., 5 caC), genomic DNA not treated with m.mpei-N374K was used as a control. The results show that after A3A treatment, C/5mC at all CG sites was read as T (FIG. 5A). Next, we used the method of the invention to quantify the 5mC level at the CG site (fig. 5B). The quantitative results showed that 5mC levels at 7 sites were significantly elevated in lung tumor DNA among 9 CG sites of the RARB gene promoter (P <0.05, fig. 5B). These results were further confirmed by conventional sulfite sequencing (FIGS. 5C-5D). The 5mC levels obtained with the method of the invention were comparable to those obtained with bisulfite sequencing (Pearson's r =0.94 and 0.92, fig. 5C-5D).

Since conventional bisulfite treatment may lead to severe degradation of genomic DNA, the present application compares the degradation of genomic DNA using the method or bisulfite sequencing of the invention. The fragmented genomic DNA (300-500 bp) was subjected to the method of the invention or bisulfite sequencing analysis. After deamination, the 247bp region of the RARB gene promoter was PCR amplified. As shown in FIG. 6, in the bisulfite sequencing method, at least 10ng of the starting genomic DNA is required to detect a 247bp amplification product. However, with the method of the present invention, only 0.1ng of the starting genomic DNA was required to clearly detect the amplified product. This result indicates that the method of the present invention is superior to bisulfite sequencing in cases where there are limited DNA samples.

In conclusion, the method can be used for carrying out quantitative and single base resolution detection on the upper 5mC of the CG locus in the regional DNA in a limited DNA sample, and in combination with high-throughput sequencing, the method can be used for realizing whole genome sequencing of the CG locus 5mC.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including the preferred embodiment and all changes and modifications that fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Claims (8)

1. A method for DNA methyltransferase binding to cytosine deaminase mediated single base mapping of 5-methylcytosine in DNA, comprising:

performing carboxymethylation labeling reaction on the DNA to be detected by adopting DNA methyltransferase, and performing denaturation treatment to inactivate the DNA methyltransferase to terminate the reaction to obtain the carboxymethylation labeled DNA;

carrying out deamination reaction on the carboxymethylation labeled DNA by adopting cytosine deaminase, and then carrying out high-temperature inactivation treatment to inactivate the cytosine deaminase so as to terminate the reaction, thereby obtaining a deaminated DNA sample;

carrying out PCR reaction on the deamination DNA sample to obtain an amplification product;

sequencing the amplification product to obtain the site information of the 5-methylcytosine.

2. The method for analyzing the single-base localization of 5-methylcytosine in DNA mediated by DNA methyltransferase binding cytosine deaminase according to claim 1, wherein the carboxymethylation labeling reaction is performed under the following conditions: the double-stranded DNA is reacted for 0.5 to 6 hours at 30 to 45 ℃ in a reaction system containing Tris-HCl 5 to 20mM, pH 7.0 to 8.5, naCl 20 to 100mM, dithiothreitol 0.2 to 2mM, EDTA0.2 to 2mM, carboxy-S-adenosyl-L-methionine 80 to 640mM, and M.MpeI-N374K protein 1 to 10 MuM.

3. The method for analyzing the single-base localization of 5-methylcytosine in DNA mediated by DNA methyltransferase binding syncytial pyrimidine deaminase according to claim 1, wherein the denaturation step comprises: incubating the DNA at a high temperature of 90-98 ℃ for 2-30 minutes in the presence of 0-60% DMSO.

4. The method for analyzing the single-base localization of 5-methylcytosine in DNA mediated by DNA methyltransferase binding cytosine deaminase of claim 1, wherein the deamination reaction is performed under the following conditions: the DNA is reacted at 30 to 45 ℃ for 0.5 to 4 hours in a reaction system containing 10 to 30mM of 2- (N-morpholine) ethanesulfonic acid, 0.05 to 0.5% of Triton X-100, 5.5 to 7.5% of pH, and 1 to 10 mu M of A3A protein.

5. The method for analyzing the single-base localization of 5-methylcytosine in DNA mediated by DNA methyltransferase binding syncytial pyrimidine deaminase according to claim 1, wherein the conditions of the high-temperature inactivation treatment comprise: incubating in water bath at 92-98 deg.C for 5-20 min.

Use of a combination of a DNA methyltransferase and a cytosine deaminase in an assay for single base resolution mapping of 5-methylcytosine in DNA.

7. A kit for single base resolution mapping of 5-methylcytosine in DNA, the kit comprising: DNA methyltransferases and cytosine deaminases.

8. The kit of claim 7, wherein the kit further comprises:

reaction components for carboxymethylation using DNA methyltransferase: tris-HCl with pH 7.0-8.5, naCl, dithiothreitol, EDTA, carboxyl-S-adenosine-L-methionine;

the reaction components for deamination by cytosine deaminase are as follows: 2- (N-morpholine) ethanesulfonic acid and Triton X-100.

Images