CN115960921A - Acquisition and application of novel liver-targeted adeno-associated viruses - Google Patents

Abstract

The present invention provides a set of adeno-associated viruses having properties of interest, e.g., targeting properties and/or neutralizing properties, obtained by directed evolution and in vivo screening methods. The present invention also provides adeno-associated virus capsid protein and viral particles comprising the adeno-associated virus capsid protein, which have excellent or superior targeting and/or neutralizing properties.

Description

Acquisition and application of novel liver-targeted adeno-associated viruses

The application is a divisional application of an invention patent application, wherein the application date is 2020, 7, 29 and the application number is 202010742484.2, and the invention is named as 'acquisition of a group of liver-targeted novel adeno-associated viruses and application thereof'.

Technical Field

The invention relates to a group of adeno-associated viruses obtained by directed evolution and in vivo screening methods, and optimized adeno-associated virus capsid proteins and viral vectors comprising the capsid proteins.

Background

The adeno-associated virus (AAV) subtypes, so far designated by serotypes, are classified into AAV1-AAV12 (highlight par, 2004, j Virolm 78, 6381-6388 mori S et al, 2004, virology 330, 375-383 schmidt M et al, 2008, j virol 82. AAV7 and AAV8 were obtained by genetic engineering rescue from macaque heart tissue, suspected to be AAV subtypes that have been extincted in evolution, which offers new ideas and paradigms for the discovery of new AAV subtypes and the design and engineering of recombinant viruses (gazette et al, 2002, proc Natl Acad Sci USA 99. Although viruses of different AAV serotypes all have a regular icosahedral structure, the diversity in sequence and spatial conformation of their capsid proteins allows for significant differences in their cell surface binding to receptors and infection tropism for cells (Timpe J et al, 2005, curr Gene Ther 5. In the aspect of infection tropism, the infection spectrum of AAV2 is wide, and the effect on nerve cells is particularly good; AAV1 and AAV7 are more efficient in transduction in skeletal muscle; AAV3 readily transduces megakaryocytes; AAV5 and AAV6 have obvious advantages of infecting respiratory epithelial cells; AAV8 transduces hepatocytes more efficiently than other subtypes.

AAV viruses are replication-defective in nature and can only be latent in host cells in the absence of helper virus. Production of AAV viral vectors requires helper plasmids (helper) to provide key genes for adenovirus (Ad) to participate in AAV replication. These Ad genes include: the early gene E1A is responsible for the transcriptional activity of AAV, the early genes E1B and E4 are involved in maturation of AAV mRNA, and the early genes E2A and VA enhance AAV RNA translation (Berns et al, 1984, adeno-associated virus 563-592).

Recombinant adeno-associated virus (rAAV) has many advantages as a gene therapy vector, such as high infection efficiency, a wide infection range, long-term expression, and high safety (David AF et al, 2007, bmc Bio 7. At present, the gene therapy project using AAV as carrier is more than 100 in clinical research, and the disease range of therapy is expanded to tumor, retina disease, arthritis, AIDS, heart failure, muscular dystrophy, nervous system disease and other series of gene defect diseases.

The clinical research of rAAV vector-based eye disease gene therapy is currently carried out, and most of the clinical research is directed to congenital amaurosis (LCA) caused by mutation of a retinal pigment epithelium specific 65kDa protein coding gene (RPE 65). The Luxturona drug developed by Spark corporation has been approved by FDA to be on the market in 12 months 2017, and is a rAAV2 carrying hRPE65v2 gene to treat LCA and hereditary retinal dysplasia. The test results of the subjects after injection showed their pharmaceutical effectiveness and no significant side effects, especially vehicle-related side effects were found (Russell S et al, 2017, lancet 390 849-860). Other clinical gene therapy ophthalmology diseases also include choroideremia, most of the research is in clinical stages I and II, wherein the university of Alberta utilizes rAAV2 to carry a Rab guard protein 1 coding gene (REP 1) treatment project, and the stage I research result published in 2018 shows the safety and the effectiveness of the medicine.

There are over twenty clinical studies on gene therapy for hemophilia based on rAAV vectors currently in progress, with hemophilia B being the most studied. AAV gene drugs with long-term expression ability are ideal candidates for treatment of hemophilia B. UniQure is conducting a phase I/II clinical study with AAV5 carrying the human coagulation factor IX coding gene (hFIX) for hemophilia B, with drug safety shown by follow-up data 1 year after administration. The patient developed a humoral immune response 1 week after dosing, but did not affect the level of coagulation factor IX expression, and no T cell activation could be detected using the current "gold standard" system for T cell detection. Transaminase was elevated but did not affect FIX activity, nor was a hepatotoxic response found (Miesbach W et al, 2018, blood131. There are currently several gene therapy programs for treating hemophilia using AAV8 vectors, all in liver-targeted clinical studies (Nathwani AC et al, 2006, blood.107, 2653-2661), and AAV8 is also currently recognized as the best AAV serotype for liver targeting.

Spinal Muscular Atrophy (SMA) refers to a group of diseases that result in muscle weakness and atrophy due to degeneration mainly of the anterior horn cells of the spinal cord. AVXS-101 from AveXis is currently on the market, taking advantage of AAV9 in nervous system infections, carrying the motor neuron survivin coding gene (SMN 1) has achieved good efficacy in treating SMA, and all patients did not show clinical symptoms associated with vector side effects in clinical trials (Mendell JR et al, 2017, n Engl J Med 377.

Other AAV-vectored rare disease Gene therapy programs, such as AAV1 carrying the acid alpha-glucosidase coding Gene (GAA) for treating pompe disease (Smith BK et al, 2013, hum Gene Ther 24, 630-640), and AAV2.5 carrying the mini dystrophin coding Gene (minisytropin) for treating Duchenne Muscular Dystrophy (DMD) (Bowles DE et al, 2012, mol Ther 20 443-455), all show drug efficacy and safety from clinical studies.

Natural AAV targeting is limited, especially when systemic administration is performed using AAV vectors, the proportion of target cell tissues that can be effectively infected varies greatly depending on the serotype, without maximizing AAV utilization; still other non-targeted tissue cells have the potential to be infected. In addition, since human and other primates are naturally infected with AAV to generate neutralizing antibodies against native AAV, the half-life of AAV is greatly reduced, and the activity of the drug is affected.

There is now an increasing search for the engineering of AAV coat proteins for the purposes of: on one hand, the targeting property of the virus vector can be enhanced, and on the other hand, the immunogenic response of the virus vector can be reduced.

For the carrier serotype with clear mechanism research of virus cell receptor, the small-range or site-specific modification can be directly carried out on the amino acid of the relevant region of the cell receptor. The receptor of AAV2 on cells is well-defined in the current research. Heparan Sulfate Proteoglycans (HSPGs) are the major cellular receptors of AAV2 and AAV3 types, and alterations in the amino acid positions R484, R487, K532, R585, R588 on AAV coat protein type 2 affect their binding to HSPGs (opine, s.r et al, 2003, j Virol 77, summerford, c et al, 1999, nat Med 5.

The engineered novel AAV vectors have been used in gene therapy clinical studies, such as AAV2.5 carrying minidstrophin gene therapy DMD (Bowles DE et al, 2012, mol Ther 20. The AAV2.5 coat protein used in the project is a chimera, and 5 amino acids related to skeletal muscle targeting in the AAV1 coat protein are transplanted to the coat protein of AAV2. The chimera not only enhances the targeting property to skeletal muscle, but also has humoral immune response obviously lower than AAV2, and these clinical tests prove the safety of the modified virus vector.

In addition, under the condition that the cell receptor mechanism of the virus is not clear, the coat protein of the novel AAV viral vector with optimized functions can be obtained by using a DNA shuffling (DNA shuffling) or error-prone PCR method. For example, grimm et al, using a shuffled library constructed from AAV, obtained a chimeric AAV-DJ consisting of AAV2,8,9 under a stringent screening condition of intravenous immunoglobulin, and the vector has higher transduction efficiency on a variety of cell lines such as fibroblasts and lung (Grimm D et al, 2008, J Virol 82. Jang et al screened a variant that efficiently infected neural stem cells using a DNA shuffling library (Jang J H,2011, mol Ther 19.

At present, gene therapy medicines become hot spots of domestic and foreign research, and in order to enable the gene therapy medicines to play a role better and longer, a novel AAV vector with optimized functions is searched to better meet the requirement of serving as a gene therapy vector, so that the problem to be solved is urgent.

Disclosure of Invention

Based on the need to find novel AAV vectors, the present invention provides a panel of viruses comprising AAV capsids of traits of interest, e.g., targeting traits and/or neutralizing traits (e.g., the ability to evade neutralizing antibodies), obtained by methods for achieving directed evolution of the viruses by in vivo screening. The invention also provides AAV capsids and virions comprising AAV capsids.

In one aspect, the invention provides a nucleic acid encoding an AAV capsid protein, the nucleic acid comprising an AAV capsid protein coding sequence selected from the group consisting of:

(a) The nucleotide sequence (L1) of FIG. 3A (SEQ ID NO: 1);

(b) The nucleotide sequence of FIG. 3C (L4) (SEQ ID NO: 3);

(c) The nucleotide sequence of FIG. 3E (L10) (SEQ ID NO: 5);

(d) The nucleotide sequence of FIG. 3G (L52) (SEQ ID NO: 7);

(e) The nucleotide sequence of FIG. 3I (L58) (SEQ ID NO: 9);

(f) The nucleotide sequence of FIG. 3K (L84) (SEQ ID NO: 11);

(g) The nucleotide sequence of FIG. 3M (L37) (SEQ ID NO: 13);

(h) The nucleotide sequence of FIG. 3O (L107) (SEQ ID NO: 15);

(i) The nucleotide sequence of FIG. 3Q (L57) (SEQ ID NO: 17); or

(j) A nucleotide sequence that encodes an AAV capsid protein encoded by any one of (a) - (i) but differs from (a) - (i) due to the degeneracy of the genetic code.

In another aspect, the invention provides an AAV capsid protein encoded by a nucleic acid of the invention, the amino acid sequence of said AAV capsid protein being selected from any one of SEQ ID NO.

The invention further provides recombinant virions comprising a viral genome and an AAV capsid protein of the invention, wherein the viral genome is encapsidated in the AAV capsid protein. The invention further provides an AAV viral genome and a recombinant adeno-associated virion of an AAV capsid protein of the invention, wherein the viral genome is enveloped in the AAV capsid protein. In particular embodiments, the viral genome is a recombinant vector genome comprising a heterologous nucleic acid.

The invention provides a cell comprising a nucleic acid of the invention, an AAV capsid protein, a recombinant virion, and/or a recombinant adeno-associated virion.

The invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a nucleic acid, AAV capsid protein, recombinant virion, recombinant adeno-associated virion, and/or cell of the invention.

The invention provides uses of the nucleic acids, AAV capsid proteins, recombinant virions, recombinant adeno-associated virions, cells, and/or pharmaceutical compositions described herein in the preparation of a medicament for the prevention or treatment of a disease.

The invention provides a method of producing a recombinant virion comprising an AAV capsid protein, the method comprising: providing a nucleic acid of the invention, an AAV Rep protein coding sequence, a recombinant vector genome comprising a heterologous nucleic acid, and a helper for producing productive infection to a cell in vitro allows assembly of recombinant virions comprising AAV capsid proteins, and encapsidation of the recombinant vector genome.

The invention provides a method of producing a recombinant AAV particle comprising an AAV capsid protein, the method comprising: providing a nucleic acid of the invention, an AAV Rep protein coding sequence, a rAAV genome comprising the heterologous nucleic acid, and a helper for production of a productive infection to a cell in vitro allows assembly of recombinant virions comprising AAV capsid proteins, and encapsidation of the recombinant vector genome.

The invention provides a method of delivering a nucleic acid of interest to a cell, the method comprising providing to the cell a nucleic acid, AAV capsid protein, recombinant virion, recombinant adeno-associated virion, and/or pharmaceutical composition of the invention.

The present invention provides a method of delivering a nucleic acid of interest to a mammalian subject, the method comprising: an effective amount of a nucleic acid, AAV capsid protein, recombinant virion, recombinant adeno-associated virion, cell, and/or pharmaceutical composition of the invention is administered to a mammal.

The invention also provides a method of identifying a viral vector, such as an AAV vector or an AAV capsid protein, having a tropism profile of interest, said method comprising:

(a) Providing a collection of viral vectors, such as AAV vectors, wherein each viral vector in the collection comprises:

(i) An AAV capsid protein comprising a capsid protein produced by shuffling two or more different AAV capsid protein coding sequences, wherein the amino acid sequences of the two or more different AAV capsid proteins differ by at least two amino acids; and (ii) a viral vector genome, e.g., an AAV viral genome, comprising a coding sequence encoding (i) said AAV capsid proteins, an AAV Rep protein coding sequence, at least one terminal repeat (e.g., a 5 'and/or 3' terminal repeat) that interacts with AAV Rep proteins, wherein the viral vector genome is encapsidated in the AAV capsid proteins.

(b) Administering the collection of viral vectors to a mammalian subject, and

(c) Recovering a plurality of virions or viral vectors encoding viral genomes of the AAV capsid proteins from the target tissue, thereby identifying viral vectors or AAV capsid proteins having a tropism of interest.

The invention has the positive effects that:

the present invention provides a novel set of AAV viral vectors obtained by directed evolution and in vivo screening methods, AAV capsid proteins and viral particles comprising said AAV capsid proteins, viruses having a characteristic AAV capsid of interest, e.g., a targeting characteristic (higher liver tissue targeting) and/or a neutralizing characteristic (e.g., the ability to evade neutralizing antibodies), relative to AAV viral vectors of the prior art.

The present disclosure is further described with reference to the following drawings and detailed description, but the present disclosure is not limited thereto. All technical equivalents which may be substituted for elements thereof according to the disclosure are intended to be encompassed by the present patent.

Drawings

FIG. 1 shows the random selection of positive cloning cleavage map from the plasmid library. 1-12 respectively corresponding to randomly selected positive clone samples, wherein M represents a 5000bp DNA Marker.

FIG. 2. Frequency of AAV mutants in liver, skeletal muscle and heart after two in vivo screens. After the first in vivo screening, 370 positive clones are obtained, and after the second in vivo screening, 9 groups of novel AAV sequences with high-frequency target liver are obtained.

FIGS. 3A-3R novel AAV-Cap sequences. Wherein the sequence diagram is divided into a nucleotide sequence and an encoded amino acid sequence.

FIGS. 4A-4F comparison of infection of different in vitro cell lines (CAG-EGFP). Different AAV vectors are packaged into corresponding viruses carrying CAG-EGFP, different cell lines are infected in vitro through different MOI, and flow cytometry detection analysis is carried out after 48 hours. Values are mean ± sd.

FIGS. 5A-5E comparison of infection in vitro with different cell lines (CAG-Luciferase). Different AAV vectors are packaged into corresponding viruses carrying CAG-Luciferase, different cell lines are infected in vitro through MOI 500, and the Luciferase activity is detected after 48 h. Values are mean ± sd.

FIG. 6. Vector genome copy number in different tissues of mice following systemic injection of AAV vector. Different AAV vectors are packaged into corresponding viruses carrying CAG-Luciferase, and the vector genome copy numbers in different tissues are compared after 2 weeks of tail vein injection of mice at dose of 1E + 1vg. Values are mean ± sd.

FIGS. 7A-7E Luciferase activity in different tissues of mice following systemic injection of AAV vectors. After 2 weeks of tail intravenous injection of mice with the dose of 1E + 1vgg with the corresponding virus carrying CAG-Luciferase packaged with different AAV vectors, luciferase activity was compared in different tissues. Values are mean ± sd.

Detailed Description

The invention provides a set of viral vectors comprising AAV capsids of traits of interest, e.g., targeting traits and/or neutralizing traits (e.g., the ability to evade neutralizing antibodies), obtained by methods for achieving directed viral evolution by in vivo screening. The invention also provides AAV capsids and virions comprising AAV capsids.

The present invention will be explained in more detail hereinafter. This description is not intended to detail all of the various ways in which the invention may be practiced, and further, many variations of the various embodiments of the invention may be apparent to those skilled in the art without departing from the invention. Accordingly, the following description is intended to illustrate some specific embodiments of the invention, but not to exhaustively describe all permutations, combinations and variations thereof.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Unless otherwise indicated, standard methods known to those skilled in the art can be used to produce recombinant and synthetic polypeptides, antibodies or antigen-binding fragments thereof, manipulate nucleic acid sequences, produce transformed cells, construct recombinant AAV, modify capsid proteins, package vectors comprising AAV rep and/or cap coding sequences, and transiently or stably transfect packaging cells. Such techniques are well known to those skilled in the art, see SAMBROOK et al, MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (1989, cold Spring harbor, N.Y); AUSUBEL et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, inc. and John Wiley & Sons, inc., new York).

All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference in their entirety.

Definition of I

The specification of all amino acid positions in the AAV capsid subunits in the description and claims herein are related to VP1 capsid subunit numbering.

In the description of the invention and in the claims hereof, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

In the present invention, "and/or" is meant to encompass any and all possible combinations of one or more of the recited elements.

As used herein, the term "substantially comprises" in relation to a nucleic acid, protein, or capsid structure, means that the nucleic acid, protein, or capsid structure comprises any element that can significantly alter the function of the nucleic acid, protein, or capsid structure of interest, e.g., the targeting or neutralizing properties of the protein or capsid or the protein or capsid encoded by the nucleic acid.

The term "adeno-associated virus (AAV)" in the context of the present invention includes, but is not limited to, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV and ovine AAV, as well as any other AAV now known or later discovered (Bernard N.FIELDS et al, VIROLOGY, volume 2, chapter 69,4th ed., lippincott-Raven Publishers). Some additional AAV serotypes and branches have been identified and are also included in the term "AAV" of the invention (highlight equality, 2004, j. Virology 78.

The genomic sequences of various AAV and parvoviruses, as well as the sequences of ITRS, rep proteins, and capsid protein subunits are known in the art and such sequences can be found in the literature or public databases. For example, genBank accession numbers NC 002077, NC 001401, NC 001729, NC 001863, NC 001829, NC 001862, NC000883, NC001701, NC 001510, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC 00135, NC 001540, AF513851, AF513852, AY530579, AY63 1965, AY63 1966, in the GenBank database, which disclosures are incorporated herein by reference. Additionally, srivistava et al, 1983, j.virology 45; chiorini et al, 1998, J.virology 71; chiorini et al, 1999, J.virology 73; batel-Schaal et al, 1999, j.virology 73; xiao et al, 1999, j.virology 73; muramatsu et al, 1996, virology 221; shade et al, 1986, J.Virol.58; gao et al, 2002, proc.nat.acad.sci.usa 99; international publications WO 00/28061, WO 99/61601, WO 98/11244; us patent 61563203; these disclosures are also incorporated herein by reference in their entirety. For an early description of AAV1, AAV2 and AAV3 terminal repeats, see Xiao, X,1996, "Characterization of advanced-assisted virus (AAV) DNA replication and integration," ph.d. discovery, university of Pittsburgh, pa, which is incorporated herein by reference in its entirety.

A "shuffled" or "chimeric" AAV capsid coding sequence or AAV capsid protein is a portion of two or more capsid sequences that are joined by nucleic acid sequences and amino acid sequences that result from mixing two or more different AAV capsid protein sequences. A "shuffled" or "chimeric" AAV virion comprises an AAV capsid protein that is "shuffled" or "chimeric".

The term "targeted" as used herein refers to the preferential entry of a virus into certain cell or tissue types and/or the preferential interaction with the cell surface to facilitate its entry into certain cell or tissue types, optionally and preferably the expression of sequences carried by the viral genome in the cell, e.g., the expression of heterologous nucleotide sequences by recombinant viruses. In the case of recombinant AAV genomes, gene expression of the viral genome can be from a stably integrated provirus and/or a non-integrated episome, as well as any other form in which viral nucleic acid may occur within a cell.

The term "targeting property" refers to a transduction pattern of one or more target cells, tissues and/or organs. For example, some shuffled AAV capsids may exhibit efficient transduction of liver, gonadal, and/or germ cells, some shuffled AAV capsids have only low levels of transduction of skeletal muscle, diaphragm muscle, and/or cardiac muscle tissue, and typical shuffled AAV capsids have targeting characteristics of high transduction of liver and low transduction of skeletal muscle.

As used herein, "transduction" of a cell by a viral vector refers to the transfer of genetic material into a cell by carrying nucleic acid by the viral vector and subsequently by the viral vector.

As used herein, unless the context indicates otherwise, a "set" or "plurality" of virions, vectors, capsids, or capsid proteins means two or more.

Unless otherwise indicated, "effective transduction" or "effective targeting" or similar terms may be determined with reference to a suitable control, e.g., at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or more transduction or targeting relative to the control.

Similarly, it can be determined by reference to an appropriate control whether the virus is "not effectively transduced" or "not effectively targeted" to the target cell or tissue. In particular embodiments, the viral vector does not transduce efficiently skeletal muscle, cardiac myocytes, and in particular embodiments, the non-efficient transduction of the tissue is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less of the level of efficient transduction of the tissue.

As used herein, unless otherwise indicated, the term "polypeptide" includes peptides and proteins.

A "nucleic acid" or "nucleotide sequence" is a nucleotide base sequence, which may be an RNA, DNA or DNA-RNA hybrid sequence, including naturally occurring and non-naturally occurring nucleotides, but is preferably a single-or double-stranded DNA sequence.

As used herein, an "isolated" nucleic acid or nucleic acid sequence refers to a nucleic acid or nucleic acid sequence that is separated from at least some other components of a naturally occurring organism or virus, such as, for example, cellular or viral structural components or other polypeptides or nucleic acids that are normally associated with the nucleic acid or nucleic acid sequence.

Likewise, an "isolated" polypeptide refers to a polypeptide that is isolated from at least some other component of a naturally occurring organism or virus, such as a cellular or viral structural component or other polypeptide or nucleic acid normally associated with the polypeptide.

The term "treatment" or grammatical equivalents thereof, refers to a reduction in the severity or at least partial amelioration or amelioration of the condition of a subject, and/or at least the achievement of a remission or reduction of one clinical symptom, and/or the delay in progression of the condition and/or the prevention or delay of the onset of a disease or disorder. The term "treating" as used herein also includes prophylactic treatment of a subject, e.g., to prevent the occurrence of an infection, cancer or disease. As used herein, the term "prevention" and grammatical equivalents thereof include any type of treatment in which prevention reduces the incidence of a condition, delays the onset and/or progression of a condition, and/or alleviates a symptom associated with a condition. Thus, unless the context indicates otherwise, the term "treatment" or grammatical equivalents refer to prophylactic and therapeutic methods or regimens.

An "effective" dose as used herein is a dose sufficient to obtain some improvement or benefit to the subject. Alternatively, an "effective" dose is a dose that provides relief or reduction of at least one clinical symptom in a subject. One skilled in the art will appreciate that the therapeutic effect need not be complete or curative so long as the subject gains improvement or benefit.

A "heterologous nucleotide sequence" or "heterologous nucleic acid" is generally not a sequence that occurs naturally in a virus. Typically, the heterologous nucleic acid or nucleotide sequence comprises an open reading frame encoding a polypeptide and/or an untranslated RNA.

A "therapeutic polypeptide" can be a polypeptide that can alleviate or reduce symptoms caused by a protein deficiency or defect in a cell or subject. In addition, a "therapeutic polypeptide" can be a polypeptide that otherwise provides a benefit to a subject, such as an anti-cancer effect or an increase in transplant survival.

As used herein, "vector," "viral vector," "delivery vector" generally refers to a viral particle that is a nucleic acid delivery vector, which includes viral nucleic acid, i.e., a vector genome, packaged within the body of a virus. Viral vectors according to the invention include a chimeric AAV capsid of the invention, and may package an AAV or recombinant AAV genome or any other nucleic acid including viral nucleic acids. Alternatively, in certain instances, the terms "vector", "viral vector", "delivery vector" may be used to refer to the vector genome in the absence of viral particles and/or to the viral capsid as a transporter, for delivery of molecules associated with or packaged within the capsid.

A "recombinant AAV vector genome" or "rAAV genome" is an AAV genome comprising at least one inverted terminal repeat and one or more heterologous nucleotide sequences. rAAV vectors typically retain 145 base-Terminal Repeats (TRs) in cis structure to produce a virus; however, modified AAV-TRs and non-AAV-TRs may also be used for this purpose. All other viral sequences are optional and may be provided in trans (Muzyczka, 1992, curr-topics micro. Immunological.158: 97). The rAAV vector optionally may comprise two TRs, e.g., AAV TRs, typically located at the 5 'and 3' ends of the heterologous nucleotide sequence, but not necessarily adjacent thereto. TRs may be the same or different. The vector genome may also comprise a TR at the 3 'or 5' end.

The term "terminal repeat" or "tr" includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat, i.e., mediates a desired function such as replication, viral packaging, integration, and/or proviral rescue. The TR may be an AAV TR or a non-AAV TR. For example, the non-AAV TR sequence may be another parvovirus, e.g., canine parvovirus CPV, mouse parvovirus MVM, human parvovirus B-19, or SV40 hairpin that is the source of SV40 replication, and may be further modified by truncation, substitution, deletion, insertion. In addition, TR may be partially or fully synthesized, such as the "double D sequence" described in US 5478745.

The "AAV-terminal repeats" or "AAV TRs" may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8,9, 10, 11, or any other known or later discovered AAV. It is not necessary to have a native terminal repeat sequence, for example, the native AAV TR sequence may be altered by insertion, deletion, truncation and/or missense mutations, so long as the terminal repeat mediates the desired function, e.g., replication, viral packaging, integration, and/or proviral rescue, etc.

The terms "recombinant AAV particle" and "recombinant AAV particle" may be used interchangeably. A "recombinant AAV particle" or "recombinant AAV particle" comprises a recombinant AAV vector genome packaged within an AAV capsid.

"substantially retains" a property means that at least about 75%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% of the property, e.g., activity or other measurable property, is retained.

II. Chimeric AAV capsids identified by directed evolution and in vivo screening

The inventors have identified "chimeric" or "shuffled" AAV capsid structures having features of interest, e.g., targeting properties and/or neutralizing properties. In particular embodiments, the chimeric AAV capsid exhibits high transduction of liver and/or low transduction of skeletal and/or cardiac muscle.

Thus, in some embodiments, the invention provides chimeric AAV capsids comprising or consisting essentially of, and viruses comprising the following amino acid sequences shown in figures 3B, 3D, 3F, 3H, 3J, 3L, 3N, 3P, or 3R.

In particular embodiments, the chimeric AAV capsid protein may comprise or consist essentially of, or consist of, the amino acid sequences shown in fig. 3B, fig. 3D, fig. 3F, fig. 3H, fig. 3J, fig. 3L, fig. 3N, fig. 3P, or fig. 3R, respectively.

Furthermore, in non-limiting embodiments, a chimeric AAV capsid protein of the invention can be encoded by a nucleic acid comprising or consisting essentially of a nucleotide sequence set forth in, or consisting of, the nucleotide sequences set forth in fig. 3A, fig. 3C, fig. 3E, fig. 3G, fig. 3I, fig. 3K, fig. 3M, fig. 3O, or fig. 3Q, respectively; or a nucleotide sequence encoding an AAV capsid or capsid protein encoded by any of the nucleotide sequences described above, but which differs from the nucleotide sequences described above due to the degeneracy of the codons. All amino acid position designations in the present specification and appended claims are in relation to VP1 numbering. One skilled in the art will appreciate that the modifications described herein may also result in alterations of the VP2 and/or VP3 capsid subunits due to the overlap of AAV capsid coding sequences.

The invention also provides chimeric AAV capsid proteins comprising or consisting essentially of, and methods for evaluating biological properties such as viral transduction and/or antibody neutralization are well known in the art.

Conservative amino acid substitutions are known in the art. In particular embodiments, conservative amino acid substitutions include one or more substitutions in the following group: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and/or phenylalanine, tyrosine.

The amino acid sequence of the chimeric AAV capsid protein shown in fig. 3B, 3D, 3F, 3H, 3J, 3L, 3N, 3P, 3R will be readily apparent to those skilled in the art to apply any other modification known in the art, by further modification to obtain the desired properties. For example, mutations at R484E and R585E in the AAV2 capsid sequence improve transduction of the heart by AAV vectors (Muller et al, 2006, cardiovacular Research 70. As a further non-limiting possibility of modification, the capsid proteins are modified to incorporate targeting sequences or sequences that facilitate purification and/or detection, e.g., the capsid proteins can be fused to all or part of glutathione-S-transferase, maltose binding protein, heparin/heparin sulfate binding domain, poly-HIS, ligands and/or reporters, immunoglobulin Fc fragment, single chain antibody, hemagglutinin, C-MYC, tag epitopes, etc. to form a fusion protein. Methods of inserting targeting peptides into AAV capsids are known in the art, for example, international patent nos. WO00/28004; nicklin et al, 2001, molecular Therapy 474-181; white et al, 2004, circulation 109; muller et al, 2003, nature Biotech 21.

The virus of the invention may further comprise a dual viral genome as described in international patent WO01/92551 and US patent US 7465583.

The invention also provides recombinant virions comprising a chimeric AAV capsid protein of the invention, wherein the vector genome is enveloped in a virion, preferably an AAV vector genome. In particular embodiments, the invention provides a recombinant AAV particle comprising a chimeric AAV capsid protein of the invention, wherein the AAV vector genome is encapsidated in an AAV capsid.

In particular embodiments, the virus is a recombinant vector comprising a heterologous nucleic acid of interest. Thus, the invention is useful for delivering nucleic acids to cells in vitro and in vivo. In representative embodiments, the recombinant vectors of the invention are used to deliver or transfer nucleic acids to animal cells, preferably mammalian cells.

Any heterologous nucleotide sequence can be delivered by the viral vectors of the invention. Nucleic acids of interest include nucleic acids encoding polypeptides, optionally therapeutic polypeptides and/or immunogenic polypeptides.

Therapeutic polypeptides include, but are not limited to, any of insulin, glucagon, growth hormone, parathyroid hormone, growth hormone releasing factor, follicle stimulating hormone, luteinizing hormone, human chorionic gonadotropin, vascular endothelial growth factor, angiopoietin, angiostatin, granulocyte colony stimulating factor, erythropoietin, connective tissue growth factor, basic fibroblast growth factor, acidic fibroblast growth factor, epidermal growth factor, platelet-derived growth factor, insulin growth factors I and II, any of the transforming growth factor alpha superfamily, activin, inhibin, bone morphogenetic protein, any of the polypeptides, including but not limited to, insulin, glucagon, parathyroid hormone, growth hormone, follicle stimulating hormone, luteinizing hormone, human chorionic gonadotropin, vascular endothelial growth factor, angiopoietin, angiostatin, granulocyte colony stimulating factor, erythropoietin, connective tissue growth factor, basic fibroblast growth factor, acidic fibroblast growth factor, epidermal growth factor, platelet-derived growth factor, insulin, growth factor I, and/II, transforming growth factor alpha superfamily, and/alpha superfamily nerve growth factor, brain derived neurotrophic factor, neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor, glial cell line derived neurotrophic factor, collectin, any of the semaphorin/disruption protein family, netrin-1 and netrin-2, hepatocyte growth factor, ephrin, noggin, sonic hedgehog protein and tyrosine hydroxylase, thrombopoietin, interleukins IL-1 to 1L-25, monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, fas ligand, tumor necrosis factor alpha and beta, interferons alpha, beta and gamma, stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system, including but not limited to immunoglobulin 1gG, igM, igA, igD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and II MHC molecules and engineered immunoglobulins, complement regulatory proteins, membrane cofactor proteins, decay accelerating factors, CR1, CF2 and CD59, low density lipoprotein receptors, high density lipoprotein receptors, very low density lipoprotein receptors and scavenger receptors, glucocorticoid receptors and estrogen receptors, vitamin D receptors and other nuclear receptors, jun/fos, max, mad, serum effector, AP-1, AP2, myb, myoD and myogenin, TFE3, E2F, ATF 1, ATF2, ATF3, ATF4, ZF5, AT, GAB, HNF-4, C/EBP, CCAAT-cassette binding protein, interferon regulatory factor, tumor cell binding protein, willebox binding protein, head binding protein, STAT-head binding protein, and head binding protein, carbamoyl synthetase 1, ornithine transcarbamylase, argininosuccinate synthetase, argininosuccinate lyase, arginase, fumarylacetoacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucosidase, glucose-6-phosphatase, porphobilinogen deaminase, cystathionine B synthase, branched chain ketoacid decarboxylase, isovaleryl-CoA dehydrogenase, propionyl-CoA carboxylase, methylmalonyl-CoA mutase, glutaryl-CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, beta-glucosidase, phosphorylase, beta-glucosidase, beta-phosphorylase, and the like, H-protein, T-protein, cystic fibrosis transmembrane conductance regulator, dystrophin, alpha-galactosidase, beta-galactosidase, lysosomal enzyme, coagulation factors, and any other polypeptide having a therapeutic effect in an individual in need thereof.

Heterologous nucleotide sequences encoding polypeptides include sequences encoding reporter polypeptides. The reporter gene known in the art encodes a polypeptide, including but not limited to green fluorescent protein, beta-galactosidase, alkaline phosphatase, luciferase, chloramphenicol acetyltransferase, and the like.

In another aspect, the heterologous nucleic acid may encode an antisense oligonucleotide, including ribozymes, interfering RNAs, including small interfering RNAs that mediate gene silencing (Sharp et al, 2000, science 287 2431), microRNAs, other untranslated functional RNAs, such as "guide" RNAS (Gorman et al, 1998, proc. Nat. Acad. Sci. USA 95.

It is known in the art that antisense nucleic acids and inhibitory RNA sequences can induce "exon skipping". Thus, the heterologous nucleic acid may encode an antisense nucleic acid or an inhibitory RNA, inducing appropriate exon skipping.

Ribozymes are RNA protein complexes that cleave nucleic acids in a site-specific manner. Ribozymes have specific catalytic domains with endonuclease activity (Kim et al, 1987, proc.natl.acad.sci.usa 84.

microRNAs are natural cellular RNA molecules that regulate the expression of multiple genes by controlling the stability of mRNA. Overexpression or reduction of specific micrornas can be used to treat dysfunction and has been shown to be effective in a number of disease states and animal models of disease (Couzin, 2008, science 319. Chimeric AAVs are useful for introducing micrornas into cells, tissues and subjects for treating genetic and acquired diseases, or for enhancing the function and promoting growth of certain tissues, e.g., mir-1, mir-133, mir-206 and/or mir-208 can be used to treat cardiac and skeletal muscle diseases (Chen et al, 2006, genet 38, 228-233 van Rooij et al, 2008, trends genet.24, 159-166), micrornas can also be used to regulate the immune system post-gene delivery (Brown et al, 2007, blood 110.

The term "antisense oligonucleotide," including "antisense RNA," as used herein, refers to a nucleic acid that is complementary to, and specifically hybridizes to, a particular DNA or RNA sequence. Antisense oligonucleotides and nucleic acids encoding the same can be made according to conventional techniques.

One of skill in the art understands that an antisense oligonucleotide need not be fully complementary to a target sequence, so long as the sequence is similar enough to specifically hybridize the antisense nucleotide sequence to the target sequence and reduce production of a protein product, e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. To determine the specificity of hybridization, hybridization of such oligonucleotides to target sequences can be carried out under conditions of weak, medium, or even stringent conditions.

Antisense oligonucleotides can be synthesized by chemical synthesis and enzyme-binding reactions by procedures known in the art. For example, an antisense oligonucleotide can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides for the purpose of increasing the biological stability of the molecule and/or increasing the stability of the duplex formed between the antisense and sense strands, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.

Modified nucleotides useful for the production of antisense oligonucleotides, including 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyl uracil, dihydrouracil, β -D-galactosylquinoline, inosine, N6-isopentenyllysine, 1-methylguanine, 1-methylinosine, 2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytidine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β -D-mannosylquinoline, 5' -methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenylamine, uracil-5-oxyacetic acid, quinoline, 2-thiocytosine, 5-methyl-2-thiouracil, 4-methylthiouracil, 5-diaminouracil, 5-6-thioacetic acid, 5-diaminouracil, 5-methyl-thiouracil, 5-6-thiouracil, 5-diaminouracil, and the like.

The antisense oligonucleotide may be chemically modified to covalently bind to another molecule. For example, the antisense oligonucleotide may be conjugated to a molecule that facilitates delivery to the cell of interest, enhances absorption through the nasal mucosa, provides a detectable label, increases the bioavailability of the oligonucleotide, increases the stability of the oligonucleotide, or improves formulation or pharmacokinetic properties, among others. Conjugated molecules include, but are not limited to, cholesterol, lipids, polyamines, polyamides, polyesters, reporter molecules, biotin, dyes, polyethylene glycol, human serum albumin, enzymes, antibodies or antibody fragments or cellular receptor ligands.

Other modifications to nucleic acids to improve stability, nuclease resistance, bioavailability, formulation characteristics, and/or pharmacokinetic properties are also known in the art.

RNA interference is a mechanism of post-transcriptional gene silencing by introducing double-stranded RNA (DsRNA) corresponding to a target sequence into a cell or organism, resulting in degradation of the corresponding mRNA. The mechanisms by which RNAi effects gene silencing have been reported in various review articles (Sharp et al, 2001, genes Dcv 15, 485-490. RNAi effects persist through multiple cell divisions before gene expression is restored. Therefore, RNAi is an effective method for targeted knock-outs at the RNA level. RNAi has proven successful in human cells, including human embryonic kidney and HeLa cells (Elbashir et al, 2001, nature 411. It has been demonstrated that short synthetic dsrnas of about 21 nucleotides, also known as "short interfering RNAs", can mediate silencing in mammalian cells without triggering an antiviral response (Elbashir et al, 2001, nature 411 494-498, caplen et al, 2001, proc.nat acad.sci.98.9742.

RNAi molecules can be short hairpin RNAs (Paddis et al, 2002, PNAS USA 99, 1443-1448) which are processed in cells by RNaseIII cleavage into sirna molecules 20-25 in length. ShRNA typically has a stem-loop structure, i.e., two inverted repeats linked by a short spacer sequence.

Methods for generating RNAi include chemical synthesis, in vitro transcription, dicer digestion of long dsRNA in vitro or in vivo, expression of delivery vectors in vivo, and expression of RNAi expression cassettes from PCR sources in vivo.

The antisense region of the RNAi molecule can be completely complementary to the target sequence, but need not be completely complementary to the target sequence so long as it specifically hybridizes to the target sequence and reduces production of the protein product, e.g., by at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. In some embodiments, hybridization of the oligonucleotide to a target sequence can be performed under conditions of weak stringency, moderate stringency, or even high stringency as defined above.

In other embodiments, the antisense region of the RNAi has at least about 60%, 70%, 80%, 90%, 95%, 97%, 98% or more sequence identity to the target sequence and reduces production of the protein product by at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. In some embodiments, the antisense region comprises 1, 2, 3, 4, 5, 6, 7, 8,9, or 10 mismatches compared to the target sequence. Mismatches are generally more acceptable at the ends of the dsRNA than in the central portion. RNAi molecules can comprise modified sugars, modified nucleotides, backbone linkages, and other modifications of the antisense oligonucleotides described above.

The invention also provides recombinant viral vectors expressing the immunogenic polypeptides. The heterologous nucleic acid can encode any immunogen of interest known in the art, including but not limited to from human immunodeficiency virus, influenza virus, gag protein, tumor antigens, cancer antigens, bacterial antigens, viral antigens, and the like. Alternatively, the immunogen may be present in the viral capsid, e.g. bound to the viral coat by covalent modification.

Parvoviruses are known in the art for use as vaccines (US 5916563, US5905040, US 5882652). The antigen may be present in the viral capsid or the antigen may be expressed from a heterologous nucleic acid introduced into the recombinant vector genome.

The immunogenic polypeptide or immunogen may be any polypeptide suitable for protecting a subject against disease, including but not limited to microbial, bacterial, protozoan, parasitic, fungal and viral diseases. The immunogen may be a pro-myxovirus immunogen, for example, an influenza virus immunogen, an influenza virus hemagglutinin surface protein or an influenza virus nucleoprotein gene; or a lentiviral immunogen, e.g., an equine infectious anemia virus immunogen, a simian immunodeficiency virus immunogen, or a human immunodeficiency virus immunogen; or an arenavirus immunogen, e.g., a lassa fever virus immunogen; or a poxvirus immunogen, a flavivirus immunogen, a filovirus immunogen, a bunyavirus immunogen, a coronavirus immunogen or a severe acute respiratory syndrome immunogen. The immunogen may also be a polio immunogen, a herpes immunogen, a mumps immunogen, a measles immunogen, a rubella immunogen, a diphtheria toxin or other diphtheria immunogen, a pertussis antigen, a hepatitis immunogen, or any other vaccine immunogen known in the art.

Alternatively, the immunogen may be any tumor or cancer cell antigen. Optionally, the tumor or cancer antigen is expressed on the surface of a cancer cell. Exemplary cancer and tumor antigens include, but are not limited to: BRCA1 gene product, BRCA2 gene product, GP100, tyrosinase, GAGE-1/2, RAGE, NY-ESO-1, CDK-4, 3-catenin, MUM-1, caspase-8, HPVE, SART-1, PRAME, p15, melanoma tumor antigen, HER-2/neu gene product, estrogen receptor, milk fat globulin, p53 tumor suppressor, mucin antigen, telomerase, nuclear matrix protein, prostatic acid phosphatase, papilloma virus antigen, and antigens associated with cancers including melanoma, adenocarcinoma, thymoma, sarcoma, lung cancer, liver cancer, colorectal cancer, non-Hodgkin lymphoma, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer, kidney cancer, gastric cancer, esophageal cancer, and head and neck cancer.

Alternatively, the heterologous nucleotide sequence may encode any polypeptide produced in a cell in vitro or in vivo. For example, a viral vector may be introduced into cultured cells and the expressed protein product isolated therefrom.

One skilled in the art understands that the heterologous nucleic acid of interest can be operably linked to appropriate control sequences. For example, the heterologous nucleic acid may be linked to an expression control element such as a transcriptional translational control signal, origin of replication, polyadenylation signal, internal ribosome entry sites, promoter, enhancer, or the like.

One skilled in the art will further appreciate that various promoter/enhancer elements may be used depending on the desired expression level and tissue specific expression. Promoters/enhancers may be constitutive or inducible, depending on the desired expression pattern. Promoters/enhancers may be natural or foreign, and may be natural or synthetic sequences.

The promoter/enhancer element may be native to the target cell or subject, or may be native to a heterologous nucleic acid sequence. The promoter/enhancer element is typically selected so that it functions in the target cell of interest. In representative embodiments, the promoter/enhancer element is a mammalian promoter/enhancer element, which may be constitutive or inducible.

Inducible expression control elements are commonly used in applications where regulation of overexpression of a heterologous nucleic acid sequence is desired. Inducible promoter/enhancer elements for gene delivery can be tissue specific or tissue preferred promoter/enhancer elements and include muscle specific or preferred, neural tissue specific or preferred, eye (including retina specific and corneal) specific or preferred, liver specific or preferred, bone marrow specific or preferred, pancreas specific or preferred, spleen specific or preferred, lung specific or preferred. Other inducible promoter/enhancer elements include hormone inducible and metal inducible elements. Exemplary inducible promoter/enhancer elements include, but are not limited to, the Tet on/off element, the RU 486-inducible promoter, the rapamycin-inducible promoter, and the metallothionein promoter.

In embodiments where the heterologous nucleic acid sequence is transcribed and translated in the target cell, specific initiation signals are typically used to effect translation of the inserted protein-coding sequence. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, may be initiated in a variety of forms, including natural and synthetic.

The invention provides chimeric AAV particles comprising a chimeric AAV capsid and an AAV genome. The invention also provides a collection or library of such chimeric AAV particles, wherein the collection or library comprises 2 or more, 10 or more, 50 or more, 10 ² Or more, 10 ³ Or more, 10 ⁴ Or more, 10 ⁵ Or more, or 10 ⁶ Or more different sequences.

The invention also includes "empty" capsid particles comprising, consisting of, or consisting essentially of the chimeric AAV capsid proteins of the invention, as described in US 5863541. Chimeric AAV capsids of the invention can be used as "capsid carriers," molecules that can be covalently linked, bound, or packaged and transferred into cells include DNA, RNA, lipids, carbohydrates, polypeptides, small organic molecules, or combinations of these molecules. In addition, the molecule can be associated with the exterior of the viral capsid in order to transfer the molecule into a target cell of the host. In one embodiment of the invention, the molecule is covalently linked to the capsid protein. Methods for covalently linking molecules are well known to those skilled in the art.

The viral capsids of the invention can also be used to raise antibodies against new capsid structures. Alternatively, the exogenous amino acid sequence can be inserted into a viral capsid in order to present an antigen to a cell, e.g., administered to a subject to generate an immune response to the exogenous amino acid sequence.

The invention also provides nucleic acids encoding the chimeric capsid proteins of the invention. Further provided are vectors comprising said nucleic acids and cells comprising the nucleic acids and/or vectors of the invention. For example, the nucleic acids, vectors, and cells can be used as reagents to produce the viral vectors described herein.

In exemplary embodiments, the invention provides a nucleic acid sequence encoding an AAV capsid as depicted in figure 3B, 3D, 3F, 3H, 3J, 3L, 3N, 3P, or 3R. Representative nucleic acid sequences comprise or consist essentially of, or consist of, the nucleotide sequences shown in fig. 3A (L1) fig. 3C (L4), fig. 3E (L10), fig. 3G (L52), fig. 3I (L58), fig. 3K (L84), fig. 3M (L37), fig. 3O (L107), or fig. 3Q (L57), respectively, or the nucleotide sequences shown in these figures, or nucleotide sequences encoding AAV capsid or capsid protein encoded by any of the above nucleotide sequences, but differing from the above nucleotide sequences due to codon degeneracy, which allows different nucleic acid sequences to encode the same AAV capsid.

The invention also provides nucleic acids encoding variants and fusion proteins of the above-described AAV capsid proteins. In particular embodiments, the nucleic acid hybridizes to the complementary strand of the nucleic acid sequences specifically disclosed herein under standard conditions known to those of skill in the art, encoding a variant capsid protein. The nucleic acid sequences specifically disclosed herein, with reference to fig. 3A, fig. 3C, fig. 3E, fig. 3G, fig. 3I, fig. 3K, fig. 3M, fig. 3O, or fig. 3Q, optionally, the variant capsid protein substantially retains at least one property of the capsid protein encoded by the nucleic acid sequences shown in fig. 3A, fig. 3C, fig. 3E, fig. 3G, fig. 3I, fig. 3K, fig. 3M, fig. 3O, or fig. 3Q. For example, a virion with a variant capsid protein can substantially retain the targeting characteristics of a virion comprising a capsid protein encoded by a nucleic acid coding sequence as shown in figure 3A, figure 3C, figure 3E, figure 3G, figure 3I, figure 3K, figure 3M, figure 3O, figure 3Q. Hybridization of such sequences can be carried out under weak, medium or even stringent conditions (Sambrook et al, 1989, molecular cloning, A Laboratory Manual 2d Ed, cold Spring Harbor Laboratory).

As is known in the art, many different procedures can be used to determine whether a nucleic acid or polypeptide has a percent identity or similarity to a known sequence. Percent identity, as used herein, refers to a nucleic acid or fragment thereof having a specified percentage of another nucleic acid when aligned with another nucleic acid using BLASTN, which is available from the National Center for Biotechnology Information (NCBI) via the internet.

When referring to a polypeptide, percent identity or similarity indicates that the polypeptide exhibits a particular percent identity or similarity when compared to another protein or portion thereof over a common length as determined using BLASTP. This is also available from the National Center for Biotechnology Information (NCBI) through the Internet. The percent identity or similarity of polypeptides is typically determined using sequence analysis software, for example, see the sequence analysis software package of the genetics computer group at the university of wisconsin biotechnology center. Protein analysis software uses the homology of various substitutions, deletions and other modifications to match similar sequences. Conservative substitutions typically include substitutions in the following classes: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.

In particular embodiments, the nucleic acid may comprise, consist of, or consist essentially of, but is not limited to, a plasmid, a phage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome, among other vectors. Viral vectors include, but are not limited to, adeno-associated viral vectors, adenoviral vectors, herpes viral vectors, baculovirus vectors, or hybrid viral vectors.

In some embodiments, the nucleic acid encoding the chimeric AAV capsid protein further comprises an AAV Rep protein coding sequence.

The invention also provides cells stably comprising a nucleic acid of the invention. For example, the nucleic acid may be stably transformed into the genome of the cell, or may be stably maintained in an episomal form, e.g., an "EBV-based nuclear episome.

The nucleic acid can be inserted into a delivery vector, e.g., a viral delivery vector. For example, the nucleic acids of the invention may be encapsulated in AAV particles, adenovirus particles, herpesvirus particles, baculovirus particles, or any other suitable virus particles.

In addition, the nucleic acid may be operably linked to a promoter element.

The invention also provides a method for producing the viral vector of the invention. In one representative embodiment, the invention provides a method of producing a recombinant viral vector, the method comprising providing to a cell in vitro, comprising a heterologous nucleic acid and a signal sequence, e.g., an AAV terminal repeat, sufficient to package an AAV template into a virion; also included are AAV sequences sufficient to replicate and package the template into a virion, such as AAV Rep sequences, and sequences encoding the AAV capsids of the invention. The method may further comprise the step of collecting viral particles from the cells, which viral particles may be collected from the culture medium and/or lysed cells.

In an illustrative embodiment, the invention provides a method of making a recombinant AAV particle comprising an AAV capsid, the method comprising: providing a nucleic acid encoding a chimeric AAV capsid of the present invention, an AAV Rep coding sequence, an AAV vector genome comprising a heterologous nucleic acid, and a helper factor for production of infectious AAV to cells in vitro allows the AAV vector genome to be encapsulated in the AAV capsid and complete assembly of the AAV particle.

The cell is typically one that allows replication of the AAV virus. Any suitable cell known in the art may be used, including, but not limited to, one or more of a HEK293 cell line, a HEK293T cell line, a HEK293A cell line, a HEK293S cell line, a HEK293FT cell line, a HEK293F cell line, a HEK293H cell line, a HeLa cell line, a SF9 cell line, a SF21 cell line, a SF900 cell line, a BHK cell line.

AAV replication and capsid sequences can be provided by any method known in the art. Current methods typically express AAV rep and cap genes on a single plasmid. AAV replication and packaging sequences need not be provided together. The AAV rep and/or cap gene sequences may be provided by any viral or non-viral vector. For example, rep and/or cap gene sequences may be provided by a hybrid adenovirus or herpes virus vector. EBV vectors can also be used to express AAVcap and/or rep gene sequences. Alternatively, the rep and/or cap gene sequences may be stably present in the cell, in an episomal or integrated state.

Typically, AAV rep and/or cap gene sequences are not surrounded by AAV packaging sequences to prevent rescue and/or packaging of these sequences.

The template or vector genome may be provided to the cell using any method known in the art. The template or vector genome may be provided by a non-viral vector or a viral vector. In particular embodiments, the template or vector genome is provided by a herpesvirus or adenovirus vector. Baculovirus vectors, EBV vectors can also be used to deliver the template or vector genome. In another representative embodiment, the template or vector genome is provided by a replicating rAAV virus. In other embodiments, the AAV provirus is stably integrated into the chromosome of the cell.

To obtain maximal viral titers, the cells are usually supplied with helper viruses, such as adenovirus or herpes virus, which are necessary for the production of infectious AAV. Helper viral sequences, known in the art to be necessary for AAV replication, are typically provided by helper adenovirus or herpesvirus vectors. Alternatively, the adenoviral or herpesvirus sequence may be provided by another non-viral or viral vector (Ferrari et al, 1997, nature Med.3. Furthermore, helper virus function can be provided by integration of the helper gene in the chromosome of the packaging cell or maintained as a stable extrachromosomal element.

It is understood by those skilled in the art that it may be advantageous to provide AAV replication and capsid sequences as well as helper viral sequences on a single helper construct. The helper construct may be a non-viral or viral construct, and may alternatively be a hybrid adenovirus or a hybrid herpesvirus comprising the AAV rep/cap gene sequence.

In a particular embodiment, the AAV rep and/or cap gene sequences and adenoviral helper sequences are provided by a single adenoviral helper vector. This vector further comprises a rAAV genomic template. AAV rep and/or cap sequences and/or rAAV templates may be inserted into deleted regions of the adenovirus, e.g., the Ela or E3 regions.

In another embodiment, the AAV rep and/or cap sequences and adenoviral helper sequences are provided by a single adenoviral helper vector. The rAAV genome template is provided by a plasmid. In another illustrative embodiment, the AAV rep and/or cap sequences and adenoviral helper sequences are provided by a single adenoviral helper vector, and the rAAV genomic template is integrated into the cell as a precursor. Alternatively, the rAAV template is provided by an EBV vector maintained intracellularly as an extrachromosomal element. In another exemplary embodiment, the AAV rep and/or cap sequences and adenoviral helper sequences are provided by a single adenoviral vector. The rAAV genome template is provided as a separate replicating viral vector. For example, the rAAV template may be provided by a rAAV particle or a second recombinant adenovirus particle.

Herpes viruses are also used as helper viruses in AAV packaging methods.

As another alternative, the viral vectors of the invention may be used to deliver rep and/or cap genes and rAAV templates in insect cells using baculovirus vectors (Urabe et al, 2002, human Gene Therapy 13 1935-1943).

Other methods of producing AAV can also use stably transformed packaging cells (see U.S. Pat. No. 5,5658785).

AAV vectors free of helper virus contamination can be obtained by any method known in the art. For example, AAV and helper viruses can be readily distinguished by size. AAV can also be isolated from helper virus based on affinity for heparin substrates. In representative embodiments, replication-defective helper viruses are used such that any contaminating helper virus is unable to replicate. Alternatively, helper adenoviruses lacking late gene expression may be used, as only adenoviral early gene expression mediates packaging of AAV virus. Adenoviral mutants deficient in late gene expression, e.g., TS100K and TS149 adenoviral mutants, are known in the art.

The packaging methods of the invention can be used to produce high titer viral particles. In particular embodiments, the titer of the viral stock is at least about 10 ⁵ Tu/ml, at least about 10 ⁶ Tu/ml, at least about 10 ⁷ Tu/ml, at least about 10 ⁸ Tu/ml, at least about 10 ⁹ Tu/ml, at least about 10 ¹⁰ Tu/ml。

The novel capsid proteins and capsid structures are useful for the production of antibodies, e.g., for diagnostic or therapeutic use or as research reagents. Accordingly, the invention also provides antibodies against the novel capsid proteins of the invention.

The term "antibody" or "antibody fragment" as used herein refers to all types of immunoglobulins, including IgG, igM, igA, igD, and IgE. The antibody may be monoclonal or polyclonal and may be derived from any species, including mouse, rat, rabbit, horse, goat, sheep, chicken, monkey, alpaca or human, or may be a chimeric, humanized, human antibody. The antibody may be a recombinant monoclonal antibody, or screened from a phage library, a yeast library, a mammalian cell display library.

Antibody fragments encompassed within the scope of the invention include Fab, F (ab') ₂ And Fc fragments, as well as corresponding fragments obtained from antibodies other than IgG. Such fragments may be produced by known techniques. For example, F (ab') ₂ Fragments may be produced by pepsin digestion of an antibody molecule, and Fab fragments may be produced by reducing F (ab') ₂ Disulfide bonding of the fragments occurs. Alternatively, fab expression libraries can be constructed to quickly and easily identify monoclonal Fab fragments with the desired specificity.

Polyclonal antibodies can be obtained by immunizing a suitable animal, such as a rabbit, a goat, etc., with a virus, collecting immune serum from the animal, and isolating the immune serum.

The invention also includes methods of delivering heterologous nucleotide sequences to a wide range of cells, including dividing and non-dividing cells. The viral vectors of the invention can be used to deliver nucleotide sequences of interest to cells in vitro, e.g., to produce polypeptides in vitro or for in vitro gene therapy. The vectors may also be used in methods of delivering a nucleotide sequence to an individual in need thereof, e.g., to express an immunogenic or therapeutic polypeptide.

In general, the viral vectors of the invention can be used to deliver any exogenous nucleic acid having a biological effect to treat or ameliorate any disease associated with gene expression. Furthermore, the invention may be used to treat any disease for which delivery of a therapeutic polypeptide may be improved. Exemplary disease symptoms include, but are not limited to: cystic fibrosis (cystic fibrosis transmembrane regulator) and other diseases of the lung, hemophilia A (factor VIII), hemophilia B (factor IX), thalassemia (β -globin), anemia (erythropoietin) and other blood diseases, senile dementia (GDF), multiple sclerosis (interferon-beta), parkinson's disease (glial cell line-derived neurotrophic factor), huntington's disease (abrogated inhibitory RNA including but not limited to RNAi such as siRNA or shRNA, antisense RNA or microRNA), amyotrophic lateral sclerosis, epilepsy (galanin, neurotrophic factor) and other neurological diseases, cancer (endostatin, angiostatin, TRAIL, FAS ligand, cytokines including interferons, inhibitory RNA that inhibits VEGF including but not limited to siRNA, shRNA, antisense RNA, microRNA, multidrug-resistant gene products, cancer immunogens), diabetes (insulin, PGC- α 1, GLP-1, myostatin precursor peptide, glucose transporters), dystrophies including Duchenne dystrophies and beck's, dystrophies such as phospholipases (e.g. enzyme), dystrophies (e.g. phospho- α -kallikrein-phospho), diseases such as phospho-kallikrein-e-like, and dystrophies (e), and dystrophies such as phospho), and dystrophies (e-s), diseases such as autoimmune diseases, retinal degenerative diseases and other diseases of the eye and retina (PDGF, endostatin and/or angiostatin to treat macular degeneration), astrocytomas (endostatin, angiostatin and/or RNAi to inhibit VEGF), glioblastomas (endothelial growth factor, vascular endothelial growth factor and/or RNAi anti-vascular endothelial growth factor), liver (RNAi for hepatitis b and/or hepatitis c genes, e.g., siRNA or shRNA, microRNA or antisense RNA), congestive heart failure or peripheral artery disease (phosphatase protein inhibitor I, phospholipase, intrasarcoplasmic network Ca2-ATPase, zinc finger protein regulating phospholipase gene, phospholipase inhibitor, etc.), arthritis (insulin-like growth factor), aids (soluble CD 4), muscle atrophy (insulin-like growth factor I, myostatin pro peptide, anti-apoptotic factor, etc.), limb ischemia (VEGF, PGC-I α, EC-SOD, HIF), kidney deficiency (erythropoietin), arthritis (anti-inflammatory factors such as soluble receptors like IRAP and TNF α), hepatitis (α -interferon), low density lipoprotein receptor deficiency (lack of avian receptors), high phenylalanine aminotransferase (LDL receptor), urinary transaminase (phenylalanine aminotransferase), and other diseases (e.g., ammoniation diseases).

The invention may also be used to increase the success of transplantation and/or reduce the side effects of organ transplantation or adjuvant therapy after organ transplantation, e.g., by blocking cytokine production by administration of immunosuppressive or inhibitory nucleic acids.

Gene transfer has great potential use in the recognition and treatment of disease. There are many genes defective in genetic diseases that are known and have been cloned. In general, the above disease states fall into two categories: the first is a defective state, usually an enzyme defect, usually inherited in a recessive manner; the second is an unbalanced state, possibly involving regulatory or structural proteins, usually inherited in a dominant fashion. For defective conditions, gene transfer can bring normal genes into the affected tissues for replacement therapy, as well as create animal models for the disease using inhibitory RNAs, including siRNA or shRNA, microRNA, or antisense RNA. For unbalanced disease states, gene transfer can be used to create a disease state in the model system, which can then be used to treat the disease state. Thus, the viral vector according to the invention allows the treatment of genetic diseases. As used herein, a disease state is treated by a defect or imbalance that partially or wholly remedies or aggravates the disease.

In addition, the viral vectors of the invention have further utility in diagnostic and screening methods wherein the gene of interest is transiently or stably expressed in a cell culture system or transgenic animal model. The invention may also be used to deliver nucleic acids for protein production, e.g., for laboratory, industrial, or commercial purposes.

Alternatively, the viral vector can be administered to the cells and the altered cells to the subject. Introducing a heterologous nucleic acid into the cell, and administering the cell to the subject, wherein the heterologous nucleic acid encoding the immunogen is optionally expressed and induces an immune response in the subject to the immunogen. In particular embodiments, the cell is an antigen presenting cell, such as a dendritic cell.

An "active immune response" or "active immunity" is characterized by "involvement of host tissues and cells after contact with an immunogen". It involves the differentiation and proliferation of immunoregulatory cells in lymphoid tissues, resulting in antibody synthesis or cell-mediated responses, or both. Alternatively, the host may be exposed to an immunogen, either by infection or vaccination, and a positive immune response may result. Active immunization can be contrasted with passive immunization, which is achieved by "transferring a preformed substance, such as an antibody, transfer factor, thymic graft, interleukin-2, from an actively immunized host to a non-immunized host".

As used herein, "protective" immune response or "protective" immunity indicates that the immune response imparts some benefit to the subject in that it may prevent or reduce the incidence of disease. Alternatively, the protective immune response or protective immunity may be used to treat a disease, particularly a cancer or tumor, e.g., to cause regression of the cancer or tumor and/or to prevent metastasis and/or to prevent the growth of metastatic nodules. The protective effect may be complete or partial, as long as the therapeutic benefit is greater than the disadvantage.

The viral vectors of the invention may also be used in cancer immunotherapy by administering cancer cell antigens or immunologically similar molecules or any other immunogen to generate an immune response against cancer cells. For example, in treating a cancer patient, an immune response to a cancer cell antigen in the subject can be generated by administering a viral vector comprising a heterologous nucleotide sequence encoding the cancer cell antigen. As described herein, the viral vectors can be administered to a subject in vitro or by in vitro methods.

As used herein, the term "cancer" includes tumor-forming cancers. Similarly, the term "cancerous tissue" also includes tumors. "cancer cell antigens" include tumor antigens.

The term "cancer" has its understood meaning in the art, e.g., with uncontrolled tissue growth that spreads or metastasizes to remote sites in the body. Exemplary cancers include, but are not limited to, leukemia, lymphoma, colorectal cancer, renal cancer, liver cancer, breast cancer, lung cancer, prostate cancer, testicular cancer, ovarian cancer, uterine cancer, cervical cancer, brain cancer, bone cancer, sarcoma, melanoma, head and neck cancer, esophageal cancer, thyroid cancer, and the like. In embodiments of the invention, the invention is practiced to treat and/or prevent neoplasia cancer.

Cancer cell antigens have been described above. The term "treating cancer" is intended to reduce the severity of the cancer, prevent or at least partially eliminate the cancer. For example, in certain instances, these terms indicate that the treatment of cancer is prophylactic or reducing, or at least partially abrogating. In yet another representative embodiment, these terms indicate that the growth of metastatic nodules is prevented or reduced or at least partially eliminated, for example, after surgical resection of the primary tumor. According to the term "preventing cancer", it is intended to at least partially eliminate or reduce the incidence or incidence of cancer. In other words, the subject's cancer onset or progression may be slowed, controlled, reduced or delayed in likelihood or probability.

In particular embodiments, cells can be removed from an individual having cancer and contacted with a viral vector of the invention. The modified cells are then administered to a subject, thereby eliciting an immune response to the cancer cell antigen. This method is particularly useful in immunocompromised subjects who are unable to produce an adequate immune response in vivo, i.e., produce an adequate amount of boosting antibodies.

It is known in the art that immunomodulatory cytokines, such as alpha-interferon, beta-interferon, gamma-interferon, omega-interferon, tau-interferon, interleukin-l alpha, interleukin-1 beta, interleukin-2, interleukin-3, interleukin-4, interleukin 5, interleukin-6, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-11, interleukin 12, interleukin-13, interleukin-14, interleukin-18, B cell growth factor, CD40 ligand, tumor necrosis factor-alpha, tumor necrosis factor-beta, monocyte chemotactic protein-1, granulocyte-macrophage colony stimulating factor, and lymphotoxin, and immunomodulatory cytokines, such as CTL inducing cytokines, may be administered to a subject with a viral vector.

The cytokine may be injected by any method known in the art. Exogenous cytokines can be injected into a subject, or a nucleotide sequence encoding the cytokine can be delivered to the subject using a suitable vector, and the cytokine produced in vivo.

The recombinant viral vectors according to the invention can be used in veterinary and medical applications. Suitable subjects include birds and mammals. The term "avian" as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasants, parrots. The term "mammal" as used herein includes, but is not limited to, humans, primates, non-human primates, cows, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents, and the like. Human subjects include neonates, infants, juveniles, and adults. Optionally, the individual "in need of the methods of the invention, for example, because the individual has or is thought to have a risk of, or would benefit from, delivery of nucleic acids including the invention. As a further alternative, the subject may be a laboratory animal and/or an animal model of disease.

In particular embodiments, the invention provides pharmaceutical compositions comprising a viral vector of the invention in a pharmaceutically acceptable carrier, and optionally including other agents, stabilizers, buffers, carriers, adjuvants, diluents, and the like, the carrier for injection being generally a liquid. For other methods, the transport carrier may be either solid or liquid. For administration by inhalation, the carrier will be respirable, preferably in the form of solid or liquid particles.

"pharmaceutically acceptable" refers to a material that is non-toxic or otherwise undesirable in character, i.e., the material can be administered to a subject without producing any undesirable biological effects.

One aspect of the invention is a method of transferring a nucleotide sequence to a cell in vitro. Viral vectors can be introduced into cells at appropriate fold infection according to standard transduction methods appropriate for the particular target cell. The titer of the viral vector or capsid to be administered can vary depending on the cell type and number of the target cells and the particular viral vector or capsid. In particular embodiments, at least about 10 ³ Infectious unit, more preferably at least about 10 ⁵ The infectious unit is introduced into the cell.

The cells to be introduced into the viral vector may be of any type, including but not limited to neural cells, including cells of the peripheral and central nervous system, particularly brain cells, such as neurons, oligodendrocytes, glial cells, astrocytes, lung cells, ocular cells including retinal cells, retinal pigment epithelium and corneal cells, epithelial cells including intestinal and respiratory epithelial cells, skeletal muscle cells including myoblasts, myotubes and muscle fibers, diaphragm muscle cells, dendritic cells, pancreatic cells including pancreatic islet cells, liver cells, gastrointestinal tract cells including smooth muscle cells and epithelial cells, heart cells including cardiac muscle cells, bone marrow cells, hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, joint cells including, for example, cartilage, meniscus, synovium and bone marrow, germ cells, and the like. Alternatively, the cell may be a stem cell, e.g., a neural stem cell, a hepatic stem cell. Alternatively, the cell may be a cancer or tumor cell, such as the cancers and tumors described above. Furthermore, as noted above, the cells may be from any species of origin.

The viral vector can be introduced into cells ex vivo to administer the modified cells to a subject. In particular embodiments, the cells are removed from the individual, into which the viral vector is introduced, and then returned to the individual. Methods of removing cells from a subject for in vitro therapy and then reintroducing into the subject are known in the art, see, e.g., U.S. patent No. 5399346. Alternatively, the recombinant viral vector is introduced into cells from another individual, cultured cells, or cells from any other suitable source, and the cells are administered to the individual in need thereof.

Cells suitable for in vitro gene therapy are described above. The dosage of cells administered to a subject will vary with the age, condition and species of the subject, the cell type, the nucleic acid expressed by the cell, the mode of administration, and the like. Typically, at least 10 doses per dose are administered in a pharmaceutically acceptable carrier ² To 10 ⁸ Or about 10 ³ To about 10 ⁶ And (4) cells. In particular embodiments, cells transduced with a viral vector are administered to an individual in an effective amount in combination with a pharmaceutical carrier.

Another aspect of the invention is a method of administering a viral vector or capsid of the invention to a subject. In particular embodiments, the methods include a method of delivering a nucleic acid of interest to an animal subject, the method comprising: an effective amount of a viral vector of the invention is administered to an animal subject. The viral vectors of the invention can be administered to a human subject or an animal in need thereof by any method known in the art. Optionally, the viral vector is delivered in an effective dose in a pharmaceutically acceptable carrier.

The viral vectors of the invention may further be administered to a subject to elicit an immunogenic response, e.g., as a vaccine. Typically, the vaccines of the present invention comprise an effective amount of the virus in combination with a pharmaceutically acceptable carrier. Optionally, the dose is sufficient to produce a protective immune response. The degree of protection afforded need not be complete or permanent, so long as the benefit of the administration of the immunogenic polypeptide outweighs any deficiency thereof. The subject and immunogen are as described above.

The dose of viral vector injected into a subject will depend on the mode of administration, the disease or condition to be treated, the condition of the individual, the particular viral vector and the nucleic acid to be delivered, and can be determined in a conventional manner. An exemplary dosage to achieve a therapeutic effect is at least about 10 ⁵ ，10 ⁶ ，10 ⁷ ，10 ⁸ ，10 ⁹ ，10 ¹⁰ ，10 ¹¹ ，10 ¹² ，10 ¹³ ，10 ¹⁴ ，10 ¹⁵ Tu or more, preferably about 10 ⁷ Or 10 ⁸ ～10 ¹² ，10 ¹³ Or 10 ¹⁴ Tu, more preferably about 10 ¹² Viral titer of Tu.

In particular embodiments, more than one administration may be used, e.g., two, three, four or more administrations, and the desired level of gene expression may be achieved at different time intervals.

Examples of modes of administration include oral, rectal, mucosal, topical, intranasal, inhalation, buccal, vaginal, intrathecal, intraocular, transdermal, intrauterine, parenteral, intravenous, subcutaneous, intradermal, intramuscular, intradermal, intrapleural, intracerebral and intraarticular, cutaneous and mucosal surfaces, intralymphatic, etc., as well as direct tissue or organ injection, e.g., in the liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain. The administration to a tumor can also be, for example, injection within or near a tumor or lymph node. The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular vector used.

Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, or in solid forms suitable for liquid solutions or suspensions prior to injection, or as emulsions. Alternatively, the viral vector may be administered in a local rather than systemic manner, e.g., in a specific manner, such as a sustained release formulation. In addition, viral vectors can be delivered in dry form to surgical implant matrices, such as bone graft substitutes, sutures, stents, and the like.

Pharmaceutical compositions suitable for oral administration may be presented as discrete units, such as capsules, buffers, lozenges, or tablets, each unit containing a predetermined amount of a composition of the invention. As a powder or granules, as a solution or suspension in an aqueous liquid or a non-aqueous liquid, or as an oil-in-water or water-in-oil emulsion. Oral administration can be accomplished by incorporating the viral vectors of the present invention into a vector that is resistant to degradation by digestive enzymes in the intestinal tract of an animal. Examples of such carriers include capsules or tablets as known in the art. Such formulations are prepared by any suitable pharmaceutical method which includes the step of bringing the ingredients into association with a suitable carrier which may contain one or more accessory ingredients as described hereinbefore. In general, pharmaceutical compositions according to embodiments of the invention are prepared by uniformly and intimately admixing the compositions with liquid or finely divided solid carriers or both, and then shaping the resulting mixture. For example, tablets may be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients. Compressed tablets are prepared by compressing in a suitable machine the composition in a free-flowing form, such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent and/or surface active/dispersing agent. Tablets are formed by wetting the powdered compound with an inert liquid binder in a suitable machine.

Pharmaceutical compositions suitable for oral administration include lozenges comprising the ingredients of the invention in a flavoured base, typically sucrose and gum arabic or tragacanth, and lozenges comprising inert base ingredients such as gelatin and glycerol or sucrose and gum arabic.

Pharmaceutical compositions suitable for parenteral administration may comprise sterile aqueous and nonaqueous injection solutions of the compositions of the invention, which formulations are optionally isotonic with the blood of the intended recipient. These formulations may contain antioxidants, buffers, bacteriostats and solutes that render the components isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions and emulsions may include suspending agents and thickening agents. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters. Aqueous carriers include water, alcohol/water solutions, emulsions or suspensions, including saline and buffered media. Parenteral drugs include sodium chloride solution, ringer's dextrose, dextrose and sodium chloride, lactated ringer's or fixed oils. Carriers for intravenous injection include liquid and nutritional supplements, electrolyte supplements such as ringer's dextrose-based supplements, and the like. Preservatives and other additives such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like may also be present.

These ingredients may be presented in unit-dose or multi-dose containers, for example, in sealed ampoules and vials, and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection, immediately prior to use.

Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind described above. For example, the injectable, stable, sterile compositions of the present invention may be provided in unit dosage form in a sealed container. The composition may be provided in the form of a lyophilizate which may be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into an individual. The unit dosage form can be about 1 μ g to about 10g of the composition of the invention. When the composition is substantially water-insoluble, a sufficient amount of a physiologically acceptable emulsifier may be added to emulsify the composition in an aqueous carrier. One useful emulsifier is phosphatidylcholine.

Pharmaceutical compositions suitable for rectal administration may be presented as unit dose suppositories. These may be prepared by mixing the components with one or more conventional solid carriers and then forming the resulting mixture.

The pharmaceutical compositions of the present invention suitable for topical application to the skin may take the form of ointments, creams, lotions, pastes, gels, sprays, aerosols or oils. Carriers that can be used include, but are not limited to, petrolatum, lanolin, polyethylene glycols, alcohols, dermal penetration enhancers, and combinations of two or more thereof. For example, in some embodiments, topical delivery may be performed by mixing the pharmaceutical composition of the present invention with a lipophilic agent capable of entering the skin.

Pharmaceutical compositions suitable for transdermal administration may be in the form of discrete patches adapted to remain in intimate contact with the epidermis of the subject for an extended period of time. Compositions suitable for transdermal administration may also be delivered by iontophoresis and are generally in the form of an optionally buffered aqueous solution of the compositions of the present invention. Suitable formulations may comprise citrate or bis/tris buffers or ethanol/water and may contain 0.1 to 0.2M active ingredient.

The viral vectors disclosed herein can be administered to the lungs of a subject by any suitable method, such as by administering a suspension of respirable particles that consist of viral vectors inhaled by the subject. The inhalable particles may be liquid or solid. The aerosol of liquid particles comprising viral vectors may be generated by any suitable method, for example using a pressure driven aerosol nebulizer or an ultrasonic nebulizer known to those skilled in the art. Aerosols of solid particles comprising viral vectors may likewise be generated with any solid particle drug aerosol generator by techniques known in the medical arts.

III chimeric AAV capsid viral vector directed evolution and in vivo screening method

The invention also includes a method for preparing a viral bank comprising chimeric AAV capsids and then screening for chimeric AAV capsids or viruses having one or more desired properties in vivo. Non-limiting examples of desirable properties include targeting characteristics, the ability to evade neutralizing antibodies, and improved intracellular trafficking, among others.

In representative embodiments, the invention provides a method of identifying a viral vector, e.g., an AAV vector or AAV capsid, having a property of interest, the method comprising:

first, a collection of viral vectors, e.g., AAV particles, is provided, wherein each AAV vector within the collection comprises: comprising a capsid protein produced by shuffling the capsid coding sequences of two or more different AAVs, wherein the capsid amino acid sequences of the two or more different AAVs differ by at least two amino acids; and a viral vector genome, e.g., an AAV vector genome, comprising the AAV capsid protein coding sequence generated by the aforementioned shuffling, the coding sequence for one AAV Rep, and at least one terminal repeat, e.g., a 5 'and/or 3' terminal repeat of AAV, wherein the viral vector genome is encapsidated in an AAV capsid.

Second, administering to the subject a collection of viral vectors;

third, a plurality of viral vectors are recovered from the target tissue as virions or as viral vector genomes encoding AAV capsids, thereby identifying viral vectors or AAV capsids having the property of interest.

The invention can also be used to identify a chimeric AAV capsid or viral particle that has the ability to evade neutralizing antibodies in vivo, e.g., neutralizing antibodies found in human serum. For example, in vivo screening for neutralizing antibody resistance can be performed by injecting human immunoglobulin into a subject. For example, IVIG is injected into a non-human mammalian subject. IVIG naturally contains a mixture of antibodies against all common AAV in humans. Alternatively, the subject can be injected with a specific neutralizing antibody, and then a library of chimeric viruses can be injected into the subject, and the viral genome can be selected for entry into a target tissue of interest (e.g., heart, skeletal muscle, liver, etc.), the genome isolated from the target tissue corresponding to a capsid capable of evading neutralization.

Thus, in representative embodiments, the invention provides a method of identifying a chimeric AAV capsid or viral vector having the ability to evade neutralizing IgGs, the method comprising:

first, administering IgGs to a mammalian subject;

second, a collection of viral vectors, e.g., AAV particles, is provided, wherein each AAV vector within the collection comprises: comprising a capsid protein produced by shuffling the capsid coding sequences of two or more different AAVs, wherein the capsid amino acid sequences of the two or more different AAVs differ by at least two amino acids; and a viral vector genome, e.g., an AAV vector genome, comprising the AAV capsid protein coding sequence generated by the aforementioned shuffling, the coding sequence for one AAV Rep, and at least one terminal repeat, e.g., a 5 'and/or 3' terminal repeat of AAV, wherein the viral vector genome is encapsidated in an AAV capsid.

Third, administering to the subject a collection of viral vectors;

fourth, a plurality of viral vectors are recovered from the target tissue as virions or as viral vector genomes encoding AAV capsids, thereby identifying viral vectors or AAV capsids having neutralizing antibody evading properties.

By "evading" the neutralizing antibody, it is meant that neutralization is at least partially reduced as compared to an appropriate control group, but as long as the degree of neutralization is reduced as compared to the control group, and as long as some of the vector is able to reach and transduce the target tissue, the degree of "evasion" need not be complete.

In particular embodiments, the target tissue is liver, skeletal muscle, cardiac muscle, diaphragm muscle, kidney, pancreas, spleen, gastrointestinal tract, lung, joint tissue, tongue, ovary, testis, germ cells, cancer cells, or a combination thereof.

The sequences of any combination of two or more AAV capsids, whether naturally occurring or modified, whether now known or later discovered, can be "shuffled" to produce a collection of AAV vectors comprising chimeric capsids. In representative embodiments, the collection of AAV vectors comprises chimeric capsids generated by shuffling from two or more capsid sequences comprising: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goose AAV or snake AAV. As described above, the collection of AAV capsids may further comprise non-naturally occurring AAV capsids that are currently known or later discovered. Such modifications include substitutions, including substitutions of modified nucleic acids and/or amino acids, as well as deletions and/or insertions.

Further diversity of the chimeric capsids can be achieved by any method known in the art for introducing mutations into nucleic acid and/or amino acid sequences, e.g., using chemical mutagens, error-prone PCR, cassette mutations, and the like.

Optionally, the in vivo screening method can be combined with one or more rounds of in vitro screening to further optimize the vector. For example, in vivo selection can be performed to identify chimeric AAV capsids having desired properties, and then in vitro selection can be used to identify AAV capsids having the ability to evade antibody neutralization.

The collection of AAV particles can be administered to the subject by any suitable method. In particular embodiments, the assemblage is administered to the blood of a subject, e.g., intravenously or intra-articularly.

The mode of administration and the subject are as described elsewhere herein.

The present invention can be used to recognize chimeric viruses or viral capsids having desirable properties in vivo. Thus, in particular embodiments, the methods of the invention comprise recovering AAV particles or viral genomes encoding the same AAV particles from two or more target tissues and identifying a chimeric virus or chimeric AAV capsid having desired properties for the two or more target tissues. For example, in particular embodiments, chimeric viruses or chimeric AAV capsids are identified that have inefficient targeting to skeletal muscle and/or cardiac muscle and or efficient targeting to the liver.

The target cell or tissue or one of them may also be a cancer cell or a tumor tissue. For example, a chimeric virus can be administered to an animal model of cancer and the chimeric virus coat or viral genome encoding the virus isolated from cancer cells or tumors. In representative embodiments, the animal model may be a model with an increased likelihood of forming a cancer or tumor, or may be a xenograft model in which human tumor cells are transplanted into an animal.

Exemplary methods of DNA "shuffling" or "chimerization", also known as "molecular breeding", "rapid forced evolution", etc., are known in the art (US 5605793, US6165793, US6117679, stemmer,1994, proc. Nati. Acad. Sci. 10747-10751, and Soong et al, 2000, nature Genetics 25. This method is also applied to the directed evolution of viruses (US 6096548, US 6596539). In one representative embodiment, the collection of AAV capsid protein coding sequences is fragmented and recombined in vitro by homologous and/or nonhomologous recombination to form a collection of "chimeric" AAV capsid proteins. Each chimeric capsid encapsidates a nucleic acid, e.g., an AAV genome, comprising the corresponding capsid coding sequence, thereby generating a chimeric virus. The chimeric virus pool is administered to a subject and selected in vivo according to a property of interest. For example, chimeric viruses can be isolated from one or more target tissues to identify optimized capsid proteins with desired properties.

IV detailed description of the invention

In one aspect, the invention provides a nucleic acid encoding an AAV capsid protein, the nucleic acid comprising a nucleotide sequence selected from any one of the group consisting of:

(a) 1, nucleotide sequence SEQ ID NO;

(b) 3, the nucleotide sequence of SEQ ID NO;

(c) Nucleotide sequence SEQ ID NO 5;

(d) Nucleotide sequence SEQ ID NO 7;

(e) The nucleotide sequence of SEQ ID NO 9;

(f) Nucleotide sequence SEQ ID NO 11;

(g) 13 in nucleotide sequence SEQ ID NO;

(h) 15, nucleotide sequence SEQ ID NO;

(i) Nucleotide sequence SEQ ID NO 17; or

(j) A nucleotide sequence of an AAV capsid protein encoded by any one of nucleotide sequences (a) - (i) that differs from the nucleotide sequences of (a) - (i) due to the degeneracy of the genetic code.

The nucleic acid is a plasmid, phage, viral vector, bacterial artificial chromosome, yeast artificial chromosome, preferably an AAV vector comprising a coding sequence, more preferably the nucleic acid further comprises a coding sequence for an AAV Rep protein.

In one aspect, the invention also provides an AAV capsid protein encoded by the nucleic acid described above, the amino acid sequence of which comprises any one of SEQ ID NOs. Preferably, the AAV capsid is covalently linked, associated or encapsulated with a composition selected from one or more of a DNA molecule, an RNA molecule, a polypeptide, a carbohydrate, a liposome and a small organic molecule.

In another aspect, the invention provides a recombinant viral particle comprising a nucleic acid and/or a capsid protein as described above. The recombinant virus particle is selected from recombinant AAV virus particle, recombinant adenovirus particle, recombinant herpes virus particle, recombinant baculovirus particle or recombinant hybrid virus particle.

In another aspect, the invention provides a recombinant AAV virion comprising an AAV vector genome and an AAV capsid protein as described above, wherein the AAV vector genome is encapsidated in an AAV capsid. The AAV vector genome comprises a heterologous nucleic acid sequence. The heterologous nucleic acid sequence codes one or more selected from antisense RNA, microRNA, shRNA, polypeptide and immunogen. Preferably, the polypeptide encoded by the heterologous nucleic acid sequence is a therapeutic polypeptide or a reporter gene, wherein the therapeutic polypeptide encoded by the heterologous nucleic acid is selected from the group consisting of insulin, glucagon, growth hormone releasing factor, erythropoietin, insulin growth factor, transforming growth factor alpha, hepatocyte growth factor, tyrosine hydroxylase, thrombopoietin, interleukin 1-interleukin 25, low density lipoprotein receptor, glucocorticoid receptor, vitamin D receptor, interferon regulatory factor, factor viii, factor ix, glucosidase, glucose-6-phosphatase, isovaleryl-CoA dehydrogenase, propionyl-CoA carboxylase, beta-glucosidase, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, alpha-galactosidase, beta-galactosidase and lysosomal enzyme.

In one aspect, the invention provides a cell comprising the aforementioned nucleic acid, AAV capsid protein, recombinant virion, and/or recombinant AAV virion.

In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier or excipient and one or more selected from the group consisting of a nucleic acid as described in the preceding claims, an AAV capsid protein, a recombinant virion, a recombinant AAV virion and/or a cell as described above.

In another aspect, the invention also provides the use of one or more of the aforementioned nucleic acids, AAV capsid proteins, recombinant viral particles, recombinant AAV viral particles, cells and/or the aforementioned pharmaceutical compositions in the manufacture of a medicament for the prevention or treatment of a disease selected from one or more of the group consisting of cystic fibrosis and other diseases of the lung, hemophilia a, hemophilia B, thalassemia, anemia and other blood disorders, senile dementia, multiple sclerosis, parkinson's disease, huntington's disease, amyotrophic lateral sclerosis, epilepsy, cancer, diabetes, muscular dystrophy, glycogen storage disease and other metabolic defects, congenital emphysema, lesch-Nyhan syndrome, nieman-Pick disease, aids, hepatitis, hyperammonemia and spinocerebral ataxia.

In one aspect, the invention provides a method of producing a recombinant AAV virion, comprising providing a cell with a nucleic acid as described above, a nucleic acid coding sequence for an AAV Rep protein, an AAV vector genome carrying a heterologous nucleic acid sequence, a helper factor that facilitates production of infectious AAV, and allowing the AAV vector genome to be enveloped in an AAV capsid encoded by the nucleic acid described above, in vitro, and effecting assembly of the recombinant AAV virion, the method being an AAV vector production system comprising a two plasmid packaging system, a three plasmid packaging system, a baculovirus packaging system, and an AAV packaging system adjuvanted with Ad or HSV, and the like.

In one aspect, the invention also provides a method of delivering a heterologous nucleic acid to a cell in vitro, the method comprising administering to the cell a nucleic acid, a viral capsid protein, a recombinant virion, a recombinant AAV virion and/or a pharmaceutical composition as described above, the cell being a mammalian cell, preferably a human stem cell or a liver cell.

In another aspect, the invention also provides a method of delivering a heterologous nucleic acid to a mammal, the method comprising administering to a mammalian subject an effective amount of the foregoing nucleic acids, viral capsid proteins, recombinant virions, recombinant AAV virions, the foregoing cells, and/or the foregoing pharmaceutical compositions, wherein the mammal is a human subject or a primate subject.

Having described the invention, the invention will be illustrated in greater detail in the following examples, which are intended to be illustrative only and are not intended to be limiting of the invention.

Examples

The following examples describe the shuffling of AAV capsid genes by directed evolution and in vivo screening methods to generate a panel of vectors with superior or superior liver targeting. And (3) carrying out reorganization on the AAV capsid genes by adopting a DNA reorganization technology, and constructing an AAV capsid gene library for in vivo screening of a mouse model. Mouse liver-enriched AAV mutants were isolated and their targeting was determined by in vitro and in vivo activity testing of AAV mutant capsids.

Example 1 chimeric AAV plasmid library construction

To obtain chimeric AAV capsid gene Cap, the capsid full-length genes were first amplified separately from different serotype AAV parents using the upstream primer primerA and the downstream primer primerB, and the selected parental AAV capsid genes included AAV1 capsid (NCBI sequence ID: AF063497.1, nucleic acid coding sequence 2223-4433 of Cap), AAV2 capsid (NCBI sequence ID: AF043303.1, nucleic acid coding sequence 2203-4410 of Cap), AAV3B capsid (NCBI sequence ID: AF028705.1, nucleic acid coding sequence 2208-4418 of Cap), AAV7 capsid (NCBI sequence ID: AF513851.1, nucleic acid coding sequence 2222-4435 of Cap), AAV8 capsid (NCBI sequence ID: AF513852.1, nucleic acid coding sequence 2121-4337 of Cap), AAV9 capsid (NCBI sequence ID: 579.1, nucleic acid coding sequence 1-2211 of Cap). The upstream primer is 5-: 5min at 95 ℃ for 1 cycle; 8s at 98 ℃, 5s at 60 ℃, 15s at 72 ℃ and 35 cycles; 72 ℃ for 5min,1 cycle.

Mixing the amplified Cap gene and other substances to obtain a DNA template with the total mass of 4ug, randomly crushing and digesting with 0.04U DNaseI at 22 ℃ for 6-8min under normal conditions, and inactivating DNaseI enzyme at 75 ℃ for 10min. Agarose gel electrophoresis gave a diffuse DNA band, the length of which was mostly concentrated in the range of 500-1000bp, and DNA fragments in this length range were recovered.

The recovered DNA fragments are first subjected to random primer-free amplification with primers each other, and in order to increase the diversity and amplification efficiency, an unconventional single annealing PCR mode (94 ℃ 60s,65 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,62 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,59 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,56 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,53 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,50 ℃ 90s,72 ℃ 90s,10 cycles; 94 ℃ 60s,47 ℃ 90s,72 ℃ 90s,10 cycles) is employed.

Using the primer-free PCR product AS a template, the full-length amplification of the chimeric Cap gene was carried out by using the upstream primer T-primer A (5' ACGCCTGCCGTTCGACGATTCCCAAGCTCGATCCGCAGACAGGTTACCAAA-. The amplification procedure was carried out at 94 ℃ 30s,62 ℃ 30s,72 ℃ 2.5min for a total of 40 cycles. Obtaining a chimeric full-length Cap DNA fragment with the length of about 2500bp, carrying out double enzyme digestion by HindIII and NotI, connecting with a pSNAV2.3 vector (containing a single-chain AAV2 genome ITR and a polymerase Rep gene sequence, deleting a Cap gene) which is subjected to the same double enzyme digestion treatment, and carrying out electric shock transformation on a connection product to E.coli HST08 cells to prepare a chimeric AAV plasmid library with the library capacity of more than 1E +6 clones. The plasmids identified as positive clones by PCR are respectively subjected to enzyme digestion identification of PstI, haeIII and TaqI, and the enzyme digestion morphological difference of each plasmid is observed (figure 1) so as to judge the diversity of the plasmid library.

Example 2 packaging and titer detection of novel AAV viral libraries

The chimeric plasmid library is self-packaged and replicated under the assistance of a helper, the packaging method is a two-step method, firstly, library plasmids, R2C2 plasmids and the helper plasmids are transfected according to the mass ratio of 1; in the second step, 293T cells are infected at an infection index MOI of 100, ensuring that the copy number of the viral genome infected per cell is < 10, when the final AAV viral pool generated is homozygous, and the genome titer is measured after the harvest is purified by chloroform extraction (see Muller et al, 2003, nature Biotechnology, 21. The use of library plasmids in packaging is of very low quality, and serves to ensure that each novel AAV genome is packaged within the coat formed by its own expressed Cap protein. The packaged virus particles can normally express coat protein, and the complete virus coat can be formed and has infection capacity.

A proper amount of purified AAV samples were taken, DNase I digestion reaction mixture was prepared according to the following table (Table 1), incubation was carried out for 30min at 37 ℃ and 10min at 75 ℃ to inactivate DNase I.

TABLE 1

AAV sample	5μl
			10 XDnase I buffer	5μl
Dnase I	1μl
		RNase-free water	39μl
Is totaled	50μl

After the treated purified AAV sample was diluted by an appropriate factor, the Q-PCR reaction system was prepared according to the following table (Table 2), and the detection was carried out according to the following procedure.

TABLE 2

The primers used therein are shown in the following table (table 3):

TABLE 3

Forward primer (5 '-3')	AAGGTGGTGGATGAGTGCTACA
		Reverse primer (5 '-3')	TGGAGCTCAGGCTGGGTTT
Probe primer	CCCCAATTACTTGCTCC

Packaging yield results are seen in the following table (table 4):

TABLE 4

Name of viral vector	Genome titer (vg/ml)
		Novel AAV virus library	2.5E+11

EXAMPLE 3 novel AAV vectors screened and enriched in mice

The virus packaged by the novel AAV vector is injected into a C57BL/6J mouse at the age of 8 weeks through tail veins at the dose of 1.5E + 11vg/single dose for liver targeted screening and enrichment. Three days after injection, mice were sacrificed and all liver tissues were collected and total DNA was extracted after liquid nitrogen homogenization. The primers were amplified again using T-primer A/T-primer B, and the amplified DNA obtained by mixing the full-length Cap genes of the novel AAV was constructed into pSNAV2.3 vector by the method described above. 370 positive single clones obtained by PCR identification were mixed in equal mass to form a second plasmid library. And packaging into a virus library, injecting into C57BL/6J mice with the age of 8 weeks by 1.5E + 11vg/tail vein, killing the mice three days after injection, and collecting all liver tissues, heart tissues and skeletal muscles. 100, 50 positive clones were randomly selected from the above tissues, respectively, and sequenced. The positive clones after sequencing were subjected to sequence alignment analysis using BioEdit, vectorNTI, clustalX2 and TreeViewX.

Novel AAV vectors were selected for high frequency liver, low frequency heart and skeletal muscle, or no frequency heart and skeletal muscle. A total of 9 groups of high-frequency liver-targeted novel AAV mutants were obtained (FIG. 2), and the nucleotide sequences and amino acid sequences of the above 9 novel AAV-Cap mutants were analyzed (FIG. 3). The other 4 packages are not suitable for industrial needs due to low titer. Therefore, 5 of the novel AAVs, i.e., L37, L57, L58, L107, L10, were selected for subsequent infection activity testing experiments.

Example 4 Activity of novel AAV on infection of human liver cell lines in vitro

4.1 testing the Activity of novel AAV on infection of in vitro human liver cell lines by Green fluorescent protein detection System

To initially test the liver-targeting infectious activity of the novel AAV, 6 human normal livers or liver cancer cell lines were first tested for in vitro infectious activity. The obtained novel AAV Cap genes L57, L58, L107 and L10 are respectively constructed on an RC plasmid vector containing AAV Rep type 2, the plasmid carries CAG-EGFP exogenous genes, the packaged viruses are named AAV2/57, AAV2/58, AAV2/107 and AAV2/10, and the virus titer is detected (the result is not shown).

The 4 recombinant AAV viruses carrying green fluorescent protein and AAV2/8 recombinant virus carrying the same green fluorescent protein are used to infect several kinds of human liver cell lines simultaneously for 48 hr before the infection activity is detected in flow mode. In order to avoid the infection efficiency of the viral vectors on a certain cell line to be too low or too supersaturated, each cell line is infected with at least two infection indexes (MOI), and as can be seen from the figures (4A-4F), when 2-3 infection indexes are used to infect human liver cell lines 7721, hepG2, huh7 and L02, the novel AAV2/10, AAV2/57, AAV2/58 and AAV2/107 show obvious dose-dependent relationship on the infection of human liver cell lines. The results of infection with one of the MOIs for each cell are described next, and the remaining MOIs are detailed in FIG. 4.

When the 4 recombinant viruses infected human liver cell line 7402 at an infection index (MOI) of 2500, and analyzed by flow cytometry 48h after infection, the results (FIG. 4A) show that: at this MOI, the AAV2/10 infection efficiency was 4.6 times, the AAV2/57 infection efficiency was 2.2 times, the AAV2/58 infection efficiency was 3.9 times, and the AAV2/107 infection efficiency was 1.6 times higher than the AAV2/8 infection efficiency.

When the 4 recombinant viruses infect a human liver cell line 7721 with an infection index (MOI) of 2500, and flow cytometry detection analysis is carried out 48h after infection, the result (figure 4B) shows that the AAV2/10 infection efficiency is the highest under the MOI, the AAV2/107 infection efficiency is close to the AAV2/107 infection efficiency, the AAV2/10 infection efficiency is 23.4 times of the AAV2/8 infection efficiency, the AAV2/107 infection efficiency is 21.8 times of the AAV2/8 infection efficiency, the AAV2/57 infection efficiency is 4.6 times of the AAV2/8 infection efficiency, and the AAV2/58 infection efficiency is 15.9 times of the AAV2/8 infection efficiency.

When the 4 recombinant viruses infect a human liver cell line HepG2 with an infection index (MOI) of 2500, and flow cytometry detection analysis is carried out 48h after infection, the result (figure 4C) shows that the AAV2/10 infection efficiency is the highest under the MOI, the AAV2/107 infection efficiency is close to the highest, the AAV2/10 infection efficiency is 14.8 times of the AAV2/8 infection efficiency, and the AAV2/107 infection efficiency is 13.5 times of the AAV2/8 infection efficiency. AAV2/57 infection is 5.5 times more efficient than AAV2/8 infection, and AAV2/58 infection is 10.9 times more efficient than AAV2/8 infection.

When the 4 recombinant viruses infected human liver cell line Huh7 at an infection index (MOI) of 2500 and analyzed by flow cytometry 48h after infection, the results (fig. 4D) showed that AAV2/10 infection efficiency was the highest at this MOI, 31.8 times higher than AAV2/8. AAV2/57 infection efficiency is 1.4 times of AAV2/8, AAV2/58 infection efficiency is 6.6 times of AAV2/8, and AAV2/107 infection efficiency is 19.5 times of AAV2/8.

When the 4 recombinant viruses infect a human liver cell line Huh6 with an infection index (MOI) of 10000, and flow cytometry detection analysis is carried out 48h after infection, the result (figure 4E) shows that AAV2/10 infection efficiency is the highest under the MOI, AAV2/107 infection efficiency is close to that, AAV2/10 infection efficiency is 2.9 times of AAV2/8 infection efficiency, and AAV2/107 infection efficiency is 2.7 times of AAV2/8 infection efficiency. The AAV2/57 infection efficiency is 1.8 times of that of AAV2/8, and the AAV2/58 infection efficiency is 2.6 times of that of AAV2/8.

When the 4 recombinant viruses infected human liver cell line L02 with infection index (MOI) of 50000 and analyzed by flow cytometry after 48h infection, the results (FIG. 4F) showed that AAV2/10 infection efficiency was the highest at this MOI, 42 times higher than AAV2/8 infection efficiency, AAV2/107 infection efficiency was 26.8 times higher than AAV2/8 infection efficiency, AAV2/57 infection efficiency was 2.5 times higher than AAV2/8 infection efficiency, and AAV2/58 infection efficiency was 10.8 times higher than AAV2/8 infection efficiency.

According to the results, the infection activity of the 4 recombinant novel AAV on human hepatocytes or liver cancer cell lines is higher than that of positive control AAV2/8.

4.2 testing the Activity of novel AAV on infection by in vitro human liver cell lines Using luciferase assay System

The obtained novel AAV Cap genes L37, L57, L58, L107 and L10 are constructed on an RC plasmid vector containing AAV Rep type 2, the plasmid carries a CAG-Luciferase exogenous gene, the packaged viruses are named as AAV2/37, AAV2/57, AAV2/58, AAV2/107 and AAV2/10, and the virus titer is detected (the result is not shown). The recombinant AAV is used to infect 5 normal liver or liver cancer cell lines with infection index MOI of 500, and after 48 hr, the luciferase detection system is used to detect the infection activity. Comparison of infection activity was performed after subtraction of NC background values on each assay.

The results of the 5 recombinant novel AAV viruses on the human liver cell line Huh7 infection activity comparison (figure 5A) show that the infection activity is AAV2/10 > AAV2/107 > AAV2/58 > AAV2/37 > AAV2/57 from high to low.

The results of the comparison of the infection activities of the 5 recombinant novel AAV viruses on human liver cell line 7402 (FIG. 5B) show that AAV2/10 has the highest activity, AAV2/107 is close to the activity, AAV2/58 is close to AAV2/37, and the infection activities are sequentially AAV2/10 > AAV2/107 > AAV2/58 > AAV2/37 > AAV2/57 from high to low.

The results of the comparison of the infection activities of the 5 recombinant novel AAV viruses on human liver cell line 7721 (FIG. 5C) show that the AAV2/10 has the highest activity, the AAV2/58 has the infection activity close to that of AAV2/37, and the infection activities are sequentially AAV2/10 > AAV2/107 > AAV2/58 > AAV2/37 > AAV2/57 from high to low.

The results of the 5 recombinant novel AAV viruses on the human liver cell line HepG2 infection activity comparison (figure 5D) show that AAV2/10 has the highest activity, and the infection activity is AAV2/10 > AAV2/37 > AAV2/107 > AAV2/58 > AAV2/57 from high to low.

The results of the comparison of the infection activities of the 5 recombinant novel AAV viruses in the human liver cell line L02 (FIG. 5E) show that the AAV2/10 has the highest activity, and the infection activities are sequentially AAV2/10 > AAV2/107 > AAV2/37 > AAV2/58 > AAV2/57 from high to low.

From these results, it was found that AAV2/10 activity was relatively highest and AAV2/57 activity was relatively low among the above novel AAV.

EXAMPLE 5 novel AAV Activity assay in vivo

5 novel AAV Cap coat genes L37, L57, L58, L107, L10 are respectively constructed on an RC plasmid vector containing AAV Rep type 2, the plasmid carries CAG-Luciferase exogenous gene, the packaged viruses are named AAV2/37, AAV2/57, AAV2/58, AAV2/107, AAV2/10, the virus titer is detected (the result is not shown), and the novel AAV viruses are subjected to in vivo infection activity comparison. Mice C57BL/6J at 6-8 weeks are selected and injected with tail vein at dose of 1E + 11vg/mouse, and after 2 weeks, the mice are sacrificed, tissue DNA is extracted, AAV vector genome copy number in liver, heart and skeletal muscle is tested, and luciferase expression in the 3 tissues is respectively tested.

Vector genome copy number test results (fig. 6) showed that AAV2/58 had the highest vector genome copy number in the liver compared to other novel AAV and the genome copy number in the liver was significantly increased compared to the heart and skeletal muscle of the same group; although AAV2/37, AAV2/57, AAV2/107, and AAV2/10 vector genome copy numbers were lower than AAV2/58 vector genome copy numbers, genome copy numbers were higher in the liver compared to gene copy numbers in the heart and skeletal muscle of the same group.

The results of luciferase expression assays (FIGS. 7A-E) showed that AAV2/37, AAV2/57, AAV2/58, AAV2/107, and AAV2/10 expressed luciferase in the liver at higher levels than in the heart and skeletal muscle of the same group.

These results indicate that all of the 5 novel AAV vectors have excellent liver targeting, and AAV2/10 has the highest luciferase expression level in liver compared with other novel AAV vectors, followed by AAV2/58, followed by AAV2/37 and AAV2/107, and has the relatively lowest AAV2/57 expression level in liver.

Example 6 detection of novel AAV neutralizing antibodies in monkey serum or human serum

Because AAV is naturally infected by humans and other primates, neutralizing antibodies raised against native AAV will greatly reduce the half-life of AAV. Herein, the level of neutralizing antibodies of the novel AAV was tested.

6.1 detection and comparison of novel AAV and AAV2/8 neutralizing antibodies in monkey sera

In the experiment, virus infection is adopted, the MOI value is fixed, serum is diluted, and the levels of the novel AAV vector and the neutralizing antibody of AAV2/8 in the cynomolgus monkey serum are detected. The efficiency of infection of cells by serum virus mixtures was found to be 50% of the efficiency of virus-serum-free infection of cells in a series of serum dilutions, with the reciprocal of this dilution being the amount of neutralizing antibody, which was evaluated against each viral vector (see Lochrie MA et al, 2006, virology 353, 68-82 mori S et al, 2006, jpn J infection Dis 59. In the experiment, 10 cynomolgus monkey serums are detected in total, and after serial dilution of the serums, the neutralizing antibody of the novel AAV and the neutralizing antibody of AAV2/8 in each sample are respectively judged and compared.

The method comprises the following specific steps: the obtained novel AAV Cap genes L37, L57, L58, L107 and L10 are respectively constructed on an RC plasmid vector containing AAV Rep type 2, the plasmid carries a CAG-EGFP exogenous gene, the packaged viruses are named as AAV2/37, AAV2/57, AAV2/58, AAV2/107 and AAV2/10, and the virus titer is detected (the result is not shown). 7402 cells are inoculated on a 24-well plate, serum samples of cynomolgus monkeys are serially diluted, the infection indexes of novel AAV2/37, AAV2/57, AAV2/58, AAV2/107, AAV2/10 and AAV2/8 recombinant viruses carrying the same green fluorescent protein MOI are 2000, the diluted serum samples are mixed with a virus solution 1, the mixture is incubated for 1h at 37 ℃, and then the mixed solution of the serum samples and the virus solution is added into the cells. Cells were harvested after 48h and the infection efficiency was examined by flow cytometry.

The results of detection of neutralizing antibodies are shown in Table 5, and when the amount of neutralizing antibodies is less than 5, the neutralizing antibodies are considered negative for the virus. 10 serum samples are respectively numbered as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8#, 9#, and 10#, wherein 7# is negative to all virus vector neutralizing antibodies; 1# and 9# are negative for the neutralizing antibodies of the novel AAV vector, and positive for the neutralizing antibodies of AAV 2/8; the novel AAV neutralizing antibodies of the 2#, 3#, 4#, 5#, 6#, 8#, and 10# samples are obviously lower than those of AAV2/8.

Therefore, through comprehensive comparison of the novel AAV and the AAV2/8 neutralizing antibody in the cynomolgus monkey serum, the neutralizing antibody of the novel AAV in a monkey population is obviously lower than that of the AAV2/8, and the novel AAV is used as a drug delivery vector and has lower immunogenicity.

TABLE 5 neutralizing antibody assay results for cynomolgus monkey 10 sera

6.2 detection and comparison of novel AAV and AAV2/8 neutralizing antibodies in human serum

The experiment adopts fixed virus infection index MOI, serum is diluted, and the level of novel AAV neutralizing antibody and AAV2/8 neutralizing antibody level in individual human serum are detected. The efficiency of infecting cells with the serum virus mixture was found to be 50% of the efficiency of infecting cells without virus serum in a series of serum dilutions, and the reciprocal of this dilution was used as the amount of neutralizing antibody, which was evaluated for each viral vector. In the experiment, 10 human sera are tested, and the sera are serially diluted to compare the neutralizing antibody of the novel AAV with the neutralizing antibody of AAV2/8 in each sample.

The specific procedure was as in 6.1, except that the serum selected was normal human serum. In this experiment, 10 normal human sera were randomly selected for neutralizing antibody experiments, and the novel AAV neutralizing antibody and AAV2/8 neutralizing antibody in each sample were compared. The neutralizing antibody test results are shown in table 6, where sample # 3 showed negative for all virus neutralizing antibodies; sample # 2 was negative for the novel AAV neutralizing antibodies and positive for AAV2/8 neutralizing antibodies; the neutralizing antibodies of the 1#, 4#, 5#, 6#, 7#, 8#, 9#, and 10# samples to the novel AAV are all obviously lower than those of AAV2/8. The results of the experiments demonstrate that in the human population, the neutralizing antibodies against the novel AAV are more suitable as drug delivery vehicles and can reduce reactogenicity compared to the neutralizing antibodies against AAV2/8.

TABLE 6 neutralizing antibody assay results for 10 human sera

Combining the above results, the novel AAV has lower immunogenicity than AAV2/8 vector and is more suitable as gene therapy vector by comparing the neutralizing antibody of novel AAV and AAV2/8 serum.

Claims (25)

1. A nucleic acid, wherein said nucleic acid comprises:

a nucleotide sequence shown by SEQ ID NO 9 for encoding adeno-associated virus capsid protein; or

The nucleotide sequence of the adeno-associated virus capsid protein encoded by the nucleotide sequence shown in SEQ ID NO. 9 differs from the nucleotide sequence shown in SEQ ID NO. 9 due to the degeneracy of the genetic code.

2. The nucleic acid of claim 1, wherein the nucleic acid is a plasmid, a bacteriophage, a viral vector, a bacterial artificial chromosome, or a yeast artificial chromosome.

3. The nucleic acid of claim 2, wherein the nucleic acid is an adeno-associated viral vector comprising a coding sequence.

4. The nucleic acid of claim 3, further comprising a coding sequence for an adeno-associated virus Rep protein.

5. The adeno-associated virus capsid protein according to claim 1 encoded by the nucleotide sequence set forth in SEQ ID NO 9.

6. The adeno-associated virus capsid protein according to claim 5, wherein the amino acid sequence of the adeno-associated virus capsid protein is the amino acid sequence set forth in SEQ ID NO 10.

7. The adeno-associated virus capsid protein according to claim 5 or 6, wherein said adeno-associated virus capsid protein is covalently linked to, associated with or encapsulating a composition selected from the group consisting of one or more of DNA, RNA, polypeptides, carbohydrates, liposomes and small organic molecules.

8. A recombinant viral particle comprising a nucleic acid according to any one of claims 1 to 4 and/or a capsid protein according to any one of claims 5 to 7.

9. The recombinant viral particle of claim 8, wherein the recombinant viral particle is a recombinant adeno-associated viral particle, a recombinant adenoviral particle, a recombinant herpes viral particle, a recombinant baculovirus particle, or a recombinant hybrid viral particle.

10. A recombinant adeno-associated viral particle comprising an adeno-associated viral vector genome and the adeno-associated viral capsid protein of claim 5 or 6, wherein the adeno-associated viral vector genome is enveloped in the adeno-associated viral capsid protein.

11. The recombinant adeno-associated viral particle according to claim 10 wherein the adeno-associated viral vector genome comprises heterologous nucleic acid sequences.

12. The recombinant adeno-associated viral particle according to claim 11 wherein the heterologous nucleic acid sequence encodes one or more selected from the group consisting of antisense RNA, microRNA, shRNA, polypeptides and immunogens.

13. The recombinant adeno-associated viral particle of claim 12, wherein the heterologous nucleic acid sequence encodes a polypeptide that is a therapeutic polypeptide or a reporter gene.

14. The recombinant adeno-associated viral particle according to claim 13 wherein the heterologous nucleic acid encodes a therapeutic polypeptide selected from the group consisting of insulin, glucagon, growth hormone releasing factor, erythropoietin, insulin growth factor, transforming growth factor alpha, hepatocyte growth factor, tyrosine hydroxylase, thrombopoietin, interleukin 1-interleukin 25, low density lipoprotein receptor, glucocorticoid receptor, vitamin D receptor, interferon regulatory factor, factor viii, factor ix, glucosidase, glucose-6-phosphatase, isovaleryl-CoA dehydrogenase, propionyl-CoA enzyme, beta-glucosidase carboxylase, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, alpha-galactosidase, beta-galactosidase and lysosomal enzyme.

15. A cell comprising the nucleic acid of any one of claims 1 to 4, the adeno-associated virus capsid protein of any one of claims 5 to 7, the recombinant viral particle of any one of claims 8 to 9, and/or the recombinant adeno-associated viral particle of any one of claims 10 to 14.

16. The cell of claim 15, wherein the cell is selected from one or more of escherichia coli, an HEK293 cell line, an HEK293T cell line, an HEK293A cell line, an HEK293S cell line, an HEK293FT cell line, an HEK293F cell line, an HEK293H cell line, a HeLa cell line, an SF9 cell line, an SF21 cell line, an SF900 cell line, and a BHK cell line.

17. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or excipient and one or more selected from the group consisting of the nucleic acid of any one of claims 1 to 4, the adeno-associated virus capsid protein of any one of claims 5 to 7, the recombinant virion of any one of claims 8 to 9, the recombinant adeno-associated virion of any one of claims 10 to 14 and/or the cell of claim 15.

18. Use of one or more of the nucleic acid of any one of claims 1-4, the adeno-associated virus capsid protein of any one of claims 5-7, the recombinant viral particle of any one of claims 8-9, the recombinant adeno-associated viral particle of any one of claims 10-14, the cell of claim 15 and/or the pharmaceutical composition of claim 17 in the manufacture of a medicament for the prevention or treatment of a disease.

19. Use according to claim 18, characterized in that the disease is selected from one or more of the group consisting of cystic fibrosis and other diseases of the lung, hemophilia a, hemophilia B, anemia and other blood diseases, multiple sclerosis, parkinson's disease, huntington's disease, amyotrophic lateral sclerosis, epilepsy, cancer, diabetes, muscular dystrophy, glycogen storage disease and other metabolic defects, congenital emphysema, lesch-Nyhan syndrome, niemann-Pick disease, aids, hepatitis, hyperammonemia and spinocerebral ataxia.

20. A method of producing recombinant adeno-associated viral particles, comprising providing a nucleic acid according to claim 1, a nucleic acid encoding a Rep protein of adeno-associated virus, an adeno-associated viral vector genome carrying heterologous nucleic acid sequences, cofactors useful for infection with gonadal-associated virus, and allowing the adeno-associated viral vector genome to be enveloped in the capsid proteins of adeno-associated virus encoded by the nucleic acid according to claim 1 and allowing assembly of the recombinant adeno-associated viral particles in vitro.

21. The method of claim 20, wherein the method is an adeno-associated virus vector production system, comprising a two-plasmid packaging system, a three-plasmid packaging system, a baculovirus packaging system, and an adeno-associated virus packaging system with adenovirus or herpes simplex virus as a helper.

22. A method of delivering a heterologous nucleic acid to a cell in vitro, comprising administering to the cell the nucleic acid of any one of claims 1-4, the adeno-associated virus capsid protein of any one of claims 5-7, the recombinant virion of claim 8 or 9, the recombinant adeno-associated virion of any one of claims 10-14, and/or the pharmaceutical composition of claim 17.

23. The method for delivering a heterologous nucleic acid to a cell of claim 22, wherein the cell is a mammalian cell.

24. The method of delivering a heterologous nucleic acid to a cell of claim 23, wherein the cell is a human cell.

25. The method for delivering a heterologous nucleic acid to a cell of claim 24, wherein the cell is a human stem cell or a human hepatocyte.

Images