CN115960797A - Genetic engineering bacterium for improving yield of GDP-L-fucose - Google Patents

Abstract

The invention relates to a genetic engineering bacterium for improving the yield of GDP-L-fucose, belonging to the technical field of genetic engineering. The invention uses colon bacillus as an original strain, knocks out a coding gene wcaJ of the phosphoric undecenyl glucose phosphotransferase, and inserts a terminator after a GDP-mannose pyrophosphorylase coding gene manC to obtain a gene engineering bacterium for improving the yield of GDP-L-fucose; the nucleotide sequences of the coding gene wcaJ of the phosphoric acid undecylenyl glucose phosphotransferase and the coding gene manC of the gdp-mannose pyrophosphorylase are shown in SEQ ID NO. 1-2. Compared with other strains, the invention blocks the expression of subsequent unnecessary genes, greatly reduces the substances and energy consumed by the strains in other ways, reduces the survival pressure of the strains, ensures that the strains can put a great deal of energy on synthesizing a target product GDP-L-fucose, and improves the yield of the GDP-L-fucose.

Description

Genetic engineering bacterium for improving yield of GDP-L-fucose

Technical Field

The invention relates to a genetic engineering bacterium for improving the yield of GDP-L-fucose, belonging to the technical field of genetic engineering.

Background

GDP-L-fucose is an activated form of nucleotide, is a donor for producing many important substances, and plays an important role in various biological functions, such as synthesis of L-fucose, 2-FL, etc. GDP-L-fucose is also an intermediate product for synthesizing cellular colanic acid by certain microorganisms (such as Escherichia coli), and is an important biological composition. The wild strain has very small amount of synthesized GDP-L-fucose, and can not meet the requirement of industrial production. Therefore, it is important to increase the accumulation of intracellular GDP-L-fucose.

In the prior art, the GDP-L-fucose is usually synthesized by a de novo synthesis route. Taking E.coli as an example, the de novo synthesis pathway of GDP-L-fucose in E.coli includes:

glucose → glucose-6-phosphate → fructose-6-phosphate → mannose-1-phosphate → GDP-mannose → GDP-4-keto-6-deoxymannose → GDP-L-fucose.

There are currently two ways to enhance gene expression: one is to insert a target gene sequence to increase the copy number of the target gene, but this method will result in a lower enhancement effect of the bacterium; the other is to add a strong promoter before synthesizing a gene of catalytic reaction enzyme to strengthen the expression of the gene, and common promoters for strengthening the expression comprise a T7 promoter, a J23119 promoter and the like, but because the strong promoter is strongly expressed, the unnecessary genes behind the target gene are strengthened, so that a large amount of energy is consumed on the unnecessary genes by bacteria, the bacterial growth is burdened, the normal growth of the bacteria is influenced, further, the target product of bacterial expression is lower and the yield is reduced in the subsequent fermentation, and the method is a problem which cannot be ignored for the gene modification aiming at improving GDP-L-fucose.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provide a genetic engineering bacterium for improving the yield of GDP-L-fucose.

Technical scheme

The manB gene is a gene existing in escherichia coli, the manB gene mainly synthesizes mannanase which can synthesize mannose-1-phosphate from mannose-6-phosphate, the manC gene is responsible for synthesizing GDP-mannose pyrophosphorylase, and the GDP-mannose pyrophosphorylase combines mannose-1-phosphate with GTP to synthesize GDP-mannose, wherein the two synthesis processes are one of key steps for synthesizing GDP-L-fucose. In order to improve the expression of manB gene and manC gene, the inventor provides a strong promoter for increasing the expression of manB gene and manC gene at the front end of manB gene, increases the expression of subsequent manB gene and manC gene, and improves the synthesis of subsequent products. On the other hand, since the phosphoric acid undecenyl glucose phosphotransferase synthesized by the wcaJ gene can convert GDP-L-fucose into clavulanic acid, which can greatly reduce the synthesis amount of L-fucose taking GDP-L-fucose as a material, and is not beneficial to the synthesis of L-fucose by escherichia coli, the inventor considers that the wcaJ gene in the wcaJ gene is knocked out, or the expression of the wcaJ gene is reduced, and other consumption ways of GDP-L-fucose are reduced. The specific scheme is as follows:

a genetic engineering bacterium for improving the yield of GDP-L-fucose: taking escherichia coli as an initial strain, knocking out an undecenyl phosphate phosphotransferase encoding gene wcaJ, inserting a terminator after a GDP-mannose pyrophosphorylase encoding gene manC, and obtaining a genetic engineering bacterium for improving the yield of GDP-L-fucose; the nucleotide sequence of the undecenyl glucose phosphotransferase coding gene wcaJ is shown as SEQ ID No.1, and the nucleotide sequence of the gdp-mannose pyrophosphorylase coding gene manC is shown as SEQ ID No. 2.

Further, the gene wcaJ for knocking out the undecenyl phosphotransferase encoding gene is realized by adopting a CRISPR-Cas9 gene editing method.

Further, the terminator is a lambda-TL 3 terminator, and the nucleotide sequence is shown as SEQ ID NO. 3.

Further, the starting strain is selected from BL21, JM109 (DE 3), BL21 (DE 3), K12 or MG1655.

The genetic engineering bacteria for improving the yield of the GDP-L-fucose are applied to fermentation production of the GDP-L-fucose.

The construction method of the genetic engineering bacteria for improving the yield of the GDP-L-fucose comprises the following steps: firstly, constructing a plasmid for knocking out wcaJ, then inserting a terminator into an expressed manC gene, constructing a target plasmid after determining a site, sequencing the successfully constructed plasmid, ensuring that no base problem exists on the plasmid, electrically transferring the plasmid into a strain to be constructed after the plasmid is completely constructed, and finally identifying.

The invention has the beneficial effects that:

compared with other constructed strains, the engineering strain of the invention blocks the expression of subsequent unnecessary genes, greatly reduces the consumption of too many substances and energy of the strain in other ways, reduces the survival pressure of the strain, enables the strain to put a great deal of energy on the synthesis of a target product GDP-L-fucose, and improves the yield of the GDP-L-fucose.

Drawings

FIG. 1 is a plasmid map of a plasmid 318-JC2KR.PTD (BLD) of interest constructed in example 1.

Detailed Description

The technical solution of the present invention is further explained with reference to the accompanying drawings and specific embodiments.

It should be noted that, in the following examples, the experimental techniques and experimental methods used are all conventional techniques in the art unless otherwise specified; the materials, reagents and the like used are commercially available in normal places unless otherwise specified.

1) In the following examples, the strain used was e.coli BL21 (DE 3), the plasmid replication strain used was e.col DH5 α purchased from a geotrichum, and the pTarget plasmid and the pCasM plasmid used were purchased from biowind corporation. But are not limited thereto.

2) In the following examples, the primers and sequences used are shown in Table 1:

TABLE 1

In Table 1, all primer synthesis and sequencing work was done by Jinwei Zhi, suzhou.

3) In the following examples, the media involved and the formulation were as follows:

LB solid medium: 10g/L peptone, 5g/L yeast extract powder, 10g/L sodium chloride and 15g/L agar powder.

LB liquid medium: 10g/L peptone, 5g/L yeast extract powder and 10g/L sodium chloride.

Fermentation medium containing anhydrous glucose 20g/L and KH ₂ PO ₄ 13.5 g/L、(NH ₄ ) ₂ HPO ₄ 4.0 g/L, citric acid monohydrate 1.7g/L, mgSO ₄ ·7H ₂ O1.4 g/L, thiamine 4.5mg/L and trace elements 1% (v/v), adjusting pH to 6.8 with sodium hydroxide; wherein, the glucose is added after being sterilized separately, and the microelement liquid is FeSO ₄ ·7H ₂ O 10g/L、ZnSO ₄ ·7H ₂ O 2.2g/L、CuSO·5H ₂ O 1.0g/L、MnSO ₄ ·H ₂ O0.38g/L、Na ₂ B ₄ O ₇ ·10H ₂ O 0.02gL、(NH ₄ ) ₆ Mo ₇ O ₂₄ 0.1 gL and CaCl ₂ 2.0 g/L, dissolved in 5M hydrochloric acid.

Example 1

A construction method of genetic engineering bacteria for improving the yield of GDP-L-fucose comprises the following steps:

(1) Searching a wcaJ gene sequence (the wcaJ gene sequence is shown as SEQ ID No: 1) according to E.coli BL21 (DE 3) information published by NCBI database, determining a replaced N20 sequence (the N20-1 is CAATCGTTAACTCTATTTA and the N20-2 is CGCTGGTCTTTGGTGAGAAG) according to the sequence information of the wcaJ gene, designing primers, taking a pTargetF plasmid as a template, performing PCR amplification by using primers pTS-CP-F/R and JC2BF-N20U1/N20L1, obtaining linear plasmids, connecting through Gibson Assembly Master Mix connecting liquid purchased from a biological organism, then transforming DH5a competent cell, coating an LB solid plate containing 50ug/mL spectinomycin in a 37 ℃ incubator, selecting clone bacteria and sequencing next day, successfully replacing the positive plasmid of the N20 sequence for sequencing, selecting clones, shaking and extracting the clones, and obtaining N20-318 plasmid overnight shaking;

(2) Taking the N20-318 plasmid as a template and the N20-CPF/R as a primer, and obtaining a linearized N20-318 vector fragment through PCR amplification;

(3) Taking E.coli BL21 genome as a template, taking JC2BF-HLU3/318-HL-CPR, 318-TerL-F/R, 318-HR-CPF/JC2BF-HRL6 as primers, and carrying out PCR amplification to obtain a wcaJ upstream homology arm fragment (the nucleotide sequence is shown in SEQ ID NO. 4), a wcaJ downstream homology arm fragment (the nucleotide sequence is shown in SEQ ID NO. 5) and a lambda-TL 3 terminator;

(4) Connecting the linear fragments (a linearized N20-318 vector fragment, a wcaJ upstream homology arm fragment, a wcaJ downstream homology arm fragment and a lambda-TL 3 terminator) through a Gibson Assembly Master Mix, transforming DH5a competent cells, coating an LB solid plate containing 50ug/mL spectinomycin, culturing overnight in an incubator at 37 ℃, selecting a single clone shake bacteria in the following day, identifying and sequencing, extracting a target plasmid 318-JC2KR.PTD (BLD) after sequencing is successful, wherein the plasmid map of the target plasmid is shown in figure 1;

(5) When the OD value of the bacterial liquid of the escherichia coli background strain reaches 0.8, adding 50ug/mL kanamycin and 10mmol arabinose to induce for 4 hours, preparing electrotransformation competence, transferring the target plasmid in the step (4) into the electrotransformation competence, coating the electrically transferred strain on an LB solid plate containing 50ug/mL kanamycin and 50ug/mL spectinomycin, culturing overnight at 30 ℃, selecting single clone for PCR identification the next day, and selecting correct positive single clone;

(6) Inoculating the positive monoclonal into a kalamycin LB liquid culture medium (kanamycin concentration is 50 ug/mL), inducing overnight culture by using IPTG (isopropyl thiogalactoside) with the final concentration of 1mmol/L, streaking, identifying the elimination condition of pTargetF plasmids, selecting the monoclonal with the eliminated pTargetF plasmids, inoculating a nonreactive LB liquid culture medium for overnight culture at 42 ℃, streaking a nonreactive plate, identifying the elimination condition of pCas plasmids, obtaining genetic engineering bacteria for improving the yield of GDP-L-fucose after successful identification, preparing glycerol bacteria, and naming the glycerol bacteria as a strain B and storing the strain B in a refrigerator at-80 ℃.

In the construction method, the reaction system of PCR amplification is as follows:

the PCR reaction program is: pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 30s, annealing at 50 ℃ for 15s, extension at 72 ℃ for 30s,25 cycles, extension at 72 ℃ for 5min, and storage at 4 ℃.

The strain B constructed in example 1 was used for the fermentative preparation of GDP-L-fucose and compared with the strain a before editing (e.coli BL21 (DE 3)) as follows:

the strain is fermented by using two groups of same fermentation equipment, which are respectively marked as a group (E.coli BL21 (DE 3)) and a group (B) according to a ratio of 1: 100, the strain A and the strain B are respectively inoculated into 70mL of fermentation medium, the strain A and the strain B are cultured for 8 hours at 37 ℃, the OD value of the strain liquid is measured by using a spectrophotometer, the strain A and the strain B are inoculated into a 1.5L fermentation tank when the OD value is about 0.5, the fermentation medium which is added and killed together is contained in the tank, the strain is not supplemented within 8 hours after inoculation, the supplementation is started after 8 hours, the two strains need to use the same fermentation operation, in order to ensure that the two strains have the same physiological state, in the process, the 37 ℃ fermentation is firstly maintained, the temperature is adjusted to 30 ℃ when the OD value of the fermentation reaches 60, the temperature is adjusted to 30 ℃, and then the fermentation is performed until the OD value reaches 80 (the 30 ℃ needs to be maintained for at least 1 hour), 80g of lactose is added (the lactose is added, the added in an amount is 200mL,0.4g/mL, the final concentration is 20g/L, IPTG (isopropyl group) reaches 8-beta-D), the final concentration is about 0.8-8 mL), the GDP in the fermentation liquid phase, and the fermentation liquid phase is measured by using 2-2 mM of the fermentation broth, and the liquid phase P in the fermentation liquid phase.

The detection method comprises the following steps:

1) Sample treatment: the mixture was centrifuged (12000 r/min,5 min) and the supernatant was taken for HPLC analysis.

2) And (4) HPLC detection: the supernatant was analyzed by High Performance Liquid Chromatography (HPLC) system (Agilent Technologies) and Inertsil ODS-SP column, UV wavelength 254nm, flow rate 0.6mL/min. The gradient elution process comprises eluting with 100% (v/v) mobile phase A for 10min; then eluting the mobile phase B for 10min by a gradient change of 0-50% (v/v); eluting the mobile phase B with a gradient of 50% -0% (v/v) for 5min; finally eluting with 100% (v/v) mobile phase A for 25min; wherein the mobile phase A is 20mmol/L triethylamine acetate buffer solution; the mobile phase B is as follows: acetonitrile with the volume ratio of 3.

And (3) detection results:

the content of GDP-L-fucose in group A is 0.9mg/L, while the content of GDP-L-fucose in group B is 11.4mg/L, therefore, after knockout of wcaJ gene and insertion of terminator preventing strong expression, the content of GDP-L-fucose is obviously increased.

Sequence listing

SEQ ID NO.1

wcaJ

tcaatatgccgctttgttaacgaagcccttgaataccgtcaggaaaacgattttgatatcgaaccagacgctccattcgcggatgtactcaaggtcgaactcgacgcgtttttccattttctccagcgtgtcggtttcgccacgccagccattaatctgcgcccagccggtaatgcccggtttcaccttatggcgcagcatgtagccttcaatgagctgtcgatactgttcgttatgcgccaccgcgtgcggacgtggaccgacaatcgacatcccgccagtcagcacattgataaactgcggcaattcgtccagcgaggtgcggcgcagaaagttccccactttggtgacgcgcggatcgttctgcgtcgcctgagtcaccactttgtcgttctccatcactttcatggatcggaacttccacactttgatcggtttgccatccatgccgtagcgagtctggcggaaaataaccggccccggtgagctcagtttcaccgccagcgcaatgcagcacagcaccggggagatcagcagcaggataagcgtcgccagcacaatgtcttccgcacgtttgagcaggcggttaaccccggaaagcggcgtgtcatacagcggcaccaccggtacgccattcatctcttcgaggcgtgaatggagaatgttgaaggtaaagacatcggggatcagcagcaccgaacaggtggtgtccgccagttgatggaccagttttttcactcgcgcgccgtcgcacatctgcatcgcgatatagacgttatgaatcttgcccgctttcgcatcctcgaccagttgttgcagattgcccgcccagtcgttagaaacgccgcccggttttgggtcgtggtatacgcccaccacttcaaaccctaaccacggctgattacggaagctctccatcagcatttgtccggcggctaaatcccccgctacggcgaccatgcgcttgttatagccatgattacgcagccagcccgccccaatgcgaatacatgaacggcaaaccaccagtccgatactggtcagcccataccacgccagccagattttcagttgcgtgtcgaaatcattgttgaacgccaccagtccggcgctgaaaatcacgcttaaggtccagttttgtagcagcagggcaaattctgtcgctgcccgaacaccgcgccatgagcgataaaaatcggtgatgccgcccaacatctggaacaccaccagcgtaatcagcgccaccaacaggtgcatgtagaggaatgacagtccgctgacttcgcaaaccagccatagtccggcaaacatgatggtgatatctgaaaagcgttgcaccatagagattaacgatgcattggttttcgctcgctcgcgcttttttagatttgtcat

SEQ ID NO.2

manC

atggcgcagtcgaaactctatccagttgtgatggcaggtggctccggtagccgcttatggccgctttcccgcgtactttatcccaagcagtttttatgcctgaaaggcgatctcaccatgctgcaaaccaccatctgccgcctgaacggcgtggagtgcgaaagcccggtggtgatttgcaatgagcagcaccgctttattgtcgcggaacagctgcgtcaactgaacaaacttaccgagaacattattctcgaaccggcagggcgaaacacggcacctgccattgcgctggcggcgctggcggcaaaacgtcatagcccggagagcgacccgttaatgctggtattggcggcggatcatgtgattgccgatgaagacgcgttccgtgccgccgtgcgtaatgccatgccatatgccgaagcgggcaagctggtgaccttcggcattgtgccggatctaccagaaaccggttatggctatattcgtcgcggtgaagtgtctgcgggtgagcaggatatggtggcctttgaagtggcgcagtttgtcgaaaaaccgaatctggaaaccgctcaggcctatgtggcaagcggcgaatattactggaacagcggtatgttcctgttccgcgccggacgctatctcgaagaactgaaaaaatatcgcccggatatcctcgatgcctgtgaaaaagcgatgagcgccgtcgatccggatctcaattttattcgcgtggatgaagaagcgtttctcgcctgcccggaagagtcggtggattacgcggtcatggaacgtacggcagatgctgttgtggtgccgatggatgcgggctggagcgatgttggctcctggtcttcattatgggagatcagcgcccacaccgccgagggcaacgtttgccacggcgatgtgattaatcacaaaactgaaaacagctatgtgtatgctgaatctggcctggtcaccaccgtcggggtgaaagatctggtagtggtgcagaccaaagatgcggtgctgattgccgaccgtaacgcggtacaggatgtgaaaaaagtggtcgagcagatcaaagccgatggtcgccatgagcatcgggtgcatcgcgaagtgtatcgtccgtggggcaaatatgactctatcgacgcgggcgaccgctaccaggtgaaacgcatcaccgtgaaaccgggcgagggcttgtcggtacagatgcaccatcaccgcgcggaacactgggtggttgtcgcgggaacggcaaaagtcaccattgatggtgatatcaaactgcttggtgaaaacgagtccatttatattccgctgggggcgacgcattgcctggaaaacccggggaaaattccgctcgatttaattgaagtgcgctccggctcttatctcgaagaggatgatgtggtgcgtttcgcggatcgctacggacgggtgtaa

SEQ ID NO.3

lambda-TL 3 terminator

cgcatcctcacgataatatccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttctgttatccgaaatccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgcacaaagcatcttctgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtttgtgccaataccagtag

SEQ ID NO.4

wcaJ upstream homology arm fragment

Caccgttgatgtggtgactaccgcaggtggcaccccggtaatgtcgaaaaccggacacgcctttattaaagaacgtatgcgcaaggaagacgccatctacggtggcgaaatgagcgcccaccattacttccgtgatttcgcttactgcgacagcggcatgatcccgtggctgctggtcgccgaactggtgtgcctgaaagagaaaacgctgggcgaactggtacgcgaccggatggcggcgtttccggcaagcggtgagatcaacagcaaactggcgcaacccgttgaggcgattaaccgcgtcgaacagcattttagccgcgaggcgctggcggtggatcgcactgatggcatcagcatgacctttgccgactggcgctttaacctgcgcacctccaataccgaaccggtggtgcgcctgaatgtggaatcgcgcggtgatgtgccgctgatggaagcgcgaacgcgaactctgctgacgttgctgaacgagtaatgtcggatcttcccttaccccactgcgggtaaggggctaataacaggaacaacg

SEQ ID NO.5

wcaJ upstream homology arm fragment

Gctgcaattgctgtgtgtggtggggctgctgcgctcagtggggaacccgattggctcgctgctgatggcgaaagcgcgggtcgatatcagctttaaattcaacgtattcaaaacctttatgtttattccggcgattgttattggtgggcagatggcgggcgcaatcggcgttacgcttggtttcctgctggtgcagattatcaacaccattctgagctatttcgtgatgattaaaccggtgctcggttccagttatcgtcagtacatcctgagtttgtggctgccgttttatctctcgctgccgacactggtggtcagttatgcgctgggcctattgctgaaagggcaactggcgctggggatgctgctggcggtgcaaatagccgcgggcgtgctggcgtttgtggtgatgattgtgctgtcgcgccatccgctggtggtggaagtgaagcgtcagttttgtcgcagcgaaaaaatgaaaatgcttttacgggcggggtgaatggctatccccgtaaggtcgtgcgcattttccccctcaccctaaccctctccccagggggcgaggggactgatcgagcacagctttgaatatgtcac

Claims (5)

1. A genetic engineering bacterium for improving the yield of GDP-L-fucose is characterized in that escherichia coli is used as an initial strain, a coding gene wcaJ of undecenyl glucose phosphotransferase is knocked out, and a terminator is inserted after a coding gene manC of GDP-mannose pyrophosphorylase is inserted, so that the genetic engineering bacterium for improving the yield of GDP-L-fucose is obtained; the nucleotide sequence of the undecenyl glucose phosphotransferase coding gene wcaJ is shown as SEQ ID No.1, and the nucleotide sequence of the gdp-mannose pyrophosphorylase coding gene manC is shown as SEQ ID No. 2.

2. The genetically engineered bacterium that improves production of GDP-L-fucose according to claim 1, wherein the knock-out undecenyl phosphoglucotransferase-encoding gene wcaJ is achieved by using CRISPR-Cas9 gene editing method.

3. The genetically engineered bacterium for increasing the yield of GDP-L-fucose as claimed in claim 1, wherein the terminator is a lambda-TL 3 terminator, and the nucleotide sequence is shown in SEQ ID No. 3.

4. The genetically engineered bacterium that improves the production of GDP-L-fucose according to claim 1, wherein the starting strain is selected from BL21, JM109 (DE 3), BL21 (DE 3), K12 or MG1655.

5. Use of the genetically engineered bacterium of claim 1 or 2 or 3 or 4 for increasing the production of GDP-L-fucose for the fermentative production of GDP-L-fucose.

Images