CN115948501A - Inactivated virus nucleic acid preserving fluid without guanidine salt - Google Patents
Inactivated virus nucleic acid preserving fluid without guanidine salt Download PDFInfo
- Publication number
- CN115948501A CN115948501A CN202211571667.8A CN202211571667A CN115948501A CN 115948501 A CN115948501 A CN 115948501A CN 202211571667 A CN202211571667 A CN 202211571667A CN 115948501 A CN115948501 A CN 115948501A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- reagent
- virus
- swab
- percent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an inactivated virus nucleic acid preserving fluid without guanidine salt, which comprises a protein denaturation reagent, a reduction reagent of disulfide bonds, a carbohydrate compound and water, wherein the pH value range is 4.0-6.0, and based on the protein denaturation reagent, the reduction reagent of disulfide bonds, the carbohydrate compound and the water, the mass percent of the protein denaturation reagent is 20-60%, the mass percent of the carbohydrate compound is 10-25%, the mass percent of the reduction reagent of disulfide bonds is 0.1-0.5%, and the balance is the water. The inactivated virus nucleic acid preservation solution does not contain guanidine salt components, is weak in corrosivity and strong in capability of inactivating nuclease, does not show signs of virus nucleic acid degradation after being mixed with virus and stored for 1 week at 37 ℃, and does not influence the sensitivity of virus nucleic acid detection. The virus sample can be stored and mailed after being collected in the virus nucleic acid detection technology, so that the sensitivity of subsequent virus nucleic acid detection is improved.
Description
Technical Field
The invention relates to an inactivated virus nucleic acid preserving fluid without guanidine salt.
Background
Viruses are pathogenic microorganisms which are parasitic in living cells, and different virus-infected cell types are different from host cells in the same replication system, which brings great difficulty to the isolation and treatment of the viruses. To date, humans have not found very effective methods for treating viral diseases, and have relied on effective detection and isolation of the source of the disease to prevent the spread of viral diseases.
Although nucleic acid detection is used as a "gold standard" for determining the infection of a novel coronavirus, the detection process is relatively complex because the fluorescence quantitative PCR detection (i.e., nucleic acid detection) can theoretically detect the nucleic acid of a single virus, and comprises four key links in total, namely, sample collection, sample storage and transportation, virus nucleic acid separation and purification in a sample, and virus nucleic acid detection. If any one of the two links is wrong, the fluorescent PCR detection is negative, and false negative can exist.
The virus nucleic acid preservation solution in the market mainly comprises two types of inactivation type and non-inactivation type. The non-inactivated virus nucleic acid preservation solution is similar to physiological saline or Hank's solution, and because the risk of infection exists when the non-inactivated virus nucleic acid preservation solution is used by detection personnel, the non-inactivated virus nucleic acid preservation solution is basically eliminated when the non-inactivated virus nucleic acid preservation solution is used for detecting virulent infectious disease viruses (such as new coronavirus). The inactivated virus nucleic acid preservation solution mainly comprises guanidine thiocyanate or guanidine hydrochloride, has strong corrosivity, has the defect that the virus nucleic acid preservation solution cannot be stored for a long time at room temperature after being mixed with a virus sample, and can be slowly decomposed after being stored at 37 ℃ for more than one day.
Disclosure of Invention
The invention aims to provide a buffer reagent which meets the following requirements:
1. the reagent can dissolve virus particles in samples including a throat swab, a nose swab, a genital tract swab, saliva, blood plasma, acellular body fluid (including blood plasma, blood serum, urine, CSF and cell culture supernatant), a throat swab washing solution, a genital tract swab washing solution, gargle, virus stock solution, tissue lysate and the like, and the purposes of inactivating viruses and releasing nucleic acid of the viruses are achieved.
2. The reagent can make protein (such as RNase) molecules in a denatured state, and in the case of RNA viruses, virus RNA after release is easily decomposed after being attacked by the RNase (the RNase is very stable, is not inactivated at 100 ℃ and is commonly present in the environment). The reagent can quickly denature and inactivate RNase brought in a sample, and simultaneously protect and maintain the virus RNA in a stable state.
3. The general virus nucleic acid extraction reagents in the market all contain guanidine thiocyanate or guanidine hydrochloride, and all components in the reagents can not react with the guanidine thiocyanate or the guanidine hydrochloride, so that the subsequent detection of the virus nucleic acid is not influenced.
In order to achieve the technical purpose, the invention adopts the technical scheme that:
the inactivated virus nucleic acid preserving fluid contains no guanidine salt, and comprises a protein denaturation reagent, a disulfide bond reduction reagent, a carbohydrate compound and water, wherein the pH value ranges from 4.0 to 6.0, the protein denaturation reagent, the disulfide bond reduction reagent, the carbohydrate compound and the water are based on the protein denaturation reagent, the disulfide bond reduction reagent, the carbohydrate compound and the water, the mass percent of the protein denaturation reagent is 20 to 60 percent, the mass percent of the carbohydrate compound is 10 to 25 percent, the mass percent of the disulfide bond reduction reagent is 0.1 to 0.5 percent, and the balance is the water.
Further, based on the protein denaturation reagent, the reduction reagent for the disulfide bond, the carbohydrate and the water, the mass percentage of the protein denaturation reagent is preferably 25-60%, the mass percentage of the carbohydrate is preferably 10-25%, the mass percentage of the reduction reagent for the disulfide bond is preferably 0.1-0.5%, and the mass percentage of the water is preferably 15-50%.
Further, the inactivated virus nucleic acid preservation solution may further include a buffer system component. The mass percentage of the components of the buffer system is 0.05-0.1% of the total mass of the protein denaturation reagent, the reduction reagent of the disulfide bond, the carbohydrate and the water. The pH value of the buffer system component adjustment inactivated virus nucleic acid preservation solution is 4.0-6.0.
Further, the inactivated virus nucleic acid preservation solution may further include a pH indicator dye. The weight percentage of the pH indicator dye is 0.001-0.005% of the total weight of the protein denaturation reagent, the reduction reagent of the disulfide bond, the carbohydrate and the water.
Further, preferably, the inactivated virus nucleic acid preservation solution comprises a protein denaturation reagent, a reduction reagent of a disulfide bond, a carbohydrate, a buffer system component, a pH indicator dye and water, and the weight percentage of each raw material is as follows:
25 to 60 percent of protein denaturation reagent, 10 to 25 percent of carbohydrate, 0.1 to 0.5 percent of reduction reagent of disulfide bond, 0.05 to 0.1 percent of buffer system component, 0.001 to 0.005 percent of pH indicator dye and 15 to 50 percent of water.
More preferably, the inactivated virus nucleic acid preservation solution comprises the following components in percentage by mass:
45-55% of protein denaturation reagent, 10-20% of carbohydrate, 0.1-0.5% of disulfide bond reduction reagent, 0.05-0.1% of buffer system component, 0.001-0.005% of pH indicator dye and the balance of water.
The protein denaturing agent is one or more of formamide, acetamide, thioacetamide, N-dimethylformamide, urea (carbamide), ethanol, isopropanol, ammonium formate, ammonium acetate, ammonium chloride and ammonium thiocyanate. The purpose of the protein denaturing agent is to denature and solubilize the protein components of the biological sample.
Preferably, the protein denaturing agent is one or more of formamide, thioacetamide, N-dimethylformamide, urea, ethanol, ammonium acetate, ammonium chloride and ammonium thiocyanate.
The saccharide compound is one or more of glucose, maltose, sucrose and fructose. Because the nucleic acid contains ribose or deoxyribose, the carbohydrate can promote the dissolving efficiency of the nucleic acid in the buffer solution and form molecular chaperone effect with the nucleic acid molecule.
Preferably, the saccharide compound is one or more of glucose, maltose and sucrose.
The reduction reagent of the disulfide bond is one or more of mercaptoethanol, thiourea, dithiothreitol and tri (2-carboxyethyl) phosphine. The reduction reagent of the disulfide bond can reduce the disulfide bond in the protein molecular structure, and the purpose is to further open the disulfide bond in the protein molecule after the protein is dissolved and denatured, so that the protein is more thoroughly denatured.
Preferably, the disulfide bond reducing agent is one or more of mercaptoethanol, dithiothreitol and tri (2-carboxyethyl) phosphine.
The buffer system comprises a Tris-HCl buffer system, an acetic acid-sodium acetate buffer system or an acetic acid-potassium acetate buffer system. The nucleic acid is rapidly hydrolyzed by either excessively high or excessively low pH in the nucleic acid storage solution, and the stability of the nucleic acid solution can be improved by maintaining the pH in the reagent in a stable range, with the pH being most suitable from pH4.0 to 6.0, and more preferably at pH 5.0.
The pH indicator dye is phenol red, cresol red or neutral red. The pH indicator dye is used to indicate the pH value of the buffer solution and facilitate identification of the viral nucleic acid preservation solution.
Further, the formula of the inactivated virus nucleic acid preservation solution is preferably one of the following three formulas:
the formula (I): 23% of formamide, 10% of ethanol, 20% of ammonium chloride, 15% of sucrose, 0.5% of mercaptoethanol, 0.05% of sodium acetate, 0.001% of neutral red, 31.5% of pure water and acetic acid for adjusting the pH value to 5.0;
the formula (II): 20% of thioacetamide, 20% of ammonium acetate, 10% of ammonium thiocyanate, 10% of glucose, 0.1% of dithiothreitol, 0.05% of sodium acetate, 0.001% of phenol red, 40% of pure water and acetic acid for adjusting the pH value to 5.0;
the formula (III): 15% of N, N-dimethylformamide, 20% of urea, 10% of ammonium thiocyanate, 20% of maltose, 0.1% of tris (2-carboxyethyl) phosphine, 0.05% of sodium acetate, 0.001% of cresol red, 35% of pure water and acetic acid for adjusting the pH value to 5.0.
The principle and the chemical reaction mechanism of the invention are that the reagents with the following characteristics are screened from the existing chemical reagents:
1. an agent that rapidly denatures proteins.
2. The reagent does not denature nucleic acids, and the longer the time for which the nucleic acids can be maintained stable, the better.
3. The reagent can not react with the guanidine hydrochloride and guanidine thiocyanate which are commonly used nucleic acid extracting reagent components,
does not influence the subsequent separation and purification of viral nucleic acid
Because the chemical reagents with the 3 conditions do not exist, the method adopted by the invention is to mix a plurality of chemical reagents together to form a buffer system so as to achieve the buffer solution meeting the three requirements.
The invention provides a reagent formula, wherein the reagent is used as virus nucleic acid preservation solution and has the functions of inactivation after virus sampling, virus nucleic acid release and stabilization. Suitable samples include pharyngeal swabs, nasal swabs, genital tract swabs, saliva, plasma, acellular bodily fluids (including plasma, serum, urine, CSF, and cell culture supernatants), pharyngeal swab washes, genital tract swab washes, mouth washes, viral stocks, and tissue lysates, for inactivation of viruses, and release and preservation of viral nucleic acids.
The invention is suitable for storing various virus RNA or virus DNA in saliva, acellular body fluid (including plasma, serum, urine, CSF and cell culture supernatant), gargle, nasal swab or nasal swab washing liquid, pharyngeal swab or pharyngeal swab washing liquid, genital tract swab or genital tract swab washing liquid, virus stock solution and tissue lysate. It can dissolve virus quickly, make virus lose infectivity and make the released virus nucleic acid be in stable state. After the pathological sample is obtained, the sample is added into the virus nucleic acid sample preservation solution in time for mixing, and then the pathological sample can be sent to a detection laboratory under the condition of normal temperature without low-temperature transportation.
RNA virus dissolved in the virus nucleic acid sample preservation solution does not affect the detection sensitivity for at least 1 week under the room temperature condition (15-25 ℃); the detection sensitivity is not influenced when the product is stored at-20 ℃ for at least 1 month; the product can be stored at-70 deg.C for nearly indefinite time without affecting detection sensitivity. The DNA virus dissolved in the virus nucleic acid sample preservation solution does not influence the detection sensitivity within at least 12 months under the room temperature condition (15-25 ℃); the product can be stored at-20 deg.C for nearly indefinite time without affecting detection sensitivity.
The invention also provides a method for preserving a biological sample by using the inactivated virus nucleic acid preservation solution, wherein the biological sample comprises saliva, acellular body fluid (comprising plasma, serum, urine, CSF and cell culture supernatant), gargle, nasal swab or nasal swab washing solution, pharyngeal swab or pharyngeal swab washing solution, genital tract swab or genital tract swab washing solution, virus stock solution and tissue lysate, the biological sample is divided into a liquid sample and a swab sample according to the form of the sample, and the preservation method comprises the following steps:
for liquid samples, the ratio of inactivated virus nucleic acid preservation solution: mixing the virus samples in a volume ratio of not less than 5:1, immediately shaking and uniformly mixing, and storing or mailing. When in use, the mixed solution is directly sucked for subsequent nucleic acid extraction operation.
For swab samples: and (3) directly immersing the collected swab into 1ml of inactivated virus nucleic acid preservation solution, breaking off the swab head, immediately shaking and uniformly mixing, and then storing or mailing. When in use, the mixed solution is directly sucked for subsequent nucleic acid extraction operation.
Further, the sample preserved by the inactivated virus nucleic acid sample preservation solution of the present invention may be subsequently subjected to viral nucleic acid extraction using a viral nucleic acid purification kit (Simgen cat. No. 4002050) or a viral RNA purification kit (Simgen cat. No. 4001050), trizol reagent, or the like.
The inactivated virus nucleic acid preservation solution does not contain guanidine salt components, is weak in corrosivity and strong in capability of inactivating nuclease, does not show signs of virus nucleic acid degradation after being mixed with virus and stored for 1 week at 37 ℃, and does not influence the sensitivity of virus nucleic acid detection. The virus sample can be stored and mailed after being collected in the virus nucleic acid detection technology, so that the sensitivity of subsequent virus nucleic acid detection is improved.
Drawings
FIG. 1 is a graph showing the amplification of RNA of a novel coronavirus from a virus preservation solution of formulation (I) in example 1 and a virus preservation solution of other companies in a control group.
FIG. 2 is a graph showing the amplification of RNA of a novel coronavirus from the virus preservation solution of formulation (I) in example 2 and the virus preservation solutions of other companies in the control group.
FIG. 3 photograph of Carrier RNA in example 3 electrophoresed on 1% agarose gel.
FIG. 4 is a graph showing the amplification of RNA from a novel coronavirus in formulation II virus stock solution of example 4 and a virus stock solution of other companies in a control group.
FIG. 5 is a graph showing the amplification of RNA of the novel coronavirus from the virus preservation solution of formulation (II) in example 5 and the virus preservation solution of other companies in the control group.
FIG. 6 photograph of Carrier RNA in example 6 electrophoresed on 1% agarose gel.
Detailed Description
The technical solution of the present invention is further illustrated by the following examples, but the scope of the present invention is not limited thereto.
The invention provides an inactivated virus nucleic acid preserving fluid without guanidine salt. The main components of the reagent are an amide reagent without guanidine salt and ammonium salt, the auxiliary reagent is monosaccharide or disaccharide and a disulfide bond reduction reagent, and the pH value range of the finished product reagent is between 4.0 and 6.0. If a reagent for storing a virus nucleic acid sample, which has the characteristics of virus inactivation and no guanidine salt, is commercially sold and comprises an amide group-containing reagent, ammonium salt, alcohols, saccharides and a disulfide bond reduction reagent, the reagent is considered to infringe the invention patent of the company.
Example 1
The formula of the inactivated virus nucleic acid preservation solution is as follows:
the formula (I): 23% of formamide, 10% of ethanol, 20% of ammonium chloride, 15% of sucrose, 0.5% of mercaptoethanol, 0.05% of sodium acetate, 0.001% of neutral red, 31.5% of pure water and acetic acid for adjusting the pH value to 5.0.
The virus nucleic acid preservation solution prepared by the formula (I) is used for preserving new coronavirus by comparing with a virus nucleic acid preservation solution (marked as a control group) of Shanghai Jian mining medical equipment Limited company (containing guanidine thiocyanate) in parallel, the new coronavirus RNA in the preservation solution is extracted after the new coronavirus RNA is placed at 37 ℃ for 3 days, and an amplification curve is obtained by using a new coronavirus detection kit, as shown in figure 1, the simmen virus sample preservation solution represents the formula (I) preservation solution.
The specific test method comprises the following steps:
1. saliva-administered New Corona pseudovirus (purchased from Bai' ao (Suzhou) Biotech Co., ltd., 10) 8 copies/ml) to 10 6 copies/ml；
2. Respectively using the virus nucleic acid preservation solution prepared by the formula (I), the virus nucleic acid preservation solution of a control group and the diluted saliva containing the new coronavirus to be uniformly mixed according to the volume ratio of 5:1, and preserving for 3 days in a 37 ℃ thermostat;
new coronavirus RNA was extracted from 200. Mu.l of each of the two virus nucleic acid preservation solutions with a virus nucleic acid purification kit (Simgen Cat. No. 4002050) (One tube was repeated), and 2 Xone Step Probe RT-PCR Mix (Simgen Cat. No. 7406100) and a primer and a Probe specific to the new coronavirus (F: CCCTGTGGGTTTTACACTTAA/R: ACGATTGTGCATCAGCTGA, probe:5'
FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ 1-3') amplifying the extracted RNA, and recording the amplification result. The amplification plot is shown in FIG. 1, and the CT values are shown in Table 1:
TABLE 1
The CT value of the amplified virus nucleic acid preservative fluid in the formula I is observed to be about 0.4 less than that of the virus preservative fluid in a control group, and the effect of stabilizing nucleic acid is better.
Example 2
In parallel, the viral nucleic acid preservation solution prepared according to the same formulation (one) in example 1 was compared with a viral nucleic acid preservation solution (referred to as a control group) prepared by Shanghai healthcare medical instruments Co., ltd (containing guanidine thiocyanate), and after standing at 37 ℃ for 7 days, the new coronaviruses RNA in the preservation solution was extracted, amplified by the method of example 1, and the amplification curve was recorded, as shown in FIG. 2, the simmen virus sample preservation solution represents the formulation (one) preservation solution.
The specific test method is the same as in example 1.
The CT values of PCR of the two virus nucleic acid storage solutions are shown in Table 2.
TABLE 2
The CT value of the amplified virus nucleic acid preservation solution of the formula (I) is observed to be about 1 CT value smaller than that of the virus preservation solution of the control group, the difference is obvious, and the virus nucleic acid preservation solution of the formula 1 is proved to have better effect of stabilizing nucleic acid.
Example 3
A virus nucleic acid preservation solution prepared according to the same formulation (one) as in example 1 was used to perform an anti-RNase a (bovine pancreatic ribonuclease) test in parallel with a virus nucleic acid preservation solution (referred to as a control group) of shanghai jianyan medical instruments ltd (containing guanidine thiocyanate):
the specific test method comprises the following steps:
1. diluting the RNase A to 50 ng/. Mu.l by using saliva, and adding the RNase A into two virus nucleic acid preservation solutions according to the volume ratio of 1;
2. respectively taking 200 mu l samples of two tubes from two virus nucleic acid preservation solutions added with RNase A, respectively adding 5 mu l Carrier RNA (6 mu g/mu l) into the samples, uniformly mixing, and preserving in a 37 ℃ thermostat for 1 day;
3. carrier RNA (50. Mu.l eluted) was extracted from the sample using the viral nucleic acid purification kit, and 5. Mu.l of the eluted Carrier RNA was electrophoresed on a 1% agarose gel. The electrophotograph is shown in FIG. 3. In fig. 3, M: DL2000 Ladder; 1. 2: virus nucleic acid preservative fluid prepared by the formula (I); 3. 4: virus nucleic acid preservative fluid for control group (containing guanidine thiocyanate)
FIG. 3 shows that the RNA in the virus nucleic acid preservation solution of the formula (I) still maintains the visible RNA banding pattern, while the RNA degradation banding pattern is obvious already because the anti-RNase A effect of the virus nucleic acid preservation solution of the control group is relatively poor.
Example 4
The formula (II): 20% of thioacetamide, 20% of ammonium acetate, 10% of ammonium thiocyanate, 10% of glucose, 0.1% of dithiothreitol, 0.05% of sodium acetate, 0.001% of phenol red, 40% of pure water and acetic acid for adjusting the pH value to 5.0.
The virus nucleic acid preservation solution prepared by the formula (II) is used for preserving new corona pseudoviruses by comparing with a virus nucleic acid preservation solution (marked as a control group) of Shanghai Jiancai medical equipment Limited company (containing guanidine thiocyanate) in parallel, after the virus nucleic acid preservation solution is placed at 37 ℃ for 3 days, the RNA of the new corona pseudoviruses in the preservation solution is extracted, an amplification curve is detected, as shown in figure 4, the simgen virus sample preservation solution represents the formula (II) preservation solution.
The specific test method was the same as in example 1.
The CT values of PCR of the two virus nucleic acid storage solutions are shown in Table 3.
TABLE 3
It can be observed that the amplified CT value of the virus nucleic acid preservative solution of the formula (II) is slightly smaller than the average value of the control group, and the difference is not obvious.
Example 5
The formula (III): 15% of N, N-dimethylformamide, 20% of urea, 10% of ammonium thiocyanate, 20% of maltose, 0.1% of tris (2-carboxyethyl) phosphine, 0.05% of sodium acetate, 0.001% of cresol red, 35% of pure water and acetic acid for adjusting the pH value to 5.0.
The virus nucleic acid preservation solution prepared by the formula (III) is used for preserving new corona pseudoviruses by comparing with a virus nucleic acid preservation solution (marked as a control group) of Shanghai Jian mining medical equipment Limited company (containing guanidine thiocyanate), RNA of the new corona pseudoviruses in the preservation solution is extracted after the solution is placed at 37 ℃ for 3 days, an amplification curve is detected, as shown in figure 5, and in figure 5, the simmen virus sample preservation solution represents the formula (III) preservation solution.
The specific test method is the same as in example 1.
The CT values of PCR of the two virus nucleic acid storage solutions are shown in Table 4.
TABLE 4
It can also be observed that the CT value of the virus nucleic acid preservative solution of the formula (III) is slightly smaller than the average value of the control group, and the difference is not obvious.
Example 6
In parallel with the viral nucleic acid preservation solutions prepared according to the formulation (two) in example 4 and the formulation (three) in example 5, the anti-RNase a (bovine pancreatic ribonuclease) test was performed on the viral nucleic acid preservation solutions (referred to as a control group) of shanghai jianzhi medical devices ltd:
the specific test method comprises the following steps:
1. diluting the RNase A to 50 ng/. Mu.l by saliva, and adding the RNase A into three virus nucleic acid preservation solutions according to the volume ratio of 1;
2. respectively taking two tubes of 200 mu l samples from three virus nucleic acid preservation solutions added with RNase A, respectively adding 5 mu l Carrier RNA (6 mu g/mu l) into the samples, uniformly mixing, and preserving in a 37 ℃ thermostat for 1 day;
3. the Carrier RNA in the sample was extracted using the viral nucleic acid purification kit (50. Mu.l eluted), and 5. Mu.l of the eluted Carrier RNA was electrophoresed on a 1% agarose gel. The electrophotograph is shown in FIG. 6. In fig. 6, M: DL2000 Ladder; 1. 2: virus nucleic acid preservative solution for control group (containing guanidine thiocyanate); 3. 4: virus nucleic acid preservative fluid prepared by the formula (II); 5. 6: virus nucleic acid preservative fluid prepared according to formula (III)
It can also be observed that the RNA in the virus nucleic acid preservation solution of the formula (II) and the formula (III) still maintains a visible RNA banding pattern, while the virus nucleic acid preservation solution of the control group has relatively poor anti-RNase A effect and has obvious RNA degradation banding patterns.
Claims (10)
1. The inactivated virus nucleic acid preservation solution is characterized by comprising a protein denaturation reagent, a disulfide bond reduction reagent, a carbohydrate compound and water, wherein the pH value ranges from 4.0 to 6.0, the protein denaturation reagent, the disulfide bond reduction reagent, the carbohydrate compound and the water are based on the protein denaturation reagent, the disulfide bond reduction reagent, the carbohydrate compound and the water, the mass percent of the protein denaturation reagent is 20 to 60 percent, the mass percent of the carbohydrate compound is 10 to 25 percent, the mass percent of the disulfide bond reduction reagent is 0.1 to 0.5 percent, and the balance is the water.
2. The storing solution for nucleic acid of inactivated virus free of guanidine salt according to claim 1, wherein the storing solution for nucleic acid of inactivated virus contains a buffer system component; the buffer system comprises 0.05-0.1% of the total mass of the protein denaturation reagent, the reduction reagent of the disulfide bond, the carbohydrate and the water in percentage by mass.
3. The preserving fluid for inactivated viral nucleic acid without guanidine salt according to claim 1 or 2, wherein the preserving fluid for inactivated viral nucleic acid comprises a pH indicator dye; the weight percentage of the pH indicator dye is 0.001-0.005% of the total weight of the protein denaturation reagent, the reduction reagent of the disulfide bond, the carbohydrate and the water.
4. The preserving fluid for nucleic acid of inactivated virus without guanidine salt according to claim 1, which is characterized by comprising a protein denaturation reagent, a reduction reagent for disulfide bonds, a carbohydrate compound, a buffer system component, a pH indicator dye and water, wherein the raw materials comprise, by mass:
25 to 60 percent of protein denaturation reagent, 10 to 25 percent of carbohydrate, 0.1 to 0.5 percent of reduction reagent of disulfide bond, 0.05 to 0.1 percent of buffer system component, 0.001 to 0.005 percent of pH indicator dye and 15 to 50 percent of water.
5. The preservative solution for inactivated viral nucleic acid not containing guanidine salt according to any one of claims 1 to 4, wherein the protein denaturing agent is one or more of formamide, acetamide, thioacetamide, N-dimethylformamide, urea, ethanol, isopropanol, ammonium formate, ammonium acetate, ammonium chloride and ammonium thiocyanate.
6. The preservative solution for inactivated viral nucleic acid according to any one of claims 1 to 4, wherein the sugar compound is one or more of glucose, maltose, sucrose and fructose.
7. The preservative solution for inactivated virus nucleic acid not containing guanidine salt according to any one of claims 1 to 4, wherein the disulfide bond reducing agent is one or more of mercaptoethanol, thiourea, dithiothreitol, and tris (2-carboxyethyl) phosphine.
8. The preserving fluid for nucleic acid of inactivated virus without guanidine salt according to claim 4, wherein the preserving fluid for nucleic acid of inactivated virus has a formulation of one of the following three:
the formula (I): 23% of formamide, 10% of ethanol, 20% of ammonium chloride, 15% of sucrose, 0.5% of mercaptoethanol, 0.05% of sodium acetate, 0.001% of neutral red, 31.5% of pure water and acetic acid for adjusting the pH value to 5.0;
the formula (II): 20% of thioacetamide, 20% of ammonium acetate, 10% of ammonium thiocyanate, 10% of glucose, 0.1% of dithiothreitol, 0.05% of sodium acetate, 0.001% of phenol red, 40% of pure water and acetic acid for adjusting the pH value to 5.0;
the formula (III): 15% of N, N-dimethylformamide, 20% of urea, 10% of ammonium thiocyanate, 20% of maltose, 0.1% of tris (2-carboxyethyl) phosphine, 0.05% of sodium acetate, 0.001% of cresol red, 35% of pure water and acetic acid for adjusting the pH value to 5.0.
9. Use of the inactivated viral nucleic acid preservative solution free of guanidinium according to any one of claims 1 to 8 for preserving various viral RNAs or viral DNAs in saliva, cell-free body fluids, mouth washes, nasal swabs or nasal swab washes, pharyngeal swabs or pharyngeal swab washes, genital tract swabs or genital tract swab washes, viral stock solutions or tissue lysates; the cell-free body fluid includes plasma, serum, urine, CSF, or cell culture supernatant.
10. A method for preserving a biological sample comprising saliva, an acellular body fluid comprising plasma, serum, urine, CSF, or a cell culture supernatant, a mouth wash, a nasal swab or a nasal swab wash, a pharyngeal swab or a pharyngeal swab wash, a genital tract swab or a genital tract swab wash, a viral stock solution, or a tissue lysate; the sample is divided into a liquid sample and a swab sample according to the form of the sample, and the preservation methods respectively comprise the following steps:
for liquid samples, the ratio of inactivated virus nucleic acid preservation solution: mixing the virus samples in a volume ratio of not less than 5:1, immediately shaking and uniformly mixing, and storing or mailing;
for swab samples: and (3) directly immersing the collected swab into 1ml of inactivated virus nucleic acid preservation solution, breaking off the swab head, immediately shaking and uniformly mixing, and then storing or mailing.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2022105551467 | 2022-05-19 | ||
| CN202210555146 | 2022-05-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115948501A true CN115948501A (en) | 2023-04-11 |
Family
ID=87281600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211571667.8A Pending CN115948501A (en) | 2022-05-19 | 2022-12-08 | Inactivated virus nucleic acid preserving fluid without guanidine salt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115948501A (en) |
-
2022
- 2022-12-08 CN CN202211571667.8A patent/CN115948501A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107227306B (en) | Swab eluent with sample preservation and inactivation functions | |
| CN110982876B (en) | Pretreatment method, pretreatment liquid, kit and application of virus nucleic acid detection | |
| CN112626169B (en) | Sample preservation solution for preserving nucleic acid in biological sample and use method thereof | |
| CN111088319B (en) | Inactivated virus sample RNA preservation solution and preparation method thereof | |
| CN111549101A (en) | Preservation solution for biological sample nucleic acid detection and application | |
| US20110027862A1 (en) | Sample stabilization | |
| CN105506129B (en) | A kind of RNA class Sample preservation dilution and its preparation | |
| CN111718908A (en) | Virus sample preserving fluid and preparation method and application thereof | |
| CN111534576B (en) | Method, composition, kit and use for fluorescent quantitative PCR | |
| CN109371008B (en) | Nucleic acid extraction amplification detection kit | |
| Moss et al. | Comparison of the plaque test and reverse transcription nested PCR for the detection of FMDV in nasal swabs and probang samples | |
| CN112779316A (en) | Inactivated virus preservation solution and preparation method thereof | |
| JP2023522054A (en) | Methods, apparatus, and kits for preparing nucleic acid samples for storage and analysis | |
| CN108949748B (en) | Sputum liquefaction and nucleic acid protection reagent | |
| Soares et al. | Prevalence of Mycoplasma agassizii and chelonian herpesvirus in captive tortoises (Testudo sp.) in the United Kingdom | |
| CN112680545A (en) | Virus sample direct amplification type preservation solution and application method thereof | |
| CN114621948A (en) | Efficient nucleic acid extraction kit and use method thereof | |
| CN112646803A (en) | Viral genome nucleic acid extraction kit, method and application | |
| CN110511926B (en) | Preservation solution for plasmids and pseudoviruses and application thereof | |
| CN109439800B (en) | Kit and method for detecting gene mutation of PR region and RT region of HIV-1 gene | |
| CN110819625A (en) | Method for extracting genome DNA (deoxyribonucleic acid) suitable for bacteria and/or fungi | |
| CN112608978A (en) | Novel nucleic acid hand-free storage solution | |
| CN115948501A (en) | Inactivated virus nucleic acid preserving fluid without guanidine salt | |
| CN111718927A (en) | Preservation solution for improving stability of nucleic acid and application thereof | |
| CN114107442B (en) | Viscous biological sample liquefaction release combination product, kit, liquefaction release method and nucleic acid extraction, amplification and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |