CN115948325A - Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells - Google Patents

Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells Download PDF

Info

Publication number
CN115948325A
CN115948325A CN202211614511.3A CN202211614511A CN115948325A CN 115948325 A CN115948325 A CN 115948325A CN 202211614511 A CN202211614511 A CN 202211614511A CN 115948325 A CN115948325 A CN 115948325A
Authority
CN
China
Prior art keywords
compound
pyrrolo
bond
pyridin
added
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211614511.3A
Other languages
Chinese (zh)
Inventor
魏君
蔡萌
宋永康
魏梦雅
毛晓惠
邓喆
陈细平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan Iregene Pharmaceutical Technology Co ltd
Original Assignee
Wuhan Iregene Pharmaceutical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan Iregene Pharmaceutical Technology Co ltd filed Critical Wuhan Iregene Pharmaceutical Technology Co ltd
Priority to CN202211614511.3A priority Critical patent/CN115948325A/en
Publication of CN115948325A publication Critical patent/CN115948325A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to a pyrrolopyridine derivative and application thereof, wherein the pyrrolopyridine derivative is a compound which can be used for inducing the transformation of mesenchymal cells into epithelial cells and has the following formula:
Figure DDA0004000046690000011
wherein, m1, m2 and A 2 、A 3 Described herein.

Description

Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells
Technical Field
The invention relates to the field of medicines, in particular to a group of compounds and application thereof in the process of inducing mesenchymal cells to transform into epithelial cells and reprogramming.
Background
Interconversion between epithelial and mesenchymal cells is a highly conserved and reversible cellular process in which polarized, immobile epithelial cells extend filopodia from their basal surfaces and produce migrating mesenchymal cells. Epithelial-mesenchymal and mesenchymal-epithelial transformations are well-established biological events that play important roles not only in normal tissue and organ development, but also in the pathogenesis of disease. The phenotypic changes of cells between epithelial and mesenchymal states are divided into epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET), which is not only central to the complex remodelling of embryonic and organ structures during gastrulation and organogenesis, but is also recognized as a key event in the metastasis of many cancers (thiery, jp. Nat Rev cancer, 2002;2 442-54.
In early drosophila development, newly formed epithelial germ layers will participate in complex morphogenic movements to allow embryonic development, e.g., the formed ectodermal cells will retain their epithelial phenotype (Tepass, U.S. Bioessays 19,1997, 673-682, tepass, U.S. & Hartenstein, V.Dev.biol.161,1994: 563-596). The developmental process of the mesoderm also observed circulation of EMT-MET, these cells forming dorsal vascular gonadal sheets and malpighial tubules by invagination in the ventral groove (Campbell, k.et al, mech. Dev.2010.127, 345-357). Most other metazoan development proceeds through a series of divisions of fertilized eggs and the stepwise assembly of epithelial-like structures (Stern, c.d. (ed.). Stimulation: from Cells to organisms Laboratory Press, new York, 2004.) thus MET occurs during normal development, including somatic, renal, cardiac, hepatic, and coelomic processes (Bin L et al, PLoS one.2011;6 (2) e 92; nakajima Y et al, anat rec.2000;258 119-127.) the findings show that the mechanism of MET during morphogenesis is similar, presenting a uniform tendency for epithelial-related genes to be up-regulated and down-regulated, but each process has a unique signaling pathway to induce MET and related changes in gene expression.
Similarly, embryonic Stem Cells (ESC) or Induced Pluripotent Stem Cells (iPSCs) also undergo EMT and MET differentiation into adult cell types. Then somatic cells in differentiation can also be reprogrammed into a pluripotent state by sequential EMT-MET, which is a key step in achieving pluripotency (Shu, X. & Pei, d.curr. Opin. Genet.dev.28,2014, 32-37). Studies have shown that MET in reprogramming achieves changes in cell fate through synergy with metabolic switching, epigenetic modifications (Wu, j., ocampo, a. And Belmonte, j.c.i.cell,2016,166, 1371-1385). Studies have shown that MET plays a very critical role in early somatic reprogramming of mouse embryos and human fibroblasts (Hofding, m.k. And hytte, p.stem Cell res.2015, 14,39-53, subramayam, d.et al. Nat. Biotechnol.2011, 29,443-448 li, r.et al. Cell Stem Cell 2010,7, 51-63. In this process, the BMP4 pathway plays a critical role in the initiation of MET by activating intron 2 of CDH1 (encoding E-cadherin) and the promoter CLDN4 (encoding claudin-4) to increase the action of MET. At present, compounds combined with target proteins can be predicted according to a protein structure prediction tool, and compounds for up-regulating the target proteins are obtained through functional screening; meanwhile, various microribonucleic acids (mirRNA) have been found to exhibit a high correlation with MET occurrence, such as mir-134, mir-145, mir-470 and mir-200c, all of which exhibit negative MET-modulating characteristics (Ester E Creemers 1, anke J Tijsen, yigal M pinto, circ Res,2012Feb 3 (3): 483-95 Li, R.et al.cell Stem cell.2010,7, 51-63. Therefore, inhibitory compounds can be designed according to the structure of such regulatory micro ribonucleic acid (mirna), thereby achieving positive regulation of MET phenomenon.
Thus, MET plays an important role in a variety of developmental processes, and there are currently a variety of means to regulate development in vitro, to reconstitute aged or functionally compromised tissues and organs, and to treat related diseases by a variety of medical means. This is the important research direction of regenerative medicine, focusing on the mechanism of normal tissue characteristics and functions, exploring the biological basis of post-traumatic repair, the regenerative mechanism of tissues and organs and the differentiation mechanism of various stem cells, and finally obtaining an effective biotherapeutic method. Among them, embryonic stem cells (ESCs, abbreviated as ES, EK or ESC) and induced pluripotent stem cells (induced pluripotent stem cells) are the most interesting research materials. However, most of the current regulation of development involves genome modification, and various means including regulation of viral vectors have potential tumorigenic risks. Therefore, it is important to use a regulation mode that does not change the genome sequence. Among them, if a compound capable of modulating MET is discovered, the compound can play a great role in the fields of reprogramming, cell differentiation and tissue reconstruction, and the aim of safer and more flexible modulation is fulfilled.
The invention content is as follows:
based on the reasons, the pyrrolopyridine derivative capable of simultaneously combining the Oct4 protein structure and the negative regulation mirRNA structure is designed according to the Oct4 protein structure and the negative regulation mirRNA structure combined with the Oct4 compound. The pyrrolopyridine derivative can perform Oct4 chemical activation to realize expression regulation of downstream genes thereof. Thereby avoiding the regulation and control of Oct4 by using viruses or other vectors and further realizing the safe and simple chemical small molecule enhanced biological expression function.
The invention provides application of a pyrrolopyridine derivative compound, which can realize the biological phenomenon of MET in various cells, cause cell deformation and simultaneously realize the expression of epithelial cell related genes and reprogramming early genes. Provides a powerful starting compound for chemical induction of reprogramming.
The invention relates to a pyrrolopyridine derivative, a compound with a structure shown in formula (I) or a pharmaceutically acceptable salt, a solvate, an active metabolite, a polymorph, an ester, an optical isomer or a prodrug thereof, a pharmaceutical composition containing the compound with the structure shown in formula (I) and application of the compound as an Oct4 high-selectivity activator in reprogramming of cells.
The present invention provides a compound of the structure of formula (I):
Figure BDA0004000046670000031
wherein:
m1 and m2 are each 0 or 1;
A 2 is C 1 -C 6 Alkylene radical, C 2 -C 6 Alkenylene, -O (CH) 2 )q-、-NR 1 -、-SO 2 -、-(CH 2 ) V NHS(O) 2 Or a bond, wherein q is 1 or 2 or 3 or 4, V is 0 or 1 or 2, R 1 Is selected from H or C 1 -C 4 An alkyl group;
A 3 is C 1 -C 6 An alkyl group; c 2 -C 6 An alkenyl group; c 4 -C 6 Cycloalkyl, wherein one carbon atom may be substituted by a N, O, S heteroatom;
Figure BDA0004000046670000032
z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano;
Figure BDA0004000046670000033
Z 3 is N, O, S or C = O, when Z is 4 And Z 5 When the bond between is a single bond, Z 4 Is N or CH, Z 5 Is CH 2 Or C = O, when Z 4 And Z 5 When the bond between is a double bond, Z 4 Is C, Z 5 Is CH; or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug thereof, or a combination thereof.
In some embodiments: a. The 2 is-CH 2 -、-CH＝CH-、-C(CH 3 )＝CH-、-O(CH 2 )-、-O(CH 2 ) 2 -、-NH-、-N(CH 3 )-、-SO 2 -、-NHS(O) 2 -、-(CH 2 ) 2 NHS(O) 2 -or a bond.
In some casesIn the examples: a. The 3 is-CH 3 Butenyl, butenyl,
Figure BDA0004000046670000041
Figure BDA0004000046670000042
In some embodiments: m1 is 0, m2 is 1; a. The 2 is-N (CH) 3 )-；A 3 Is that
Figure BDA0004000046670000043
In some embodiments: m1 is 1, m2 is 0; a. The 2 is-CH 2 -、-SO 2 -、-(CH 2 ) 2 NHS(O) 2 -or a bond; a. The 3 is-CH 3 、
Figure BDA0004000046670000044
In some embodiments: m1 is 1, m2 is 1; a. The 2 is-CH 2 -、-NH-、-C(CH 3 ) = CH-or a bond; a. The 3 is-CH 3 、-C(CH 3 )＝CH-CH 3 、
Figure BDA0004000046670000045
Figure BDA0004000046670000046
In some embodiments: m1 is 0, m2 is 0; a. The 2 is-CH 2 -、-CH＝CH-、-O(CH 2 )-、-O(CH 2 ) 2 -or a bond; a. The 3 Is that
Figure BDA0004000046670000051
In some embodiments, the compound is:
Figure BDA0004000046670000052
the present invention relates to pharmaceutical compositions comprising at least one compound of any of the above or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug or a combination of two or more thereof, and at least one pharmaceutically acceptable carrier or excipient.
The present invention relates to the use of a compound of any of the above and/or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug or combination thereof for the preparation of a medicament for inducing transformation of mesenchymal cells into epithelial cells.
The present invention relates to a method of activating Oct4 comprising contacting a compound of any of the above and/or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug, or combination thereof, with an Oct4 target protein.
Drawings
The upper part of FIG. 1 shows the caloric change of the sample cell, where the red line of the peak is the miR-145 binding exotherm with A-3-6 and the blue line is the A-3-6 binding exotherm without miR-145 buffer. The lower half of FIG. 1 shows the peak area fitted to the Multiple Sites model curve, where calculated nSites of 3 and 1.8 correspond to Kd (M) of 7.017E-8 and 7.544E-9, respectively, and blank group Kd (M) of 1.000E-3. The ITC test result proves that the small molecule obtained by the invention can be specifically combined with a target spot;
FIG. 2 shows that the control with the addition of pyrrolopyridine derivatives caused the MET phenomenon to occur after 24 hours of treatment of cells with pyrrolopyridine derivatives alone, and the cells exhibited typical epithelial morphology (wherein CK is the control);
FIG. 3 shows the results of the basal expression of Oct4 etc. gene by pyrrolopyridine derivatives (wherein CK is a control group).
Detailed Description
In the present invention, the following definitions are applicable:
the term "alkyl" as used herein refers to straight or branched chain groups containing from 1 to 12 carbon atomsA saturated hydrocarbon. (C) 1 -C 6 ) Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, isobutyl, sec-butyl, tert-butyl, isopentyl, neopentyl, and isohexyl.
The term "alkenyl" refers to straight or branched chain unsaturated hydrocarbons containing 2 to 12 carbon atoms, containing at least one C = C double bond in the chain. Examples of alkenyl groups include ethenyl, propenyl, n-butenyl, isobutenyl, pentenyl or hexenyl.
The term "alkylene": refers to a divalent alkyl group. Any of the monovalent alkyl groups can be an alkylene group by abstraction of a second hydrogen atom from the alkyl group. Alkylene may also be C, as defined herein 1 -C 6 An alkylene group. Alkylene may further be C 1 -C 4 An alkylene group. Typical alkylene groups include, but are not limited to: -CH 2 -、-CH(CH 3 )-、-C(CH 3 ) 2 -、-CH 2 CH 2 -、-CH 2 CH(CH 3 )-、-CH2C(CH 3 ) 2 -、-CH 2 CH 2 CH 2 -、-CH 2 CH 2 CH 2 CH 2 -and the like.
The term "alkenylene": refers to a divalent alkenyl group. Any of the monovalent alkenyl groups may be alkenylene by abstraction of a second hydrogen atom from the alkenyl group. Alkenylene may further be C, as defined herein 2 -C 6 An alkenylene group. Typical alkenylene groups include, but are not limited to: -CH = CH-, -CH = C (CH) 3 )-、-CH＝CHCH 2 -、-CH＝CHCH 2 CH 2 -、-CH＝CHCH 2 CH 2 CH 2 -、-CH＝CHCH 2 CH 2 CH 2 CH 2 -and the like.
The term "cycloalkyl" refers to a monocyclic saturated carbocyclic ring containing 3 to 18 carbon atoms. Cycloalkyl may further be C 4 -C 6 A cycloalkyl group. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like.
The term "halogen" refers to fluorine, chlorine, bromine or iodine.
The term "cyano" refers to a substituent having a carbon atom attached to a nitrogen atom through a triple bond (i.e., C ≡ N).
The term "substituted," as used herein, means that any one or more hydrogen atoms on the designated atom or group is replaced with a group selected from the designated ranges, provided that the designated atom's normal valence is not exceeded.
In certain embodiments described herein, there are provided compounds of formula (I), wherein when a is 2 When a "bond" is present, the structure of the compound of formula (I) is:
Figure BDA0004000046670000071
compounds described herein include, but are not limited to: their optical isomers, racemates and other mixtures. In these cases, the individual enantiomers or diastereomers, i.e., optically active configurations, can be obtained by asymmetric synthesis or by resolution of the racemates or diastereomeric mixtures. Resolution of the racemates or diastereomeric mixtures may be accomplished by conventional methods, such as crystallization in the presence of a resolving agent or chromatography, e.g., using a chiral High Pressure Liquid Chromatography (HPLC) column. Furthermore, these compounds include compounds having chiral centers in the R-and S-configurations. These compounds also include crystalline forms, including polymorphs and clathrates. Similarly, the term "salt" also includes all isomers, racemates, other mixtures, R-and S-configurations, tautomers and crystal forms of the salts of said compounds.
"pharmaceutically acceptable salt" refers to a salt of a free acid or base of a compound represented by formula (I), formula (II), or formula (III) that is non-toxic, biologically tolerable, or otherwise biologically suitable for administration to a subject to be treated. See generally: s.m. berge, et al, "Pharmaceutical Salts", j.pharm. sci, 1977, 66:1-19, and Handbook of pharmaceutical Salts, properties, selection, and Use, stahl and Wermuth, eds., wiley-VCH and VHCA, zurich,2002. Preferably pharmaceutically acceptable salts are those that are pharmacologically effective and suitable for contacting the tissues of a patient without undue toxicity, irritation or allergic response. The compounds of formula (I), formula (II) or formula (III) may have sufficient acidic groups, sufficient basic groups or both types of functional groups and react with some inorganic or organic bases, and inorganic and organic acids, respectively, to form a pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, hydrochloride, hydrobromide, hydroiodide, acetate, propionate, caprate, caprylate, acrylate, formate, isobutyrate, hexanoate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1, 4-dioate, hexyne-1, 6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, γ -hydroxybutyrate, glycolate, tartrate, methane sulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, and mandelate.
"solvates" such as "hydrates" are formed by the interaction of a solvent with a compound. The term "compound" includes solvates, including hydrates, of the compound. Likewise, "salt" includes solvates of the salt, such as hydrates. Suitable solvates are pharmaceutically acceptable solvates, such as hydrates, including the monohydrate and the hemihydrate.
"prodrug" may refer to a precursor of a given compound that, upon administration to a subject, yields the compound in vivo via a chemical or physiological process (e.g., solvolysis, enzymatic cleavage) or under physiological conditions (e.g., a prodrug is converted to a compound of formula (I) at physiological pH). A "pharmaceutically acceptable prodrug" is a prodrug that is non-toxic, biologically tolerable, or otherwise biologically suitable for administration to a subject. Exemplary procedures for selecting and preparing suitable prodrug derivatives are described, for example, in "Design of produgs", elsevier,1985, by h.
"active metabolite" refers to a pharmaceutically active product of the metabolism of a compound of formula (I), formula (II) or formula (III) or a salt thereof in the body. Prodrugs and active metabolites of a compound may be determined by conventional techniques known or available in the art. See, e.g., bertolini et al, j.med.chem.1997, 40, 2011-2016; shan et al, J.pharm.Sci.1997, 86 (7), 765-767; bagshawe, drug Dev. Res.1995, 34, 220-230; bouor, adv. Drug res.1984, 13, 224-331; bundgaard, design of produgs (ElsevierPress, 1985); and Larsen, design and Application of precursors, drug Design and development (Krogsgaard-Larsen et al, eds., harwood Academic Publishers, 1991)
A "therapeutically effective amount" refers to an amount of a compound disclosed herein that, when administered to a mammal (preferably a human), is sufficient to effect treatment (as defined below) of a disease or condition in the mammal (preferably a human). The amount of the disclosed compounds that constitutes a "therapeutically effective amount" will vary with the compound, the condition and its severity and the age of the mammal being treated, but can be routinely determined by one of ordinary skill in the art based on his own knowledge and the disclosure herein.
The term "treating" refers to administering to an individual at least one compound and/or at least one pharmaceutically acceptable salt thereof as described herein to slow down (reduce) the development or spread of an undesired physiological change or disease, such as inflammation or cancer. Objects of the present invention, beneficial or desired clinical results include, but are not limited to: alleviation of symptoms, reduction of the severity of a disease, stabilization (i.e., not worsening) of the state of a disease, delay or slowing of disease progression, amelioration or palliation of the disease, and remission (whether partial or total), whether detected or undetectable. "treatment" also means that survival can be extended compared to expected survival without treatment. Individuals in need of treatment include individuals with symptoms of or suffering from such diseases.
Pharmaceutical composition
The present invention provides pharmaceutical compositions comprising one or more compounds described herein, or pharmaceutically acceptable salts or esters thereof, as an active ingredient, together with one or more pharmaceutically acceptable excipients, carriers, including inert solid diluents and fillers, diluents, including sterile aqueous solutions and various organic solvents, penetration enhancers, solubilizers and adjuvants. The pharmaceutical composition may be administered alone or in combination with other therapeutic agents. Such compositions are prepared in a manner well known in the pharmaceutical art.
The pharmaceutical compositions may be administered in single or multiple doses by any acceptable means of administration of agents having similar uses, such as those described in those patents and patent applications incorporated herein by reference, including rectal, buccal, intranasal, and transdermal routes, by intra-arterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, as an inhalant, or by implantation or coating devices such as stents, for example, or arterial insertion of a pillared polymer.
The invention also provides a kit comprising a pharmaceutical composition comprising a compound of the invention, or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier.
"pharmaceutically acceptable carrier or excipient" refers to a non-toxic, biologically tolerable and other material that is biologically suitable for administration to a subject, e.g., an inert material, which is added to the pharmacological composition or serves as a vehicle, carrier or diluent to facilitate administration of the active ingredient and is compatible therewith. Examples of excipients include calcium carbonate, calcium phosphate, various types of sugars or starches, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
"a combination of two or more of them": it is to be understood that "a combination of two or more thereof" refers to a combination of two or more of a compound, a pharmaceutically acceptable salt thereof, a pharmaceutically acceptable solvate thereof, a pharmaceutically acceptable active metabolite thereof, a pharmaceutically acceptable polymorph thereof, a pharmaceutically acceptable ester thereof, a pharmaceutically acceptable optical isomer thereof, and a pharmaceutically acceptable prodrug thereof ".
Use of compounds and compositions thereof
The invention provides a compound and application of a composition thereof, wherein the compound is mainly used as an Oct4 high-selectivity activator for activating the function of Oct4, and the application of the compound to the transformation of mesenchymal cells to epithelial cells is realized by realizing the expression regulation of downstream genes of Oct4 promoters through the chemical regulation of the Oct4 promoters.
A list of abbreviations used in the following examples and elsewhere herein:
CH 2 Cl 2 : dichloromethane; cs 2 CO 3 : cesium carbonate; cu 2 SO 4 : cuprous sulfate; DCM: dichloromethane; DMAC: n, N-dimethylacetamide; DMF: n, N-dimethylformamide; DIEA: n, N-diisopropylethylamine; DIOX:1, 4-dioxane; EA: acetic acid; et (Et) 3 N: triethylamine; ETOH: ethanol; etOAc: ethyl acetate; and (2) FA: formic acid; g: g; h: hours; HATU:2- (7-azabenzotriazole) -N, N' -tetramethyluronium hexafluorophosphate; HBr: hydrobromic acid; (Hbim) BF4: 1-butylimidazolium tetrafluoroborate; h 2 O: water; HAc: acetic acid; h 2 O 2 : hydrogen peroxide; h 2 SO 4 : fuming sulfuric acid; KCN: potassium cyanide; k is 2 CO 3 : potassium carbonate; MCA: chloroacetic acid; meCN: acetonitrile; meOH: methanol; mg: mg; mL: milliliters of the solution; mmol: millimole; mol: mole; mol/L: mol/liter; m/z: a mass to charge ratio; n is a radical of 2 : nitrogen gas; naBH 3 CN: sodium cyanoborohydride; naNO 2 : sodium nitrite; naOH: sodium hydroxide; na (Na) 2 SO 4 : sodium sulfate; pH: the pH value; TBN: nitroso-tert-butyl ester; TEA: triethanolamine; THF: tetrahydrofuran; TLC: thin layer chromatography; μ L: microliter; a xylylene group: xylene.
The technical means adopted by the invention to achieve the predetermined purpose are further described below with reference to the drawings and the embodiments of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagent materials used in the following examples are all commercially available products unless otherwise specified.
General Synthesis
The general synthetic routes described in the present application can be varied by replacing the starting materials with other materials having similar structures, resulting in different products accordingly. The following synthetic scheme description gives a number of examples of how the starting materials may be varied to give the corresponding products.
General procedure A-1-n
Figure BDA0004000046670000101
Wherein R is
Figure BDA0004000046670000102
Wherein q is 1 or 2 or 3 or 4, Z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano.
General procedure A-3-n
Figure BDA0004000046670000103
Wherein R is C 2 -C 6 An alkenyl group;
Figure BDA0004000046670000104
Figure BDA0004000046670000105
wherein q is 0 or 1 or 2 or 3 or 4, Z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano radicals, R 1 Is selected from H or C 1 -C 4 Alkyl radical, Z 3 Is N, O, S or C = O.
General procedure A-4-n
Figure BDA0004000046670000111
Wherein R is
Figure BDA0004000046670000112
Wherein q is 0 or 1 or 2 or 3 or 4, Z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano.
General procedure A-6-n
Figure BDA0004000046670000113
Wherein R is C 4 -C 6 Cycloalkyl, wherein one carbon atom may be substituted by a N, O, S heteroatom; or is
Figure BDA0004000046670000114
Wherein q is 0 or 1 or 2 or 3 or 4, Z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano.
Synthesis of intermediates
Intermediate I-3: 1H-pyrrolo [2,3-c ] pyridin-5-ol
The synthesis route is as follows:
Figure BDA0004000046670000115
step 1: intermediate 1H-pyrrolo [2,3-c ] pyridine-5-diazoI-2
To 1H-pyrrolo [2,3-c ]]Pyridine-5-amine I-1 (66.6mg, 0.5mmol) to which water (2 mL) and 20% H were added 2 SO 4 Aqueous solution (1 mL). To the mixture were added a solution (0.5 mL) of an aqueous sodium nitrite solution (42mg, 0.6 mmol) and acetonitrile (2 mL) under ice-cooling, and the mixture was stirred for 30 minutes. To the resulting reaction mixture was added Cu in 20% aqueous HBr (0.5 mL) at room temperature 2 SO 4 (67mg, 0.3 mmol) and the mixture was stirred at 80 ℃ for 30 minutes. Ethyl acetate and water were added to the reaction mixture. The organic layer was separated, washed with brine, dried over sodium sulfate and concentrated under reduced pressure. Subjecting the residue to silica gel column chromatography (chloroform): methanol = 50)]Bisulfate salt of pyridine-5-diazoI-2 (94mg, 78%), liquid phase Mass Spectrometry m/z =145.1[ M ], [ M ]]+。
And 2, step: intermediate 1H-pyrrolo [2,3-c ] pyridin-5-ol I-3
An aqueous solution (1 mL) of the hydrogen sulfate salt (48mg, 0.2mmol) of the above 1H-pyrrolo [2,3-c ] pyridine-5-diazoI-2 was added dropwise to a 40% aqueous sulfuric acid solution (5 mL) at 100 ℃ and the mixture was stirred for 10 minutes. To the resulting reaction mixture was added NaOH to a PH of about 3, ethyl acetate was added to the reaction mixture, and the organic layer was separated, washed with brine, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform: methanol = 50.
Example 1: ((1H-pyrrolo [2,3-c ] pyridin-5-yl) oxy) methyl) benzonitrile A-1
Figure BDA0004000046670000121
The method comprises the following steps: reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-ol I-3 (10mg, 0.07mmol) and 3- (bromomethyl) benzonitrile (20mg, 0.1mmol) with K 2 CO 3 (138mg, 1mmol), acetonitrile (2 mL) was added, and the mixture was heated to 40 ℃ and stirred for 10 minutes. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: methanol = 40)]Pyridin-5-yl) oxy) methyl) benzonitrile A-1-1 (11mg, 63%), liquid phase Mass Spectrometry m/z =250.1[ M ] +H]+
Example 2: 5-Phenylethoxy-1H-pyrrolo [2,3-c ] pyridine A-1-2
Figure BDA0004000046670000122
The method comprises the following steps: reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-ol I-3 (10mg, 0.07mmol) and (2-bromoethyl) benzene (22mg, 0.12mmol) with K 2 CO 3 (138mg，1 mmol), acetonitrile (2 mL) is added and the mixture is heated to 40 ℃ and stirred for 10 minutes. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: methanol = 40)]Pyridine A-1-2 (13mg, 78%), liquid phase mass spectrum m/z =239.1[ m ] +H]+。
Example 3: (1H-pyrrolo [2,3-c ] pyridin-5-yl) isoindol-1-one A-2
Figure BDA0004000046670000131
The synthetic route is as follows:
Figure BDA0004000046670000132
the method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol) was mixed with 2-formylbenzoic acid (18mg, 0.12mmol), formic acid (0.2 mL), triethylamine (1 mL), ethanol (1 mL) were added, and the mixture was heated to 80 ℃ and stirred for 60 minutes. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: ethyl acetate =20: 1) to give (1H-pyrrolo [2,3-c ] pyridin-5-yl) isoindol-1-one A-2 (15mg, 60%), liquid phase mass spectrum m/z =250.3[ M ] +H ] +.
Example 4: (1H-pyrrolo [2,3-c ] pyridin-5-yl) thiophene-3-carboxamide A-3-1
Figure BDA0004000046670000133
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), thiophene-2-carboxylic acid (15mg, 0.12mmol) and 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol) were mixed, N, N-diisopropylethylamine (0.2 mL), N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) to give N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) thiophene-3-carboxamide A-3-1 (10mg, 41%), liquid phase mass spectrum m/z =244.1[ M ] +H ] +.
Example 5: (E) -2-methyl-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) but-2-enamide A-3-2
Figure BDA0004000046670000134
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), and (E) -2-methyl-2-enoic acid (12mg, 0.12mmol) were mixed with 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol), N, N-diisopropylethylamine (0.2 mL), N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) to give (E) -2-methyl-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) but-2-enamide A-3-2 (11mg, 51%), liquid phase mass spectrum m/z =216.1[ M ] +H ] +.
Example 6: n- (1H-pyrrolo [2,3-c ] pyridin-5-yl) -2, 3-dihydrobenzofuran-2-carboxamide A-3
Figure BDA0004000046670000141
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), benzofuran-2-carboxylic acid (19mg, 0.12mmol) and 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol) were mixed, N, N-diisopropylethylamine (0.2 mL), N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) to give N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) -2, 3-dihydrobenzofuran-2-carboxamide A-3-3 (13mg, 46%), liquid phase mass spectrum m/z =280.1[ M ] +H ] +.
Example 7:3, 4-dichloro-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) benzamide A-3-4
Figure BDA0004000046670000142
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), 3, 4-dichlorobenzoic acid (23mg, 0.12mmol) and 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol) were mixed, N, N-diisopropylethylamine (0.2 mL), N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane =3, 7) to give 3, 4-dichloro-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) benzamide a-3-4 (13mg, 43%) liquid phase mass spectrum m/z =306.0[ m + H ] +.
Example 8: n- (1H-pyrrolo [2,3-c ] pyridin-5-yl) benzothiophene-2-carboxamide A-3-5
Figure BDA0004000046670000143
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), benzothiophene-2-carboxylic acid (21mg, 0.12mmol) and 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol) were mixed, N, N-diisopropylethylamine (0.2 mL) and N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) to give N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) benzothiophene-2-carboxamide A-3-5 (14mg, 48%), liquid phase mass spectrum m/z =294.1[ M + H ] +.
Example 9: 2-phenyl-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) acetamide A-3-6
Figure BDA0004000046670000151
The method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.1mmol), 2-phenylacetic acid (16mg, 0.12mmol) and 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethyluronium hexafluorophosphate (38mg, 0.1mmol) were mixed, N, N-diisopropylethylamine (0.2 mL), N, N-dimethylformamide (2 mL) were added, and the mixture was stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) to give 2-phenyl-N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) acetamide a-3-6 (12mg, 48%), liquid phase mass spectrum m/z =252.1[ m + H ] +.
Example 10:1- (1H-pyrrolo [2,3-c ] pyridin-5-yl) -3- (p-tolyl) urea A-4-1
Figure BDA0004000046670000152
Step 1: p-nitrophenyl p-toluidine aminocarbonate I-9-1
Figure BDA0004000046670000153
P-toluidine (21mg, 0.2mmol) and 4-nitrophenylcarbonyl chloride (48mg, 0.24mmol) were mixed, and triethanolamine (0.2 mL), methylene chloride (1 mL) and tetrahydrofuran (2 mL) were added and stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: hexane = 5.
And 2, step: 1- (1H-pyrrolo [2,3-c ] pyridin-5-yl) -3- (p-tolyl) urea A-4-1
The above-mentioned p-nitrophenyl p-toluidine carbamate I-9-1 (27mg, 0.1mmol) and 1H-pyrrolo [2,3-c ]]Pyridin-5-amine I-1 (16952 mmol, 0.12mmol) and K 2 CO 3 (0.2g，1.45 mmol), acetonitrile (3 mL) was added and heated to 40 ℃ and stirred for 4 hours. After completion of the reaction (monitored by TLC), the reaction mixture was isolated and concentrated in vacuo. The crude reaction mixture thus obtained was washed with dichloromethane, then with EtOAc and finally with MeOH (1 mL each). Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to give 1- (1H-pyrrolo [2, 3-c) in pure form]Pyridin-5-yl) -3- (p-tolyl) urea A-4-1 (22mg, 83%), liquid phase Mass Spectrometry m/z =267.1[ M ] +H ]]+。
Example 11:1- (3-bromophenyl) -3- (1H-pyrrolo [2,3-c ] pyridin-5-yl) urea A-4-2
Figure BDA0004000046670000161
Step 1: 4-Nitrophenyl (3-bromophenyl) aminocarbonate I-9-2
Figure BDA0004000046670000162
3-bromoaniline (34mg, 0.2mmol) and 4-nitrophenylcarbonyl chloride (48mg, 0.24mmol) were mixed, and triethanolamine (0.2 mL), dichloromethane (1 mL), and tetrahydrofuran (2 mL) were added and stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: hexane =5: 1) to give 4-nitrophenyl (3-bromophenyl) aminocarbonate I-9-2 (46mg, 68%), liquid phase mass spectrum m/z =338.1[ M ] +H ] +.
Step 2:1- (3-bromophenyl) -3- (1H-pyrrolo [2,3-c ] pyridin-5-yl) urea A-4-2
4-Nitrophenyl (3-bromophenyl) aminocarbonate I-9-2 (34mg, 0.1mmol) described above and 1H-pyrrolo [2,3-c ] carbonate]Pyridin-5-amine I-1 (1695 mg, 0.12mmol) and K 2 CO 3 (0.2g, 1.45mmol) and acetonitrile (3 mL) was added and the mixture was heated to 40 ℃ and stirred for 4 hours. After completion of the reaction (monitored by TLC), the reaction mixture was isolated and concentrated in vacuo. The crude reaction mixture thus obtained was washed with dichloromethane, then with EtOAc and finally with EtOAcMeOH (1 mL each) wash. Finally, the reaction product was recrystallized using EtOAc (under warm conditions) to give 1- (3-bromophenyl) -3- (1H-pyrrolo [2, 3-c) in pure form]Pyridin-5-yl) urea A-4-2 (25mg, 75%), liquid phase Mass Spectrometry m/z =331.2[ m ] +H]+。
Example 12: N-methyl-N-phenyl-1H-pyrrolo [2,3-c ] pyridine-5-carboxamide A-5
Figure BDA0004000046670000171
Synthesizing a circuit:
Figure BDA0004000046670000172
step 1: 5-Nitro-1H-pyrrolo [2,3-c ] pyridine I-10
Figure BDA0004000046670000173
H in oleum (500. Mu.L) 2 O 2 (240mg, 2.2mmol) to a solution 1H-pyrrolo [2,3-c ] was added dropwise]Pyridine-5-amine I-1 (40mg, 0.3 mmol) in concentrated sulfuric acid (100. Mu.L) was kept at 0 ℃. After stirring at 10-25 ℃ for 3h, the reaction mixture was brought to pH = 11-12 by adding 40% aqueous naoh solution at 0-5 ℃. The resulting mixture was extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium chloride solution over Na 2 SO 4 Dried and filtered. The solvent is removed by distillation under reduced pressure to obtain the desired 5-nitro-1H-pyrrolo [2,3-c]Pyridine I-10 (39mg, 80%), LC-MS m/z = 164.0M + H]+。
And 2, step: 1H-pyrrolo [2,3-c ] pyridine-5-carboxylic acid I-11
Figure BDA0004000046670000174
Reacting the above 5-nitro-1H-pyrrolo [2,3-c ]]Pyridine I-10 (39mg, 0.24mmol) and KCN (195mg, 3mmo)l) 1-butylimidazolium tetrafluoroborate (3mg, 0.014mmol), etOH (2 mL), and water (2 mL) were added to a mixture and heated to 80 ℃ with stirring for 19 hours. Then 10mL of water was added, using CH 2 Cl 2 The mixture was extracted (3X 5 mL) and diethyl ether (3X 10 mL). Acidified to pH 1-2 with hydrochloric acid and extracted with diethyl ether (3X 10 mL). Magnesium sulfate (3 g) and activated carbon (1 g) were added and stirred for 5h. The solid is filtered off, the filtrate is evaporated and the residue is crystallized from the corresponding solvent to give the desired 1H-pyrrolo [2,3-c ]]Pyridine-5-carboxylic acid I-11 (1695g, 41%), LC-MS m/z =163.0[ 2 ] M + H]+。
And step 3: N-methyl-N-phenyl-1H-pyrrolo [2,3-c ] pyridine-5-carboxamide A-5
The above 1H-pyrrolo [2,3-c ] pyridine-5-carboxylic acid I-11 (16mg, 0.1mmol) and N-methylaniline (13mg, 0.12mmol) were mixed with 2- (7-azabenzotriazole) -N, N, N ', N' -tetramethylurea hexafluorophosphate (38mg, 0.1mmol), and N, N-diisopropylethylamine (0.2 mL) and N, N-dimethylformamide (2 mL) were added and stirred at room temperature for 18 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) and the solvent was removed by distillation under the reduced pressure to give N-methyl-N-phenyl-1H-pyrrolo [2,3-c ] pyridine-5-carboxamide A-5 (18mg, 72%) and liquid phase mass spectrum m/z =252.1[ M + H ] +.
Example 13: n- (tetrahydro-2H-pyran-4-yl) -1H-pyrrolo [2,3-c ] pyridin-5-amine A-6-1
Figure BDA0004000046670000181
Reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-ylamine I-1 (13mg, 0.1mmol) and tetrahydro-4H-pyran-4-one (12mg, 0.12mmol) were mixed, methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours, followed by addition of sodium cyanoborohydride (20mg, 0.3mmol) and stirring at room temperature for 2 hours. Then, an aqueous NaOH solution (10mL, 0.3mol/L) was added to the mixture. The resulting mixture was extracted with DCM (20mL × 3). The combined organic phases were in anhydrous Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5)Distilling off the solvent to obtain N- (tetrahydro-2H-pyran-4-yl) -1H-pyrrolo [2, 3-c)]Pyridine-5-amine A-6-1 (18mg, 83%), liquid phase mass spectrum m/z =218.1[ 2 ], [ M ] +H ]]+。
Example 14: n- (pyridin-4-ylmethyl) -1H-pyrrolo [2,3-c ] pyridin-5-amine A-6-2
Figure BDA0004000046670000182
Reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-amine I-1 (13mg, 0.1mmol) and isonicotinal (13mg, 0.12mmol) were mixed, methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours, followed by addition of sodium cyanoborohydride (20mg, 0.3mmol) and stirring at room temperature for 2 hours. Then, an aqueous NaOH solution (10mL, 0.3mol/L) was added to the mixture. The resulting mixture was extracted with DCM (20mL × 3). The combined organic phases were in anhydrous Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5) and the solvent was removed by distillation under the reduced pressure to give N- (pyridin-4-ylmethyl) -1H-pyrrolo [2,3-c ]]Pyridine-5-amine A-6-2 (1695g, 71%), liquid phase mass spectrum m/z =225.1[ 2 ], [ M ] +H ]]+。
Example 15: N-cyclobutyl-1H-pyrrolo [2,3-c ] pyridin-5-amine A-6-3
Figure BDA0004000046670000191
Reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-amine I-1 (13mg, 0.1mmol) and cyclobutanone (8mg, 0.12mmol) were mixed, methanol (2 mL) was added, and the mixture was stirred at room temperature for 2 hours, followed by addition of sodium cyanoborohydride (20mg, 0.3mmol) and stirring at room temperature for 2 hours. Then, an aqueous NaOH solution (10mL, 0.3mol/L) was added to the mixture. The resulting mixture was extracted with DCM (20mL × 3). The combined organic phases were in anhydrous Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5)]Pyridine-5-amine A-6-3 (15mg, 80%), liquid phase mass spectrum m/z =188.1[ 2 ], [ M ] +H ]]+。
Example 16:2- (1H-pyrrolo [2,3-c ] pyridin-5-yl) isoindole-1, 3-dione A-7
Figure BDA0004000046670000192
The synthetic route is as follows:
Figure BDA0004000046670000193
the method comprises the following steps: reacting 1H-pyrrolo [2,3-c ]]Pyridine-5-amine I-1 (13mg, 0.1mmol) and isobenzofuran-1, 3-dione (18mg, 0.12mmol) were mixed, and N, N-dimethylacetamide (2 mL) was added thereto, and the mixture was stirred at room temperature for 24 hours, followed by addition of xylene (1 mL), and stirred in an oil bath at 140 ℃ for 48 hours. Upon completion (monitored by TLC), the insoluble catalyst was isolated by filtration, washed with acetone and dried. The organic layer was concentrated under reduced pressure to give the desired product, washed with water and recrystallized from ethanol, and the crude product was subjected to silica gel column Chromatography (CH) 2 Cl 2 N-hexane =1: 1) Purifying, and distilling under reduced pressure to remove solvent to obtain 2- (1H-pyrrolo [2, 3-c)]Pyridin-5-yl) isoindole-1, 3-dione A-7 (20mg, 76%), liquid phase Mass Spectrometry m/z =264.1[ M ] +H]+。
Example 17: N-phenyl-1H-pyrrolo [2,3-c ] pyridin-5-amine A-8
Figure BDA0004000046670000194
The synthetic route is as follows:
Figure BDA0004000046670000201
the method comprises the following steps: reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-amine I-1 (13mg, 0.1mmol) was mixed with iodobenzene (24mg, 0.12mmol), (N, N-bipyridinylimidazolidene) copper dibromide (10mg, 0.023mmol), cesium carbonate (100mg, 0.3mmol), 1, 4-dioxane (5 mL) was added, and stirred at 170 ℃ in an oil bath for 12 hours. Aqueous NaOH solution (10 mL,0.3 mol/L). The resulting mixture was extracted with DCM (20mL. Times.3). The combined organic phases were in anhydrous Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5) and the solvent was removed by distillation under the reduced pressure to give N-phenyl-1H-pyrrolo [2,3-c]Pyridine-5-amine A-8 (19mg, 91%), liquid phase mass spectrum m/z =210.1[ 2 ] M + H]+。
Example 18: (E) -5-styryl-1H-pyrrolo [2,3-c ] pyridine A-9
Figure BDA0004000046670000202
The synthetic route is as follows:
Figure BDA0004000046670000203
the method comprises the following steps: reacting 1H-pyrrolo [2,3-c ]]Pyridin-5-amine I-1 (13mg, 0.1mmol) was mixed with styrene (13mg, 0.12mmol) and bis (dibenzylideneacetone) -palladium (0) (5mg, 0.0087mmol), and nitroso-tert-butyl ester (0.5 mL), chloroacetic acid (0.5 mL) and acetic acid (3 mL) were added and stirred in an oil bath at 50 ℃ for 2 hours. Then, an aqueous NaOH solution (10mL, 0.3mol/L) was added to the mixture. The resulting mixture was extracted with DCM (20mL × 3). The combined organic phases were in anhydrous Na 2 SO 4 Dried, filtered and concentrated in vacuo. The crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5)]Pyridine A-9 (15mg, 68%), liquid phase mass spectrum m/z = 221.1M + H]+。
Example 19: n- (1H-pyrrolo [2,3-c ] pyridin-5-yl) thiophene-2-sulfonamide A-10
Figure BDA0004000046670000204
The synthetic route is as follows:
Figure BDA0004000046670000211
the method comprises the following steps: 1H-pyrrolo [2,3-c ] pyridin-5-amine I-1 (13mg, 0.12mmol) was mixed with thiophene-2-sulfonyl chloride (22mg, 0.12mmol), and triethylamine (0.5 mL), dichloromethane (3 mL) were added and stirred at room temperature for 24 hours under nitrogen. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3), and the solvent was removed by distillation under the reduced pressure to give N- (1H-pyrrolo [2,3-c ] pyridin-5-yl) thiophene-2-sulfonamide A-10 (14mg, 50%), and liquid phase mass spectrum m/z =280.0[ M + H ] +.
Example 20: n- (2- ((1H-pyrrolo [2,3-c ] pyridin-5-yl) amino) ethyl) methanesulfonamide A-11
Figure BDA0004000046670000212
The synthesis route is as follows:
Figure BDA0004000046670000213
step 1: n1- (1H-pyrrolo [2,3-c ] pyridin-5-yl) ethane-1, 2-diamine I-19
Figure BDA0004000046670000214
Reacting 1H-pyrrolo [2,3-c ]]Pyridine-5-amine I-1 (26mg, 0.2mmol) was mixed with 2-bromoethane-1-amine I-18 (29mg, 0.24mmol), water (5 mL) was added and stirred in an oil bath at 95 ℃ for 18 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The mixture is on silica gel (CH) 2 Cl 2 Methanol-ammonia) to afford the desired product. The solvent was removed by distillation under the reduced pressure to give N1- (1H-pyrrolo [2, 3-c)]Pyridin-5-yl) ethane-1, 2-diamine I-19 (24mg, 68%), liquid phase Mass Spectrometry m/z =177.1[ M ] +H]+。
Step 2: n- (2- ((1H-pyrrolo [2,3-c ] pyridin-5-yl) amino) ethyl) methanesulfonamide A-11
The above-mentioned N1- (1H-pyrrolo [2,3-c ] pyridin-5-yl) ethane-1, 2-diamine I-19 (24mg, 0.13mmol) was mixed with methanesulfonyl chloride I-20 (28mg, 0.116mmol), and dichloromethane (5 mL) was added thereto, followed by stirring in an ice-water bath for 24 hours. To the reaction mixture were added ethyl acetate and water, and the organic layer was separated, dried over sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: hexane = 3) and the solvent was removed by distillation under the reduced pressure to give N- (2- ((1H-pyrrolo [2,3-c ] pyridin-5-yl) amino) ethyl) methanesulfonamide A-11 (12mg, 36%), liquid phase mass spectrum m/z =255.1[ M ] +H ] +.
Example 21: the invention respectively adopts two compound prediction methods to predict the pyrrolopyridine derivatives, and the methods are as follows:
the method comprises the following steps: protein structure docking prediction
The pyrrolopyridine derivative molecules of examples 1-20 were molecularly docked with Oct4 target protein using AutoDock Vina and LeDock software, respectively, to produce 10 docking conformations, respectively. Calculating the binding energy and ligand efficiency of each pyrrolopyridine molecule and the optimal docking result of Oct4 target protein, and performing pyrrolopyridine molecule screening by integrating the docking results, wherein the specific docking results are shown in Table 1: the second and third columns of the table show the binding free energy (binding energy) calculated by autodock vina and Ledock molecular docking software respectively, and the more negative the value, the stronger the binding ability of the small molecule ligand to the target protein. The fourth column of the table represents the ligand efficiency (ligand efficiency) calculated by LeDock, and the larger the absolute value of the ligand efficiency, the stronger the activity of the small molecule. According to two independent algorithms of software, the binding energy level of the compound related to the invention is predicted, and the predicted value shows that the binding energy of the compound is far larger than the threshold value 3 set according to the target characteristics.
TABLE 1 binding prediction of pyrrolopyridine derivative molecules used in the present invention to a targeting sequence
Figure BDA0004000046670000221
Figure BDA0004000046670000231
The second method comprises the following steps: mir-RNA structure docking prediction:
prediction of mir-145 affinity for small molecules uses a new computational tool, RLDOCK software. RLDOCK is a model for predicting ligand-RNA binding capacity based on physical deformation. A brand-new global multi-step search algorithm for the binding sites is adopted, so that the search efficiency and stability are optimized, and the unknown binding sites can be effectively predicted by the algorithm. In RLDOCK multistep calculations, the possible binding sites on miR-145 structures and the possible binding postures of small molecules at the sites were first scanned exhaustively, all binding possibilities were scored and ranked using the minimum Lennard-Jones potential energy scoring function, and the results are shown in table 2: the score is a negative value, the greater the absolute value, the greater the ligand-RNA affinity. The final score of RLDock is a total value of different energy functions adopted by the RLDock, at present, the number of verified available RNA targets is limited, and at present, no mature calculation system exists, and the threshold value of actual interaction can be distinguished. The method ranks according to the predicted binding energy and preferentially verifies high-ranking molecules.
Table 2: binding energy prediction of pyrrolopyridine derivatives to targeted mir-RNA
Figure BDA0004000046670000232
Figure BDA0004000046670000241
Through Oct4 protein structure docking prediction and mir-145 structure docking prediction, the pyrrolopyridine derivative shows larger binding energy in two structure docking predictions, so that the pyrrolopyridine derivative is presumed to have Oct4 expression enhancement capability, and an isothermal titration calorimetry method and a cytological experiment are adopted to verify the expression enhancement effect of the pyrrolopyridine derivative on Oct4, so that the Oct4 high-selectivity activator effect of the pyrrolopyridine derivative is verified.
Example 22: verification of interaction of small molecule compound and target nucleic acid by isothermal titration quantitative calorimetry
The isothermal titration quantitative calorimetry (ITC) method utilizes a power compensation principle, can accurately obtain the enthalpy change of intermolecular interaction of a system in a wider concentration composition range through single concentration scanning, measures the heat change during binding, and provides complete thermodynamic characteristics of nucleic acid-ligand interaction. Quantification of thermodynamic characteristics and energy of the complex is a molecular basis for analyzing interaction of the micro nucleic acid miR-145 and the compound. The invention uses a Nano-ITC titration calorimeter of Watts corporation to verify nucleic acid-small molecule interactions in vitro. The experimental process is as follows: single-stranded miR-145 solution with the volume of 300 mu L and the concentration of 50 mu M is placed in a temperature-controlled sample cell and is coupled with the equal volume of deionized water in a reference cell through a thermocouple loop. Using A-3-6 small molecule as an example, a volume of 50. Mu.L of small molecule at a concentration of 500. Mu.M was placed in a syringe as a ligand. By measuring the heat change of the sample cell and by performing an equilibration calculation with the reference cell, a peak showing an endothermic or exothermic reaction is shown. The interaction mode of the two reactants is fitted by software carried by an instrument, so that the reaction bonding enthalpy (delta H), the constant pressure heat capacity (delta Cp), the number (n) of bonding sites and the bonding equilibrium constant (Ka) between two or more molecules in the solution can be directly calculated, and the kinetic data can be obtained by comprehensive calculation. The top half of FIG. 1 shows the heat change of the sample cell, where the red line is the miR-145-3-6 binding exotherm and the blue line is the miR-145-free buffer-A-3-6 binding exotherm. FIG. 1 below is a peak area fit Multiple Sites model curve where calculated nSites of 3 and 1.8 correspond to Kd (M) of 7.017E-8 and 7.544E-9, respectively, and blank group Kd (M) of 1.000E-3. The ITC test result proves that the small molecule obtained by the invention can be specifically combined with a target spot.
Example 23: verification of MET cell morphological changes caused by small molecule compounds
Human mesenchymal cells cultured at T25, as 4x10 5 Inoculating the cells, using serum-free Duchen modified eagle's Medium (DMEM-F12 Medium), which20uM of the pyrrolopyridine derivative small molecules were added to each of the cells and cultured under a temperature of 37 ℃ and 5% carbon dioxide. FIG. 2 below shows that the MET phenomenon occurs after the cells are treated with the pyrrolopyridine derivative alone for 24 hours, and the cells show a typical epithelial morphology, as compared with the control without the addition of the pyrrolopyridine derivative. This result demonstrates morphologically that pyrrolopyridine derivatives can rapidly cause transformation of mesenchymal cells into epithelial cells.
Example 24: verification of transcriptional expression differential caused by Small molecules
The aim of the present invention is to achieve the effect of MET transformation using specific compounds, an important function of such activators being the expression of enhanced MET deformation generation. According to the previous reports, when the small molecule function of the invention is verified, except that a structural protein KRT family formed by MET and a regulation gene MSX series and the like are used as detection indexes, the result shows that pyrrolopyridine and derivatives thereof can induce MET phenomenon; the increase of the expression of the downstream gene of the Oct4 gene is also an index of functional verification of the compound, and the activation function of pyrrolopyridine and derivatives thereof on Oct4 is further verified by using the expression of the Nanog reprogramming early gene.
Human mesenchymal cells were cultured at T25 according to 4X10 5 The cells were seeded and cultured in serum-free Duchen modified eagle's medium (DMEM-F12 medium) to which 50nM of the above-mentioned pyrrolopyridine derivative small molecules were added, under 37 ℃ and 5% carbon dioxide. Total RNA extraction was performed on day 3 using RNeasy Mini or Micro Kit (QIAGEN), and 1mg of RNA was used for SuperScript III First-Strand Synthesis System (Invitrogen) to synthesize cDNA. The labeling and reaction of Quantitative PCR were performed using SYBR Premix Ex Taq (TaKaRa) and Thermal Cycler Dice Real Time System (TaKaRa), and beta-Actin was used as an internal reference. All data were analyzed using delta-Ct method. Each set of experiments was performed using three replicates and variance statistics were performed. The primer sequences used to identify the genes encoding the different cellular markers are shown in table 3. The results are shown below, in FIG. 3, with and without small moleculesCompared with a control group, the expression of Oct4 and other genes of the small molecules of the pyrrolopyridine derivatives is obviously increased;
TABLE 3 Compound Effector QPCR primer sequences
Oct4-F CCATGCATTCAAACTGAGGT
Oct4-R CCTTTGTGTTCCCAATTCCTT
Nanog-F ACCTCAGCTACAAACAGGTGAA
Nanog-R AAAGGCTGGGGTAGGTAGGT
KRT8-F CAGAAGTCCTACAAGGTGTCCA
KRT8-R CTCTGGTTGACCGTAACTGCG
KRT18-F TCGCAAATACTGTGGACAATGC
KRT18-R GCAGTCGTGTGATATTGGTGT
KRT19-F ACCAAGTTTGAGACGGAACAG
KRT19-R CCCTCAGCGTACTGATTTCCT
MSX1-F AGAAGATGCGCTCGTCAAA
MSX1-R GGCTTACGGTTCGTCTTGT
βActin-F GGCCGAGGACTTTGATTGCACA
βActin-R GGGCACGAAGGCTCATCATTCAA

Claims (10)

1. An inducer of mesenchymal to epithelial cell transformation, comprising a compound of formula (I):
Figure FDA0004000046660000011
wherein:
m1 and m2 are each 0 or 1;
A 2 is C 1 -C 6 Alkylene radical, C 2 -C 6 Alkenylene, -O (CH) 2 )q-、-NR 1 -、-SO 2 -、-(CH 2 ) V NHS(O) 2 -or a bond, wherein q is 1 or 2 or 3 or 4, V is 0 or 1 or 2, R 1 Is selected from H or C 1 -C 4 An alkyl group;
A 3 is C 1 -C 6 An alkyl group; c 2 -C 6 An alkenyl group; c 4 -C 6 Cycloalkyl, wherein one carbon atom may be substituted by a N, O, S heteroatom;
Figure FDA0004000046660000012
Figure FDA0004000046660000013
z and Z 1 Are each N or CR 2 ，R 2 Selected from H, halogen, C 1 -C 4 Alkyl or cyano;
Figure FDA0004000046660000014
Z 3 is N, O, S or C = O, when Z is 4 And Z 5 When the bond between is a single bond, Z 4 Is N or CH, Z 5 Is CH 2 Or C = O, when Z 4 And Z 5 When the bond between is a double bond, Z 4 Is C, Z 5 Is CH;
or a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug thereof.
2. An induction agent according to claim 1, wherein in said compound:
A 2 is-CH 2 -、-CH＝CH-、-C(CH 3 )＝CH-、-O(CH 2 )-、-O(CH 2 ) 2 -、-NH-、-N(CH 3 )-、-SO 2 -、-NHS(O) 2 -、-(CH 2 ) 2 NHS(O) 2 -or a bond.
3. An induction agent according to claim 2, wherein in said compound:
A 3 is-CH 3 Butenyl, butenyl,
Figure FDA0004000046660000021
Figure FDA0004000046660000022
4. An induction agent according to claim 3, wherein in said compound:
m1 is 0, m2 is 1;
A 2 is-N (CH) 3 )-；
A 3 Is that
Figure FDA0004000046660000023
5. An induction agent according to claim 3, wherein in said compound:
m1 is 1, m2 is 0;
A 2 is-CH 2 -、-SO 2 -、-(CH 2 ) 2 NHS(O) 2 -or a bond;
A 3 is-CH 3 、
Figure FDA0004000046660000024
Figure FDA0004000046660000025
6. An induction agent according to claim 3, wherein in said compound:
m1 is 1, m2 is 1;
A 2 is-CH 2 -、-NH-、-C(CH 3 ) = CH-or a bond;
A 3 is-CH 3 、-C(CH 3 )＝CH-CH 3 、
Figure FDA0004000046660000031
Figure FDA0004000046660000032
7. An induction agent according to claim 3, wherein in said compound:
m1 is 0, m2 is 0;
A 2 is-CH 2 -、-CH＝CH-、-O(CH 2 )-、-O(CH 2 ) 2 -or a bond;
A 3 is that
Figure FDA0004000046660000033
8. An induction agent according to claim 1, wherein the compound is selected from the group consisting of:
Figure FDA0004000046660000041
9. a pharmaceutical composition comprising: the induction agent of any one of claims 1 to 8, or at least one of a pharmaceutically acceptable salt, solvate, active metabolite, polymorph, ester, optical isomer, prodrug thereof, or a combination of two or more thereof, and at least one pharmaceutically acceptable carrier or excipient.
10. Use of the compound of any one of claims 1 to 8 and/or pharmaceutically acceptable salts, solvates, active metabolites, polymorphs, esters, optical isomers, prodrugs, or combinations thereof for the preparation of a medicament for inducing the transformation of mesenchymal cells into epithelial cells.
CN202211614511.3A 2022-12-15 2022-12-15 Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells Pending CN115948325A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211614511.3A CN115948325A (en) 2022-12-15 2022-12-15 Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211614511.3A CN115948325A (en) 2022-12-15 2022-12-15 Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells

Publications (1)

Publication Number Publication Date
CN115948325A true CN115948325A (en) 2023-04-11

Family

ID=87288800

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211614511.3A Pending CN115948325A (en) 2022-12-15 2022-12-15 Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells

Country Status (1)

Country Link
CN (1) CN115948325A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060076186A (en) * 2004-12-29 2006-07-04 한미약품 주식회사 Quinazoline derivatives inhibiting the growth of cancer cell and preparation thereof
WO2011047300A1 (en) * 2009-10-16 2011-04-21 The Scripps Research Institute Induction of pluripotent cells
US20140154805A1 (en) * 2012-12-03 2014-06-05 City Of Hope Enhancers of induced pluripotent stem cell reprogramming

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060076186A (en) * 2004-12-29 2006-07-04 한미약품 주식회사 Quinazoline derivatives inhibiting the growth of cancer cell and preparation thereof
WO2011047300A1 (en) * 2009-10-16 2011-04-21 The Scripps Research Institute Induction of pluripotent cells
US20140154805A1 (en) * 2012-12-03 2014-06-05 City Of Hope Enhancers of induced pluripotent stem cell reprogramming

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RIKA TESHIGAWARA等: "OCT4 activity during conversion of human intermediately reprogrammed stem cells to iPSCs through mesenchymal-epithelial transition", DEVELOPMENT, vol. 143, no. 1, 1 January 2016 (2016-01-01), XP093183361, DOI: 10.1242/dev.130344 *

Similar Documents

Publication Publication Date Title
JP6898961B2 (en) Substituted diaminocarboxamide and diaminocarboxamide pyrimidines, compositions thereof, and therapeutic methods using them.
CA2761845C (en) Thiophene[3,4-c]pyrrole pde4 mediators
JP2024503755A (en) Nucleoside compounds for the treatment of viral infections and their uses
EP2648516B1 (en) Substituted pyridinone-pyridinyl compounds
EP2197438B1 (en) Heterocyclic compounds as crth2 receptor antagonists
CA2901534C (en) N-(4-(azaindazol-6-yl)-phenyl)-sulfonamides and their use as pharmaceuticals
CN111560025A (en) Polycyclic compounds and methods of use thereof
IL258779A (en) Modulators of sestrin-gator2 interaction and uses thereof
HUE029264T2 (en) Pyrazolo-triazine derivatives as selective cyclin-dependent kinase inhibitors
RU2730505C2 (en) Pyridines and use thereof in treating cancer
WO2018184585A1 (en) Compound for inhibiting ido, manufacturing method and use thereof
JP2018526416A (en) Heterocyclic limited tricyclic sulfonamides as anticancer agents
WO2019161803A1 (en) Peptidylarginine deiminase inhibitor and use thereof
JP6619796B2 (en) MIF inhibitor
TW200304817A (en) Chemical compounds
CN116462677A (en) Multi-condensed ring PRMT5 inhibitor and preparation method and application thereof
CA3115472A1 (en) Compounds and compositions for treating conditions associated with apj receptor activity
CN116283964A (en) Pyrrolopyridine derivative, and pharmaceutical composition and application thereof
CN115948325A (en) Inducer for inducing transformation and reprogramming of mesenchymal cells to epithelial cells
US7964642B2 (en) Vanilloid TRPV1 receptor antagonists
WO2024124464A1 (en) Inducer for inducing mesenchymal-epithelial transition and reprogramming
KR101362639B1 (en) Use of compounds for inducing differentiation of mesenchymal stem cells to chondrocytes
CN116621859A (en) Tri-fused ring KAT6 inhibitors
WO2024124463A1 (en) Pyrrolopyridine derivative, and pharmaceutical composition thereof and use thereof
TW201934547A (en) A pyrimidine compound and the preparation method and medical use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Wei Jun

Inventor after: Cai Meng

Inventor after: Wei Mengya

Inventor after: Mao Xiaohui

Inventor after: Chen Xiping

Inventor before: Wei Jun

Inventor before: Cai Meng

Inventor before: Song Yongkang

Inventor before: Wei Mengya

Inventor before: Mao Xiaohui

Inventor before: Deng Zhe

Inventor before: Chen Xiping