CN115927678A - LFD-MIRA primer probe combination, kit and detection method for rapidly detecting acinetobacter baumannii on site - Google Patents

Abstract

The invention provides an LFD-MIRA primer probe combination, a kit and a detection method for rapidly detecting acinetobacter baumannii on site, wherein the primer/probe combination is used for amplifying an OXA-51 gene of the acinetobacter baumannii, the nucleotide sequence of a forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of a reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3. The invention selects Acinetobacter baumannii OXA-51 gene as a specific target, and adopts an LFD-MIRA method to detect the Acinetobacter baumannii, and the method has the advantages of simple operation, simple and portable required equipment, short time consumption, easy result interpretation and the like. The detection kit has good sensitivity and specificity to clinical blood simulation samples, can effectively detect the acinetobacter baumannii, and provides an available rapid detection method for in vitro diagnosis of the acinetobacter baumannii. In addition, the detection method can also be used for quickly detecting other pathogenic microorganisms, such as other pathogenic bacteria, fungi, viruses, mycoplasma, chlamydia, rickettsia, spirochetes, parasites and the like.

Description

LFD-MIRA primer probe combination, kit and detection method for rapidly detecting acinetobacter baumannii on site

Technical Field

The invention relates to the technical field of molecular detection, in particular to an LFD-MIRA primer/probe combination, a kit and a detection method for on-site constant-temperature visual rapid detection of acinetobacter baumannii.

Background

Acinetobacter baumannii (Ab) is a non-fermented gram-negative bacterium, widely present in water, soil, hospital environment and human skin, respiratory tract, digestive tract and genitourinary tract, and is a conditional pathogen. The bacillus subtilis is widely distributed in hospital environment and has long survival time, and hospital infection of critically ill patients is easy to occur. Acinetobacter baumannii has been a difficult problem in clinical anti-infection treatment, and is easy to generate drug resistance to various disinfectants and antibacterial drugs. In recent years, the widespread spread of multiple drug-resistant acinetobacter baumannii (MDR-Ab) and pan-drug-resistant acinetobacter baumannii (XDR-Ab) is more likely to cause nightmare of doctors and patients, and therefore, the development of new rapid detection methods and the establishment of target anti-infection strategies are not slow enough.

The current gold standard for acinetobacter baumannii drug resistance diagnosis is still a culture-drug sensitivity test-based method. The method has the defects of complicated steps, long time consumption, high requirement on experimental technicians and the like, and is not beneficial to timely diagnosis and medication judgment. Acinetobacter baumannii OXA-51 gene, and for the specific detection of target genes, researches report that the target genes are used for detecting the Acinetobacter baumannii by a PCR method. Whether a microorganism tester can quickly and accurately detect acinetobacter baumannii from a blood sample is crucial to early diagnosis of diseases and proposing a target treatment plan when a patient is infected with blood stream.

The multi-enzyme isothermal nucleic acid rapid amplification technology (MIRA) is an isothermal amplification technology that has been recently developed, and relies on three core enzymes including DNA polymerase, single-stranded DNA binding protein, and recombinase to assist DNA amplification. The MIRA does not need complex warm amplification equipment, the amplification reaction time is short, and the simultaneous detection of different targets in a sample is realized by designing a primer and a probe with a modifying group and combining a sandwich method nucleic acid detection test strip. Therefore, by the technology, the targets of various pathogens in the blood sample can be detected simultaneously, and the etiology evidence can be provided timely and effectively.

Most of blood stream infection detection kits produced in the market at present can be used for identifying blood culture pathogens. The method is mainly based on multiple real-time PCR, realizes identification of various target regions by taking different primers in the PCR amplification process and different melting temperatures in different target reaction processes as judgment bases for species identification, and can report within 1 hour. However, the identification of the method relies on temperature changes, so that the temperature sensitivity of the equipment is very high; in addition, only 1 sample can be detected at one time, and the flux is low; species discrimination relies on temperature changes, and thus the scalability of species identification is low. In addition, a part of blood stream infection pathogen detection kits are based on a multiplex PCR and liquid phase capture method to realize the detection of specific pathogens, and the method is limited by the fluorescence detection resolution and has low detection sensitivity. Therefore, establishing a more effective method for realizing the constant-temperature nucleic acid amplification visual detection becomes a problem to be solved urgently. In view of the above, the present invention is particularly proposed.

Disclosure of Invention

In view of the above, in order to overcome the defects of the prior art, the invention provides an LFD-MIRA primer/probe combination for on-site constant-temperature visual rapid detection of acinetobacter baumannii.

The primer/probe combination is used for amplifying Acinetobacter baumannii OXA-51 genes, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3.

1 in SEQ ID NO is LFD-aba-F TGCTTAATGCTTTGATCGGCCTTGAGCACC;

2 is LFD-aba-R [ biotin ] TACCGATATCTGCATTGCCATAACCAACAC;

SEQ ID NO 3 is

nfo-aba:[FAM]CGATGCTATGAAAGCTTCCGCTATTCCGGT[THF]TATCA

AGATTTAGCT[C3spacer]。

The invention also provides an LFD-MIRA detection kit for detecting acinetobacter baumannii infection, which comprises a dissolving buffer solution, freeze-dried enzyme powder, a magnesium acetate solution, a buffer, a lateral flow test strip and the amplification primer/probe combination of claim 1; the dissolving buffer comprises 30-50mM Tris buffer and 50-150mM potassium acetate; the freeze-dried enzyme powder comprises 100-500 ng/mu L of recombinase, 100-400 ng/mu L of recombinase cofactor, 400-900 ng/mu L of single-stranded DNA binding protein, 50-200 ng/mu L of DNA polymerase, 50-100 ng/mu L of reverse transcriptase, 1-3mM ATP, 30-100mM creatine phosphate, 200-300 ng/mu L of creatine kinase, 200-500 mu M dNTPs, 5-10% w/v polyethylene glycol 20000 and 1-5mM dithiothreitol.

The invention also provides a method for rapidly detecting the acinetobacter baumannii in blood, which comprises the following steps:

1) Extracting total DNA of a bacterial blood sample to be detected;

2) Carrying out MIRA amplification on the bacteria to be detected by taking the extracted total DNA as a template;

3) Performing visual detection on an MIRA amplification result by adopting a lateral flow test strip (LFD);

4) And (4) analyzing the detection result by observing the condition of the purple red strip appearing on the lateral flow test strip by naked eyes.

The step 1) adopts a DNA extraction kit to extract the total DNA of the bacterial blood sample to be detected;

the step 2) is that the extracted genome DNA is taken as a template, a primer, a probe, a dissolving buffer solution and sterile double distilled water are added and mixed uniformly, then the mixture is added into MIRA freeze-dried enzyme powder, then a magnesium acetate solution is added, the mixture is inverted and mixed uniformly, and then the mixture is added into an EP tube for reaction, the EP tube is placed in a constant-temperature heating module, the amplification temperature is 40 ℃, and the amplification time is 10min;

after the reaction in the step 3) and the step 2) is finished, sucking 10 mu L of amplification product, uniformly mixing with 190 mu L of buffer, adding into a sealed HybriDetect nucleic acid colloidal gold test strip detection tank, and standing at room temperature for 5min to observe the result;

and 4) analyzing the detection result by observing the condition that the lateral flow test strip has a purple red strip by naked eyes: the test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains pathogenic bacteria to be detected; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain pathogenic bacteria to be detected.

The MIRA amplification reaction system in the step 2) comprises: 29.5. Mu.L of dissolution buffer, 2.1. Mu.L of each of 10. Mu.M upstream and downstream primers, 0.6. Mu.L of 10. Mu.M probe, 2.0. Mu.L of template DNA to be tested, 11.2. Mu.L of sterile double distilled water, 50mg of MIRA lyophilized enzyme powder, and 2.5. Mu.L of 280mM magnesium acetate.

The method of the invention is also suitable for the rapid detection of other pathogenic microorganisms in blood, such as other pathogenic bacteria, fungi, viruses, mycoplasma, chlamydia, rickettsia, spirochetes, parasites and the like.

The present invention selects gDNA of 7 kinds of specified non-detection bacteria (Escherichia coli, enterobacter cloacae, klebsiella pneumoniae, klebsiella oxytoca, stenotrophomonas maltophilia, burkholderia cepacia, pseudomonas aeruginosa) as template to carry out LFD-MIRA reaction. The detection results of the 7 non-detection bacteria are negative and do not have cross reaction with the detection bacteria.

In order to verify the practicability of the LFD-MIRA detection method for the pathogenic bacteria infected by the blood stream, the bacteria to be detected are mixed into human blood, and the simulated clinical sample is detected by the LFD-MIRA and mass spectrum identification method. The ability of the LFD-MIRA detection method to detect Acinetobacter baumannii in the blood simulation sample is completely consistent with the positive result of mass spectrum identification. The Acinetobacter baumannii detected by the LFD-MIRA detection method in a blood simulation sample is 6CFU/mL, and the sensitivity of a positive detection result is better than that of fluorescent quantitative PCR (polymerase chain reaction) by 60CFU/mL.

The isothermal amplification integrated detection system provided by the invention integrates a multienzyme isothermal nucleic acid rapid amplification technology (MIRA) and lateral flow test strip (LFD) detection, and is beneficial to avoiding aerosol pollution. The LFD-MIRA visual detection system has the advantages of short time consumption, high sensitivity and strong specificity, and is suitable for on-site rapid screening of pathogenic microorganisms.

The invention is particularly suitable for on-site rapid screening of pathogenic microorganisms, can provide diagnosis and treatment basis at the first time, improves the treatment rate of infection, and reduces the morbidity and mortality of severe infection and secondary severe infection. The primer probe group and the detection method for detecting the acinetobacter baumannii by the LFD-MIRA provided by the invention can realize the rapid and accurate identification of the acinetobacter baumannii in blood, have the advantages of simple operation, short detection time, high sensitivity, strong specificity and the like, are particularly suitable for basic level and field detection, and have wide application prospects.

Compared with the prior art, the invention has the beneficial effects that:

1. according to the invention, through the optimized specific detection primer, probe and constant-temperature amplification integrated detection method, the rapid detection of the acinetobacter baumannii infected by blood flow is realized, the identification of the blood flow infection caused by the acinetobacter baumannii can be completed in the first time, the targeted treatment scheme of blood flow infectious diseases can be facilitated to be formulated, the treatment rate of the blood flow infection is improved, the morbidity and mortality of severe infection and secondary severe infection are reduced, and the treatment level is improved.

2. By comparing and analyzing the specificity of the Acinetobacter baumannii OXA-51 gene, an optimal group of primer/probe combinations is preferably selected for subsequent LFD-MIRA detection.

3. By optimizing LFD-MIRA reaction conditions of acinetobacter baumannii causing blood stream infection, different reaction time and temperature are compared to monitor the amplification kinetics, and the sensitivity and specificity of the acinetobacter baumannii identification are improved.

4. By analyzing the specificity of the detection method, a constant-temperature amplification integrated system for high-specificity detection of acinetobacter baumannii is obtained, has better practical value, and lays a solid foundation for subsequent clinical verification and analysis.

5. Provides a research on the clinical application of the detection kit and the method, and provides a solid theoretical basis for the rapid diagnosis of the bloodstream infectious diseases.

Description of the drawings:

FIG. 1 is a diagram showing the alignment results of the target gene sequences of the present invention;

FIG. 2 is a diagram showing the results of screening a primer set by the electrophoresis method of the present invention;

Lanes 1-16 are the results of electrophoresis of primers F1/R1,F1/R2,F1/R3,F1/R4,F2/R1,F2/R2,F2/R3, F2/R4,F3/R1,F3/R2,F3/R3,F3/R4,F4/R1,F4/R2,F4/R3,F4/R4.M:DNA marker.

FIG. 3 is a graph showing the results of detecting the optimal reaction temperature of Acinetobacter baumannii according to the present invention;

FIG. 4 is a graph showing the results of the optimal reaction time for detecting Acinetobacter baumannii according to the present invention;

FIG. 5 shows the result of the specificity test of the method of the present invention;

FIG. 6 shows the results of the sensitivity test of the method of the present invention.

Detailed Description

Example 1: LFD-MIRA primer screening

According to the invention, the Acinetobacter baumannii OXA51 gene is selected for designing the primer according to the literature report. Designing 30-35bp primers according to different lengths to prevent false positive, avoiding the influence of a hairpin structure and primer dimer, wherein the amplification speed and the detection sensitivity are influenced by overlong or overlong primer sequences, and the primer sequences require that: 1. the base arrangement randomness is high, and the GC content is between 30 and 70 percent; 2, amplifying the fragment to avoid forming a secondary structure to influence amplification; 3. the length of the amplified fragment is recommended to be 150-300bp, and usually not more than 500 bp. In order to screen out the optimal primers, multi-interval design is carried out, and 16 pairs of specific primers are designed for screening the optimal primers. 16 pairs of primer sets used 1.0X 10 ³ Carrying out MIRA agarose gel electrophoresis by using CFU/mL acinetobacter baumannii standard strain ATCC19606 DNA as a template, evaluating a designed primer pair, and screening out a primer combination with the highest amplification efficiency and the most single amplification product for subsequent LFD-MIRA detection. The primer combination which meets the requirements of each bacterium is finally determined through the screening of the round.

The target gene sequence alignment results are shown in FIG. 1.

TABLE 1 candidate primer sequences

The results of screening the primer set by electrophoresis are shown in FIG. 2.

Example 2 LFD-MIRA Probe design

After determining the primers, respectively designing the probes of each bacterium according to the LFD-MIRA probe design principle, wherein the design principle is as follows: designing a sequence with the length of 46-52nt complementary with the target segment as a probe in the middle of the upstream and downstream primers; the probe sequence does not overlap with the recognition site of the specific primer, has the length of 46-52nt, and avoids palindromic sequence, internal secondary structure and continuous repeated bases. The probe has three modification sites: 1.5' end is modified with an antigen marker (FAM); 2. a dSpacer (tetrahydrofuran, THF) is marked at the sequence position which is about 30nt away from the 5' end and serves as a recognition site of nfo; THF was about 15nt from the 3 'terminus, and the 3' terminus was labeled with a modifying group (C3-spacer). The position of the probe is determined according to the design requirements, 1 probe sequence is preferentially designed, and finally, the primer and the probe sequence for LFD-MIRA are determined.

nfo-Aba:[FAM]CCGGTAACCAGCTCAGCCACATGTCGCCGATC[THF]ACACCATCGAGATG G[C3spacer]；

TABLE 2 Final determination of primer and Probe sequences for LFD-MIRA and Real-time PCR

Example 3 optimum temperature for LFD-MIRA detection method

In order to find the optimal amplification temperature, the LFD-MIRA detection method used 2ng of Acinetobacter baumannii standard strain ATCC19606 genomic DNA (gDNA) at 20 ℃,25 ℃,30 ℃,35 ℃,40 ℃,45 ℃ and 50 ℃ for 10 minutes. This experiment was repeated twice. The detection line on the test strip was found to be observable over a wide temperature range. The best effect is achieved between 35 ℃ and 45 ℃. Therefore, the detection method is suitable for general ambient temperature, and can be carried out in a resource-poor environment. (see FIG. 3)

Example 4 optimal reaction time for LFD-MIRA detection method

The LFD-MIRA detection method was performed for different reaction times to monitor the kinetics of amplification. The reaction system was incubated 0,5, 10, 15, 20, 25, 30 and 35min at 40 ℃ and the reaction was terminated by placing the reaction tubes on ice for the corresponding time. The product was diluted in PBS and the results read as described above. As a result, as shown in fig. 2, the test strip can be observed in as little as 5 minutes. The test line became clearer as the time was extended to 10 minutes or more. In view of detection efficiency and sensitivity, an amplification time of 10 minutes is suitable for LFD-MIRA assay. Thus, the entire assay, including LFD-MIRA amplification and strip reading, requires only 15 minutes or less. (see FIG. 4)

Example 5 specificity of LFD-MIRA detection method

In the specificity experiment, the sample is selected from clinically common pathogenic bacteria, mainly including Escherichia coli, enterobacter cloacae, klebsiella pneumoniae, klebsiella oxytoca, stenotrophomonas maltophilia, burkholderia cepacia and Pseudomonas aeruginosa. gDNA of 7 specified non-detection bacteria was selected as a template for LFD-MIRA reaction. The detection results of the 7 non-detection bacteria are negative and do not have cross reaction with the detection bacteria.

Specific assay results (see FIG. 5)

Example 6 sensitivity of LFD-MIRA detection method

First, 6X 10 of ⁵ And (3) extracting the total DNA of the bacterial blood sample to be detected by adopting a DNA extraction kit, carrying out MIRA amplification by taking the total DNA as a template, and finally carrying out visual detection on the amplification result by adopting a lateral flow test strip method. The result shows that the limit of detection of the visualized detection method on the acinetobacter baumannii in blood is 6CFU/mL, and the sensitivity of the LFD-MIRA is superior to that of a Real-time quantitative PCR (Real-time PCR) detection method by 60CFU/mL.

Sensitivity test results (see FIG. 6)

Example 7: the invention relates to an LFD-MIRA detection kit for detecting acinetobacter baumannii infection

The kit comprises a nucleic acid extraction reagent, a dissolving buffer solution, freeze-dried enzyme powder, a magnesium acetate solution, a buffer, a lateral flow test strip and an amplification primer/probe combination (the nucleotide sequence of a forward primer is shown as SEQ ID NO:1, the nucleotide sequence of a reverse primer is shown as SEQ ID NO:2, and the nucleotide sequence of a probe is shown as SEQ ID NO: 3.)

The lysis buffer comprised 50mM Tris buffer and 150mM potassium acetate.

The lyophilized enzyme powder comprises 500 ng/. Mu.L of recombinase, 400 ng/. Mu.L of recombinase cofactor, 900 ng/. Mu.L of single-stranded DNA binding protein, 200 ng/. Mu.L of DNA polymerase, 100 ng/. Mu.L of reverse transcriptase, 3mM ATP, 100mM creatine phosphate, 300 ng/. Mu.L of creatine kinase, 500. Mu.M dNTPs, 10% w/v polyethylene glycol 20000, and 5mM dithiothreitol.

Example 8: the invention provides a rapid detection method for acinetobacter baumannii infection in blood

The method comprises the following steps:

1) Extracting total DNA of a blood sample containing acinetobacter baumannii by using a nucleic acid extraction kit;

2) Performing MIRA amplification of Acinetobacter baumannii by taking the extracted total DNA as a template;

3) Performing visual detection on the MIRA amplification result by adopting a lateral flow test strip (LFD);

4) And (4) analyzing the detection result by observing the condition of the purple red strip appearing on the lateral flow test strip by naked eyes.

The method comprises the following steps of 1) preparing 6CFU/mL blood sample containing acinetobacter baumannii, and extracting total DNA in the sample by adopting a DNA extraction kit;

the step 2) is to take the extracted genome DNA as a template, add a primer, a probe, a dissolving buffer solution and sterile double distilled water, fully mix the mixture, add the mixture into MIRA freeze-dried enzyme powder, then add a magnesium acetate solution, invert the mixture, mix the mixture evenly, add the mixture into an EP tube for reaction, place the EP tube in a constant-temperature heating module, and amplify the mixture at 40 ℃ for 10min;

wherein the MIRA amplification reaction system comprises: 29.5 mul of dissolving buffer, 2.1 mul of each of 10 mul of upstream and downstream primers, 0.6 mul of 10 mul of probe, 2.0 mul of template DNA to be detected, 11.2 mul of sterile double distilled water, 50mg of MIRA freeze-dried enzyme powder and 2.5 mul of 280mM magnesium acetate.

After the reaction in the step 3) and the step 2) is finished, sucking 10 microliter of amplification product, uniformly mixing with 190 microliter of buffer, adding into a sealed HybriDetect nucleic acid colloidal gold test strip detection tank, and standing at room temperature for 5min to observe the result;

and 4) analyzing the detection result by observing the condition that the lateral flow test strip has a purple red strip by naked eyes: and if the test strip has two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains pathogenic bacteria to be detected. (shown in FIGS. 5 and 6)

Example 9 verification of the practicability of the method for LFD-MIRA detection of pathogenic bacteria of bloodstream infection

In order to verify the practicability of the method for detecting the pathogenic bacteria LFD-MIRA of the bloodstream infection, the bacteria to be detected are doped into the human blood, and the simulated clinical samples are detected by an LFD-MIRA and mass spectrum identification method. The ability of the LFD-MIRA detection method to detect Acinetobacter baumannii in the blood simulation sample is completely consistent with the positive result of mass spectrum identification.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Claims (8)

1. An LFD-MIRA primer/probe combination for rapidly detecting acinetobacter baumannii on site is characterized in that: the primer/probe combination is used for amplifying Acinetobacter baumannii OXA-51 genes, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3.

2. The LFD-MIRA primer/probe combination of claim 1, characterized in that the primer is 30-35bp in length and the primer sequence requires: A. the base arrangement randomness is high, and the GC content is between 30 and 70 percent; B. the amplified fragment avoids forming a secondary structure to influence amplification; C. the length of the amplified fragment is 150-300bp.

3. The LFD-MIRA primer/probe combination of claim 1, wherein the designed primer pair is evaluated by MIRA agarose gel electrophoresis to screen out the primer set with the highest amplification efficiency and the most unique amplification product.

4. The LFD-MIRA primer/probe combination of claim 1, wherein a sequence with a length of 46-52nt complementary to the target fragment is designed as the probe between the upstream primer and the downstream primer; the probe sequence does not overlap with the recognition site of the specific primer, has the length of 46-52nt, and avoids palindromic sequence, internal secondary structure and continuous repeated bases. The probe has three modification sites: 1.5' end is modified with an antigen marker (FAM); 2. a dSpacer (tetrahydrofuran, THF) is marked at the sequence position which is about 30nt away from the 5' end and serves as a recognition site of nfo; THF was about 15nt from the 3 'terminus, and the 3' terminus was labeled with a modifying group (C3-spacer).

5. An LFD-MIRA detection kit for detecting Acinetobacter baumannii infection, which is characterized by comprising a nucleic acid extraction reagent, a dissolving buffer solution, freeze-dried enzyme powder, a magnesium acetate solution, a buffer, a lateral flow test strip and an amplification primer/probe combination according to claim 1; the dissolving buffer comprises 30-50mM Tris buffer and 50-150mM potassium acetate; the freeze-dried enzyme powder comprises 100-500 ng/mu L of recombinase, 100-400 ng/mu L of recombinase cofactor, 400-900 ng/mu L of single-stranded DNA binding protein, 50-200 ng/mu L of DNA polymerase, 50-100 ng/mu L of reverse transcriptase, 1-3mM ATP, 30-100mM creatine phosphate, 200-300 ng/mu L creatine kinase, 200-500 mu M dNTPs, 5-10% w/v polyethylene glycol 20000 and 1-5mM dithiothreitol.

6. A method for rapid detection of acinetobacter baumannii in blood, comprising:

1) Extracting the total DNA of the blood sample to be detected by using a nucleic acid extraction kit;

2) Carrying out MIRA amplification on the bacteria to be detected by using the extracted total DNA as a template;

3) Performing visual detection on the MIRA amplification result by adopting a lateral flow test strip (LFD);

4) And (4) analyzing the detection result by observing the condition of the purple red strip appearing on the lateral flow test strip by naked eyes.

The step 1) adopts a DNA extraction kit to extract total DNA in a sample;

the step 2) is to take the extracted genome DNA as a template, add primers, probes, a dissolving buffer solution and sterile double distilled water, fully mix the mixture, add the mixture into MIRA freeze-dried enzyme powder, then add a magnesium acetate solution, invert the mixture and mix the mixture evenly, add the mixture into a constant-temperature amplification integrated detection device for reaction, place the device in a constant-temperature heating module, amplify the temperature at 40 ℃ for 10min;

after the reaction in the step 3) and the step 2) is finished, forcibly pressing a sealing film of the detection device to uniformly mix and immerse the amplification product and the buffer in a certain ratio, standing at room temperature for 5min, and observing the result;

and 4) analyzing the detection result by observing the condition that the lateral flow test strip has a purple red strip through naked eyes: the test strip shows two purple red strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the sample contains pathogenic bacteria to be detected; when only the quality control area of the test strip has a mauve strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain the pathogenic bacteria to be detected.

7. The method for rapid detection of acinetobacter baumannii infection in blood according to claim 6, wherein the MIRA amplification reaction system of step 2) comprises: 29.5 mul of lysis buffer, 2.1 mul of each of 10 mul of upstream and downstream primers, 0.6 mul of 10 mul of probe, 2.0 mul of template DNA to be tested, 11.2 mul of sterile double distilled water, 50mg of MIRA lyophilized enzyme powder, and 2.5 mul of 280mM magnesium acetate.

8. The method for rapidly detecting acinetobacter baumannii in blood according to claim 6, wherein the method can also be used for rapidly detecting other pathogenic microorganisms, such as other pathogenic bacteria, fungi, viruses, mycoplasma, chlamydia, rickettsia, spirochete, parasites and the like.

Images