CN115927462A - Screening method and application of tumor specific TCR - Google Patents

Abstract

The invention discloses a screening method of tumor specific TCR and application thereof, wherein the screening method comprises the following steps: isolating TILs from the tumor tissue; knocking off a target gene in a TILs genome and inserting a reporter gene to obtain modified TILs; co-culturing the modified TILs with tumor tissue cells to activate the modified TILs; screening the activated TILs to select the TILs with high expression in the reporter gene; and (3) performing monoclonal culture on the TILs with high expression in the selected reporter gene to obtain the tumor specific TCR monoclonal cells. The invention combines a gene knock-in system with TCR screening, utilizes the gene knock-in system to accurately insert a reporter gene into the downstream of a promoter of IL-2 of TILs, and after being stimulated by tumor cells, the IL-2 releases the highly expressed reporter gene, thereby rapidly and accurately separating the TCR monoclonal cells with tumor specificity.

Description

Screening method and application of tumor specific TCR

Technical Field

The invention relates to the technical field of tumor immunity, in particular to a screening method and application of tumor specific TCR (T cell receptor).

Background

At present, most tumors, especially advanced tumors, still cannot be cured. The recent reports focusing on immunotherapy to re-enhance the patient's own immune system have brought new hopes to cancer patients, especially with regard to treatment of leukemia, lymphoma and advanced melanoma, among others. One of the most effective treatment strategies in tumor immunotherapy is adoptive T cell therapy. Adoptive T cell therapies fall into three categories: tumor Infiltrating Lymphocytes (TILs), chimeric antigen receptor expressing T cells (CAR-T), and engineered T cell receptor expressing T cells (TCR-T). Adoptive T cell therapy is usually achieved by isolating the patient's own T cells, followed by activation or by engineering and expansion of the T cells by gene editing techniques, and finally re-injection into the patient. While CAR-T cells target surface tumor antigens, TCR-T cells can also target intracellular proteins through Human Leukocyte Antigen (HLA) presentation, meaning that TCR-T cells can recognize a wide range of tumor antigens not limited to membrane expression, including unknown neoantigens.

T cells recognize the corresponding antigen through their cell surface T Cell Receptors (TCRs), a receptor molecule on the surface of T cells that specifically recognizes the antigenic peptide-MHC complex on antigen presenting cells, and thereby activates the T cell immune response. TCR has relatively low binding affinity to antigenic peptides and is degenerate: that is, many TCRs recognize the same antigenic peptide, and many antigenic peptides are recognized by the same TCR. In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which leads to a series of subsequent cell signaling and other physiological responses, thereby allowing T cells of different antigen specificities to exert an immune effect on their target cells. The TCR consists of two distinct peptide chains, in humans, in 95% of T cells the TCR consists of an alpha chain and a beta chain (encoded by TRA and TRB, respectively), whereas in 5% of T cells the TCR consists of gamma and delta (γ/δ) chains (encoded by TRG and TRD, respectively). Since most TCRs on the surface of T cells cannot recognize tumor cells, T cells cannot effectively kill tumor cells, resulting in rapid expansion of tumor cells. However, if a T cell capable of specifically recognizing a tumor cell antigen is found, a corresponding TCR gene is cloned and obtained, and the TCR is introduced into the T cell through a carrier means or gene editing, a T cell receptor gene modified T Cell (TCRT) is generated, after the TCR specific to the tumor antigen is transferred into a common T cell, the T cell can be endowed with the capacity of recognizing the tumor antigen, the TCR-T has the capacity of specifically recognizing and killing the tumor cell, and can exert the anti-tumor efficacy after being activated and proliferated in vitro and then input into a patient body, and the effective anti-tumor activity is shown in various cancers, so that the screening of the TCR specific to the tumor is the key to the success of TCR-T treatment, and the screening of the TCR specific to the research hotspot in the tumor immunotherapy or prevention.

T cells can express different markers and cytokines, especially IL-2 and IFN-gamma after being activated by tumor antigens, the degree of T cell activation is determined by judging the secretion amount of IL-2 and IFN-gamma, but the secretion of the cytokines cannot easily distinguish which cells are in an activated state, so that the screening of the specifically activated T cells can be achieved by replacing IL-2 genes with exogenous reporter genes (such as GFP) so as to obtain the tumor-specific TCR.

The gene site-specific insertion is an important means for researching gene function, and the method is widely applied to the fields of research on animal and plant functional genes, treatment and research on human diseases, transgenic animal and plant production and the like at present. Gene site-specific knock-in is mainly based on gene shearing and gene repair, the traditional gene shearing is in a gene targeting mode, but the gene targeting efficiency is very low and is only 10 ^-6 Therefore, the application of the method is naturally restricted, but the artificial nucleases (ZFN, TALEN and CRISPR/Cas 9) greatly improve the shearing efficiency and accuracy. DNA repair mechanisms with non-homologyBoth end-joining (NHEJ) and homologous recombination (HDR) are the predominant repair modalities for NHEJ in animal cells, while site-specific gene knockin is primarily based on HDR repair mechanisms.

At present, the latest generation of nucleases is derived from the CRISPR-CAS system consisting of Streptococcus pyogenes with a cluster of regularly spaced short palindromic repeats (CRISPRs) and some function-associated proteins (CRISPR-associated, cas). The structure of the gene consists of three parts, wherein the 5 'end is a tracrRNA gene, the middle is a series of Cas protein coding genes, including Cas9, cas1, cas2 and Csn2, the 3' end is a CRISPR locus, and the gene consists of a promoter region, a plurality of spacers and repetitive sequences which are arranged in sequence. Because the CRISPR/Cas9 system has targeted cleavage properties on DNA molecules, it can be used for targeted gene modification. The CRISPR/Cas9 can be operated, has low cost and high effectiveness, and can be quickly used for cell gene operation of human, mice, zebra fish, flies and the like, so that the production of transgenic animals becomes more convenient and feasible, and certain research progress is achieved.

Disclosure of Invention

Based on the above problems, the present invention provides a method for screening tumor-specific TCR based on CRISPR/Cas9 knock-in integration of exogenous genes, which is accurate, efficient and low in cost.

The technical scheme of the invention is as follows:

a method of screening for tumor specific TCRs comprising the steps of:

obtaining tumor tissues and separating out corresponding TILs in the tumor tissues;

knocking off a target gene IL-2 in the TILs genome, and inserting a reporter gene into the downstream of a promoter of the IL-2 to obtain modified TILs;

co-culturing the modified TILs with tumor tissue cells to activate the modified TILs;

screening the activated TILs to select the activated TILs with high expression in the reporter gene;

and (3) performing monoclonal culture on the activated TILs with high expression in the selected reporter gene to obtain the tumor specific TCR monoclonal cells.

In one embodiment, before the step of separating the TILs, the screening method further includes the steps of:

plasmids expressing gRNA and Cas9 proteins were constructed.

In one embodiment, in the screening method, the step of knocking off the target gene IL-2 in the TILs genome is implemented by the following processing steps:

transferring plasmids of gRNA and Cas9 protein into separated TILs through a delivery system;

the gRNA knocks off the target gene IL-2 with the Cas9 protein, and the reporter gene is transduced by AAV and inserted into the promoter downstream of the IL-2.

In one embodiment, the screening method further comprises the following steps in the plasmid delivery TIL step:

determining a gRNA region, and selecting a gRNA gene sequence with the lowest off-target rate;

gRNA expression vectors were designed, synthesized and constructed.

In one embodiment, in the screening method, two genes of the gRNA, namely the gene targeting IL-2, are sgRNA1 and sgRNA2, respectively, and the gene nucleic acid sequence of the sgRNA1 is ACAACTGGAGCATTTACTGC, and the gene nucleic acid sequence of the sgRNA2 is aaacttaaatgtgtgaggcatcc.

In one embodiment, the gRNA and Cas9 proteins are located in the same plasmid in the screening method.

In one embodiment, in the screening method, the delivery system is one or more of lentivirus, retrovirus, adenovirus, plasmid vector, episome vector, nano delivery system and electrical transduction. In one embodiment, in the screening method, the reporter gene is one or more of EGFP, RFP, mCherry and tdTomato.

In one embodiment, in the screening method, the step of activating the modified TILs further includes the following steps:

and co-culturing the modified TILs and tumor tissue cells in an X-VIVO15 serum-free culture medium for 48h to activate the modified TILs.

In one embodiment, the screening method further includes the following steps of culturing activated TILs monoclonal antibodies highly expressed in the selected reporter gene:

placing the activated TILs with high expression in the selected reporter gene in an X-VIVO15 serum-free culture medium for monoclonal culture for two weeks;

adding magnetic beads containing 5% human AB serum, 2000IU/mL IL-2 and CD3/CD28 antibodies into the monoclonal culture system to obtain proliferated TILs;

extracting total RNA in the amplified TILs, carrying out reverse transcription, cloning by using PCR, and sequencing to obtain the tumor specific TCR.

The invention combines a gene knock-in system with TCR screening, utilizes the gene knock-in system to accurately insert a reporter gene into the downstream of an IL-2 gene promoter of TILs, and after being stimulated by tumor cells, secretory IL-2 is released and converted into a high-expression reporter gene, thereby quickly and accurately separating the TILs with tumor specific TCR.

The method can be used for quickly and accurately obtaining the TCR with the tumor specificity and is applied to tumor immunotherapy medicaments.

Drawings

FIG. 1 is a schematic diagram of a tumor specific TCR screening process of the invention;

FIG. 2 is a plasmid map of pCas9-sgRNA 2;

FIG. 3 is a construction map of pAAV-HDR plasmid;

FIG. 4 is a graph showing IL-2 expression after co-culture of tumor TILs and tumor tissue cells;

FIG. 5 is a flow chart of EGFP expression after co-culture of TILs with tumor tissue cells after knocking-in of EGFP gene;

FIG. 6 is a graph of IL-2 expression following co-culture of TCR-T and tumor tissue cells.

Detailed Description

The preferred embodiments of the present invention will be described in further detail with reference to the accompanying drawings.

According to the TCR screening integrated by knocking in the exogenous gene based on CRISPR/Cas9, a T cell activation marker gene IL-2 is taken as a target gene, a CRISPR/Cas9 gene knocking-in system is utilized, and a reporter gene is inserted into the downstream of a promoter of the target gene IL-2; if T cells are activated, the reporter gene is transcribed and expressed, then cells with high expression of the reporter gene, namely activated TILs (tumor infiltrating lymphocytes) with high expression are screened, CD3/CD28 antibodies are added to make the activated TILs undergo the process of monoclonal proliferation culture, and finally TCR sequencing is carried out, so as to obtain the TCR with tumor specificity.

Specifically, as shown in fig. 1, the present invention provides a method for screening tumor-specific TCR, which comprises the following steps:

s1, constructing a plasmid for expressing gRNA and Cas9 protein;

s2, obtaining a tumor tissue, and separating out corresponding TILs in the tumor tissue;

s3, transferring plasmids expressed by gRNA and Cas9 proteins into the separated TILs through a delivery system to break a target gene IL-2 in a TILs genome;

s4, the reporter gene is transduced through AAV and inserted into the downstream of a promoter of the TILs so as to achieve the aim of accurate gene knock-in and obtain modified TILs;

s5, co-culturing tumor tissue cells and the TILs subjected to gene knock-in modification so as to activate the TILs subjected to modification;

s6, selecting high-expression TILs in the reporter gene by flow screening of the activated TILs;

and S7, performing monoclonal culture on the high-expression TILs in the selected reporter gene to obtain the tumor specific TCR monoclonal cells.

In one embodiment, the gRNA and Cas9 proteins are located in the same plasmid vector.

In one embodiment, the delivery system comprises one or more of a lentivirus, retrovirus, adenovirus, general plasmid vector, episomal vector, nano-delivery system, electroporation, and transposon.

In one embodiment, the reporter gene is selected from one or more of fluorescent protein reporter genes EGFP, RFP, mCherry and tdTomato; the preferred reporter gene is EGFP.

The tumor specific TCR screened by the invention can be transferred into T cells by a delivery system to prepare TCR-T and is applied to tumor treatment medicines.

The following examples serve to illustrate the invention in further detail.

In the examples described below, the reporter gene is EGFP.

IL-2 detection kits were purchased from Thermo fisher; the TILs of gastric cancer patients are separated and constructed by the laboratory. Targeting IL-2 gene (Genbank accession No. NC — 000004.12) reporter gene (EGFP) was inserted downstream of IL-2 gene promoter by CRISPR/CAS9 and gene homologous recombination mechanism.

Example 1 construction of Gene knock-in System

Determining a gRNA region, selecting a group of gRNA sequences with the lowest off-target rate aiming at an IL-2 gene fragment, designing, synthesizing and constructing a gRNA expression vector, wherein the number of gRNA recognition sites is two, the two gRNA recognition sites are respectively positioned in an exon 1 and an exon 2 of an IL-2 gene, and the corresponding genes are sgRNA1 and sgRNA1 respectively. The gene sequences of two target sites of gRNA on IL-2 are as follows:

IL-2sgRNA1；ACAACTGGAGCATTTACTGC；

IL-2sgRNA2：AAACTTAAATGTGAGCATCC。

FIG. 2 is a plasmid map containing pCas9-sgRNA 2; wherein, the AmpR is an ampicillin resistance gene, and is required for plasmid extraction and amplification; the U6 promoter is a U6 promoter, and the two U6 promoters respectively express a1 st sgRNA1 and a2 nd sgRNA2; the EF-1 alpha promoter is an EF-1 alpha promoter and expresses cas9 plasmid. The U6 promoter, EF-1 alpha promoter, sgRNA and Cas9 sequences were synthesized by Kinzhi Biotechnology, inc., suzhou, with the cleavage sites MIuI and PciI constructed into backbone plasmid pcDNA3.1.

FIG. 3 is a plasmid construction map of plasmid pAAV-HDR; wherein, AAV2 ITR is adeno-associated virus type 2 inverted terminal repeat sequence, which is one of AAV; IL-2Larm is the left homology arm of the IL-2 gene; IL-2 Rarm is the right homology arm of the IL-2 gene. The reporter gene (EGFP) was inserted between the two ends (i.e., the 5 'and 3' ends) of AAV2 ITR by transduction of two homologous arms (i.e., IL-2Larm and IL-2 Rarm) of IL-2 to construct the sequence of IL-2Larm \/EGFP \/IL-2 Rarm, which was synthesized by King Kogyo Biotech, suzhou, and constructed into a backbone plasmid (addge # 98218) with the cleavage sites XbaI and BspEI.

As shown in fig. 2 and 3, the well-defined sgRNA gene and Cas9 protein gene were constructed in psgRNA2, and the homology arm gene and EGFP reporter gene were constructed in AAV expression plasmid. Plasmid construction and AAV packaging was accomplished by Heyuan Biotechnology (Shanghai) Inc.

Example 2TCR screening

(1) TILs isolation

Removing the tissue beside sterile fresh tumor cancer, removing the surrounding fat, blood clot and necrotic tissue, washing with PBS twice, and cutting into 1-2mm pieces ³ Size, add 0.1. Mu.g/mL collagenase type IV (Sigma-Aldrich), volume added to infiltrate tumor tissue, and place in a 37 ℃ water bath for digestion for 2h.

The tissue mass was washed with PBS after filtration through a 100 μm pore size mesh screen and the filtrate was collected.

Centrifuging at room temperature, and centrifuging at 1500r/min for 5min. The supernatant was discarded, and after a small amount of cell suspension was prepared by adding 1mL of PBS, the lymphocyte separation medium was subjected to discontinuous density gradient centrifugation.

Centrifuging, collecting lymphocyte of lower layer interface, washing with PBS, and performing treatment at 1 × 10 ⁶ Each mL of the suspension was suspended in XVIVO-15 culture containing 10% human AB type serum and rIL-2 (2000 IU/mL), and seeded on 12-well plates at 3 mL/well.

At 37 ℃ C, 5% CO ₂ Culturing in an incubator, changing the liquid every 3-5 days, and separating to obtain the TILs.

(2) Specific detection of TILs Activity

The activity and specificity of TILs was determined by secretion of IL-2, TILs at 1X10 ⁶ One/well was seeded in 24-well plates with or without the addition of 3X10 per well, respectively ⁵ The individual autologous stimulated tumor cells were incubated together. Collecting cell supernatant in 18-24 hours, and detecting the IL-2 secretion amount by ELSIA as follows: the IL-2 secretion amount before stimulation is 22pg/mL; IL-2 secretion after stimulation was 97pg/mL, as shown in FIG. 4; thus, after stimulation, the amount of activated TILs secreting IL-2 is much more than four times that before stimulation, suggesting that TILs can be specifically activated by self-tumor cells.

(3) Gene knock-in

The TILs suspension was centrifuged to adjust the cell density to 1X10 ⁶ And (4) incubating 5ugsgRNA/Cas9 plasmid and TILs for 15min at room temperature, transferring the cell plasmid mixed solution to an electric transfer cup, and carrying out electric transfer.

After the electro-transformation is finished, the preheated DPBS is immediately added, the mixture is placed into an incubator at 37 ℃ for incubation for 2h, and after 2h, the AAV containing the homologous arm and the EGFP single-chain is added.

(4) TILs activation and screening

As shown in FIG. 5, the EGFP gene-knocked-in TILs and autologous tumor cells were co-cultured in X-VIVO15 serum-free medium for 48 hours, washed twice with PBS after the completion of the culture, and then washed at 1X10 ⁶ After sorting out the high expression TILs by flow cytometry,/mL. As shown in FIG. 5, the positive rate of TILs was 2.55%. Subsequently, the selected high expression TILs are subjected to monoclonal culture.

(5) Proliferation of TILs

TILs with high EGFP expression and monoclonal are cultured on a 96-well plate, wherein the culture medium is XVIVO-15 culture medium and contains 5% human AB serum, 2000IU/mL IL-2 and CD3/CD28 antibody magnetic beads.

Extracting TILs total RNA by Trizol extraction method, performing reverse transcription, and cloning by PCR to obtain the tumor specific TCR monoclonal cell.

Example 3TCR-T preparation and use

(1) TCR Lentiviral vector construction

The PCR product obtained in example 2 and lentivirus expression vector p007 were digested with restriction enzymes EcoRI and BamHI, and the products after gel recovery were ligated with DNA ligase to construct a TCR lentivirus vector (pTCR).

(2) Preparation of TCR Lentivirus

Lentiviral envelope Plasmid pMD2.G (Addgene, plasmid # 12259), lentiviral packaging Plasmid psPAX2 (AddgenePlasmid # 12260) and pRSV-Rev (AddgenePlasmid # 12253) were purchased from Addgene (a non-profit tissue in the United states). The recombinant lentiviral vectors described above were transfected into 293T cells by transfection reagent (PEI) to produce TCR lentiviruses.

The specific method comprises the following steps:

taking out two sterile 50ml centrifuge tubes which are numbered as #1 and # 2 respectively; wherein the No. 1 centrifugal tube is used for preparing PEI mixed liquor, and the No. 2 centrifugal tube is used for preparing plasmid mixed liquor;

the plasmid mixture (mass ratio pTCR: psPAX2: pRSV-Rev: pmd2.G =4: 2);

adding 32g of PEI into 500 mu L of serum-free culture medium Opti-MEM, and vortexing to mix the solution sufficiently;

then 500ul of the plasmid mixture was mixed with 500ul of PEI, and added to 293T cells with a confluency of about 90%, and after 48 hours, the virus supernatant was collected, and after ultracentrifugation, the virus was concentrated 100-fold to obtain concentrated virus.

(3) TCR-T preparation and uses

T cells were isolated from PBMC of healthy human peripheral blood, sorted using a T cell sorting kit, and cultured in the medium described in example 2. After 24h, infecting T cells with lentivirus with MOI =3 to obtain TCR-T, adding uninfected T cells and TCR-T cells into CD3/CD28 antibody magnetic beads to enable the cells to grow and expand for 10d, then co-culturing the T cells and the TCR-T cells with tumor cells respectively, collecting supernatant fluid after 18-24h, detecting IL-2 secretion, wherein the detection result is as follows: in uninfected T cells, the secretion amount of IL-2 is 23pg/mL; IL-2 secretion in TCR-T cells was 148pg/mL, as shown in FIG. 6; therefore, the IL-2 secretion in TCR-T after T cell infection is far more than six times that of uninfected T cells, which indicates that TCR-T can be specifically activated by tumor cells.

It should be understood that the above description is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting the scope of the invention, which is defined by the appended claims.

Claims (10)

1. A method of screening for a tumor specific TCR, comprising the steps of:

obtaining tumor tissues and separating out corresponding TILs in the tumor tissues;

knocking off a target gene IL-2 in the TILs genome, and inserting a reporter gene into the downstream of a promoter of the IL-2 to obtain modified TILs;

co-culturing the modified TILs with tumor tissue cells to activate the modified TILs;

screening the activated TILs to select the TILs with high expression in the reporter gene;

and (3) carrying out monoclonal culture on the TILs with high expression in the selected reporter gene to obtain the tumor specific TCR monoclonal cells.

2. The screening method of claim 1, wherein said TILs separation step is preceded by the steps of:

plasmids expressing gRNA and Cas9 proteins were constructed.

3. The screening method of claim 1, wherein the step of knocking off the target gene IL-2 in the TILs genome is performed by the following steps:

transferring plasmids of gRNA and Cas9 protein into separated TILs through a delivery system;

the gRNA knocks off the target gene IL-2 with the Cas9 protein, and the reporter gene is transduced by AAV and inserted downstream of the promoter for the IL-2.

4. The screening method according to claim 3, wherein the plasmid delivery TILs step further comprises the steps of:

determining a gRNA region, and selecting a gRNA gene sequence with the lowest off-target rate;

gRNA expression vectors were designed, synthesized and constructed.

5. The screening method according to claim 4, wherein the gRNA targets IL-2, and the two genes are sgRNA1 and sgRNA2, respectively, and the sgRNA1 has a gene nucleic acid sequence of ACAACTGGAGCATTTTACTGC, and the sgRNA2 has a gene nucleic acid sequence of AAACTTAAATGTGAGCGC.

6. The screening method of claim 3, wherein the delivery system is one or more of lentivirus, retrovirus, adenovirus, plasmid vector, episomal vector, nano-delivery system, and electrical transduction.

7. The screening method according to claim 1, wherein the reporter gene is one or more of EGFP, RFP, mCherry and tdTomato.

8. The screening method of claim 1, wherein the step of activating the modified TILs further comprises the steps of:

and co-culturing the modified TILs and tumor tissue cells in an X-VIVO15 serum-free culture medium for 48h to activate the modified TILs.

9. The screening method according to claim 1, wherein the culturing step for the high-expression TILs in the selected reporter gene further comprises the steps of:

placing the activated TILs with high expression in the selected reporter gene in an X-VIVO15 serum-free culture medium for monoclonal culture for two weeks;

adding magnetic beads containing 5% human AB serum, 2000IU/mL IL-2 and CD3/CD28 antibodies into the monoclonal culture system to obtain proliferated TILs;

extracting total RNA in the proliferated TILs, carrying out reverse transcription, cloning by using PCR, and sequencing to obtain the tumor specific TCR.

10. Use of a tumor specific TCR obtained from the screening assay according to any one of claims 1 to 9 in the manufacture of a medicament for use in the treatment of a tumor.

Images