CN115927415A - Encoding gene of recombinant porcine alpha interferon/interleukin 2 fusion protein and preparation method thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a coding gene of a recombinant porcine alpha interferon/interleukin 2 fusion protein and a preparation method thereof. The invention provides a coding gene of a recombinant porcine alpha interferon/interleukin 2 fusion protein, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 1. The encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein can realize high-efficiency and soluble expression in escherichia coli to prepare soluble recombinant porcine alpha interferon/interleukin 2 fusion protein; the purified recombinant porcine alpha interferon/interleukin 2 fusion protein has higher biological activity on different cell lines, the virus proliferation inhibition activity of the fusion protein is obviously higher than that of an inclusion body protein, the PEDV virus resistance effect of the fusion protein is obvious, and piglets can be effectively protected against the attack of PEDV.

Description

Encoding gene of recombinant porcine alpha interferon/interleukin 2 fusion protein and preparation method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a coding gene of a recombinant porcine alpha interferon/interleukin 2 fusion protein and a preparation method thereof.

Background

With the rapid development of the pig industry, the morbidity and mortality caused by viral infectious diseases of pigs are increasing; especially, immunosuppressive diseases seriously damage the immune system of a pig body, cause vaccine immunity failure and bring great loss to the pig raising industry; some viral diseases of pigs are still not available, and the factors increase the difficulty of prevention and control of the porcine viral diseases. In addition, the improper use and even abuse of antibiotics cause the problems of standard exceeding of drug residues of pork, serious drug resistance of pathogenic bacteria, environmental pollution and the like.

Interferons (IFNs) are a class of cytokines that have broad-spectrum antiviral, antitumor, and immune-activating functional activities on allogeneic cells. Mammalian interferons are classified into type I and type II 2, IFN-alpha belongs to type I interferon, alpha interferon can exert antitumor effect by inhibiting tumor cell proliferation, promoting tumor cell apoptosis, and regulating immune cell activity (including macrophage, DC cell, B cell, T cell, innate immunity NK cell, etc.), such as promoting CD4 ⁺ T cell, CD8 ⁺ Activation and proliferation of T cells, secretion of corresponding cytokines, promotion of killing activity and proliferation of NK cells, and down regulation of suppressive T cells (Tregs).

Interleukin-2 (interleukin-2, IL-2) is also called T Cell Growth Factor (TCGF), can induce the growth and differentiation of T lymphocytes of an organism, activate Cytotoxic T Lymphocytes (CTL) and NK cells, stimulate cells to secrete cytokines such as tumor necrosis factor alpha (TNF-alpha), gamma interferon (IFN-gamma) and the like, and improve the cellular immunity of the organism; IL-2 can also activate B lymphocytes, promote antibody secretion, and enhance the presenting ability of macrophages to antigens, bactericidal power and cytotoxicity, thereby playing antiviral and antitumor roles. Therefore, the gene engineering IL-2 protein preparation can be used as a therapeutic agent in the aspects of antiviral diseases, autoimmune diseases and anti-tumor, can also be used as an adjuvant to enhance the immune effect of the vaccine, and has wide application prospect. The development of the recombinant porcine alpha interferon/interleukin 2 fusion protein with the functions of both alpha interferon and interleukin 2 can provide an efficient gene engineering antiviral preparation for the prevention and control of the swine plague, and has important significance for the prevention and control of the swine plague.

Disclosure of Invention

The invention provides a coding gene, a recombinant vector and a recombinant bacterium of a recombinant porcine alpha interferon/interleukin 2 fusion protein, and a preparation method of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

In earlier researches, the applicant constructs a PoIFN-alpha-linker-PoIL-2 chimeric gene and expresses the chimeric gene in a prokaryotic expression system in an inclusion body form, and the chimeric gene preliminarily proves that the chimeric gene has dual biological activities of PoIFN-alpha and PoIL-2 protein on cells. However, the inclusion body protein can cause a great deal of protein loss after complex denaturation and renaturation, and the biological activity is low, so that the preparation efficiency and the application value of the recombinant porcine alpha interferon/interleukin 2 fusion protein are obviously reduced, and the application of the fusion protein is greatly limited. The soluble expression of the recombinant porcine alpha interferon/interleukin 2 fusion protein is realized by performing soluble modification on the PoIFN-alpha-linker-PoIL-2 chimeric gene. The determination shows that the recombinant porcine alpha interferon/interleukin 2 fusion protein has the inhibition effect on various viruses on different cells, and the recombinant protein has broad-spectrum antiviral activity and can play a good role in preventing porcine viral diseases.

Specifically, the present invention provides the following technical solutions

In a first aspect, the invention provides a coding gene of a recombinant porcine alpha interferon/interleukin 2 fusion protein, wherein the nucleotide sequence of the coding gene is shown as SEQ ID No. 1.

The sequence shown in SEQ ID NO.1 is as follows:

TGTGACCTGCCTCAGACCCACTCCCTGGCCCACACCCGCGCCCTGAGACTGCTGGCCCAGATGAGAAGGATTTCCCCATTTAGCTGCCTGGATCACAGAAGAGACTTCGGCAGCCCTCACGAAGCCTTCGGCGGAAACCAGGTGCAGAAGGCCCAGGCCATGGCCCTGGTGCACGAGATGCTGCAGCAGACGTTCCAGCTGTTTAGCACTGAGGGATCCGCCGCCGCCTGGAACGAAAGCCTCCTGCACCAGTTCTGCACCGGCCTGGACCAGCAGCTGCGCGATCTGGAGGCCTGCGTGATGCAGGAGGCCGGACTGGAGGGGACGCCCCTGCTGGAGGAGGATTCCATTCTGGCCGTGAGGAAATATTTCCACCGGCTGACCTTATACCTGCAGGAGAAGTCCTACTCCCCTTGCGCGTGGGAGATCGTGAGGGCCGAAGTGATGAGATCCTTCAGCAGCAGCACCAACCTCCAGGACAGACTGAGAAAAAAGGAGGGCGGCGGCGGCAGCGGAGGCGGCGGCTCCGGCGGCGGGGGCAGCGCCCCCACCAGCTCCAGTACCAAAAACACCAAGAAGCAGCTGGAGCCCCTGCTGCTGGATCTGCAGCTCCTGCTGAAGGAAGTGAAAAACTACGAGAACGCCGATCTGTCTCGCATGCTGACTTTCAAGTTCTATATGCCTAAGCAGGCCACAGAGCTGAAGCATCTGCAGTGCCTGGTGGAGGAGCTGAAGGCCCTGGAGGGCGTCCTGAACCTGGGCCAGAGTAAAAACTCTGACTCCGCCAACATCAAAGAAAGCATGAACAACATCAACGTGACCGTGCTGGAGCTGAAGGGCAGCGAGACCTCCTTCAAGTGCGAGTATGACGACGAGACCGTGACCGCCGTGGAATTCCTGAACAAGTGGATCACCTTTTGCCAGTGCATCTACTCAACACTGACT。

the coding gene with the nucleotide sequence shown as SEQ ID NO.1 is the gene of the coding recombinant porcine alpha interferon/interleukin 2 fusion protein obtained by specific codon optimization, the coding gene can realize the high-efficiency and soluble expression of the recombinant porcine alpha interferon/interleukin 2 fusion protein in escherichia coli, the expressed recombinant porcine alpha interferon/interleukin 2 fusion protein has the dual biological activities of PoIFN-alpha and PoIL-2 protein, and the biological activity is obviously improved compared with that of an inclusion body protein.

In the invention, the recombinant porcine alpha interferon/interleukin 2 fusion protein is obtained by connecting the porcine alpha interferon and the porcine interleukin 2 through a flexible linker, wherein the flexible linker is (G4S) ₃ 。

In a second aspect, the invention provides an expression cassette, which contains a promoter and the above-mentioned encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

The present invention is not particularly limited with respect to the kind and sequence of the promoter, and all promoters capable of promoting gene transcription can be selected.

In a third aspect, the invention provides a recombinant vector, which contains the above-mentioned encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

The recombinant vector may be a plasmid vector or a viral vector.

Preferably, the vector is a pET-32a vector containing the coding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

The recombinant vector is obtained by connecting the coding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein with a pET-32a vector.

In a fourth aspect, the invention provides a recombinant bacterium, which contains the above-mentioned encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein, or the expression cassette or the recombinant vector.

Preferably, the recombinant bacterium is escherichia coli.

More preferably, the recombinant bacterium is escherichia coli BL21 containing the recombinant vector.

In a fifth aspect, the invention provides an application of the encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein, or the expression cassette, or the recombinant vector, or the recombinant bacterium in preparation of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

In a sixth aspect, the present invention provides a method for preparing a recombinant porcine interferon-alpha/interleukin 2 fusion protein, the method comprising: and culturing the recombinant strain to express the recombinant porcine alpha interferon/interleukin 2 fusion protein.

Preferably, in the process of culturing the recombinant bacteria, IPTG is adopted to induce the expression of the recombinant porcine alpha interferon/interleukin 2 fusion protein, the concentration of the IPTG used for induction is 0.2-1.0mmol/L, and the temperature for induction is 20-30 ℃.

Further preferably, the concentration of IPTG used for induction is 0.2mmol/L, the temperature for induction is 25 ℃, and the induction time is 8-10h.

Preferably, the method further comprises: collecting the culture solution and purifying the recombinant porcine alpha interferon/interleukin 2 fusion protein by affinity chromatography.

In the method, after affinity chromatography, the recombinant porcine alpha interferon/interleukin 2 fusion protein is prepared after dialysis desalting and imidazole removal.

The invention has the beneficial effects that: the coding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein provided by the invention can realize high-efficiency and soluble expression in escherichia coli to prepare the soluble recombinant porcine alpha interferon/interleukin 2 fusion protein; the purified recombinant porcine alpha interferon/interleukin 2 fusion protein has higher biological activity on different cell lines, the virus proliferation inhibition activity of the recombinant porcine alpha interferon/interleukin 2 fusion protein is obviously higher than that of an inclusion body protein, and animal experiments prove that the recombinant porcine alpha interferon/interleukin 2 fusion protein has obvious effect of resisting PEDV virus and can effectively protect piglets against the attack of PEDV; the coding gene, the vector, the recombinant bacterium and the preparation method provided by the invention are expected to be used for batch production and clinical application of rPoIFN-alpha, and lay a foundation for large-scale production and clinical popularization and application of the recombinant porcine alpha interferon/interleukin 2 fusion protein.

Drawings

In order to more clearly illustrate the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the results of electrophoresis detection of the full-length PoIFN-alpha-linker-PoIL-2 chimeric gene amplified by SOE-PCR in example 1 of the present invention, wherein M is DNA Marker; 1; linker-PoIL-2;3, poIFN-alpha-linker-PoIL-2 chimeric gene.

FIG. 2 is a graph showing the identification of rT-PoIFN- α -linker-PoIL-2 plasmid and rpET-32a-PoIFN- α -linker-PoIL-2 plasmid in example 1 of the present invention, wherein A is the PCR amplification result of rT-PoIFN- α -linker-PoIL-2 plasmid; b, rpET-32 a-PoIFN-alpha-linker-PoIL-2 plasmid PCR amplification result; the rpET-32 a-PoIFN-alpha-linker-PoIL-2 plasmid double enzyme digestion identification; m is DNA Marker;1, rT-PoIFN-alpha-linker-PoIL-2 PCR amplification product; 2, rT-PoIFN-alpha-linker-PoIL-2 PCR amplification product; 3, rpET-32 a-PoIFN-alpha-linker-PoIL-2 plasmid double digestion product.

FIG. 3 is SDS-PAGE of rPoIFN-. Alpha. -linker-PoIL-2 protein expression products in example 2 of the present invention, wherein M is a relative molecular weight standard of the protein; 1; 2, pET-32a no-load induction expression control; 3, inducing precipitation; 4, inducing the supernatant.

FIG. 4 shows the effect of different concentrations of IPTG on rPoIFN-. Alpha. -linker-PoIL-2 protein expression in example 2 of the present invention, wherein M is a relative molecular weight standard for the protein; 1, inducing rPoIFN-alpha-linker-PoIL-2 protein by 0.2mmol/L IPTG; 2, inducing rPoIFN-alpha-linker-PoIL-2 protein by 0.5mmol/L IPTG; 3, inducing rPoIFN-alpha-linker-PoIL-2 protein by 0.7mmol/L IPTG; 4, 1mmol/L IPTG induces rPoIFN-alpha-linker-PoIL-2 protein.

FIG. 5 is a graph showing the effect of different induction temperatures on the expression of rPoIFN- α -linker-PoIL-2 protein in example 2 of the present invention, wherein M is a relative molecular weight standard of the protein; 1, inducing a supernatant at 20 ℃;2, inducing precipitation at 20 ℃;3, inducing the supernatant at 25 ℃;4, inducing precipitation at 25 ℃;5, inducing precipitation at 30 ℃;6, inducing supernatant at 30 ℃;7, inducing precipitation at 37 ℃; the supernatant was induced at 8.

FIG. 6 shows the effect of different induction times on rPoIFN- α -linker-PoIL-2 protein expression in example 2 of the present invention, wherein M is the relative molecular weight of the protein; 1, 6h induces rPoIFN-alpha-linker-PoIL-2 protein; 2, 9h induces rPoIFN-alpha-linker-PoIL-2 protein; 3, 12h induces rPoIFN-alpha-linker-PoIL-2 protein; 4, 18h induces rPoIFN-alpha-linker-PoIL-2 protein.

FIG. 7 is SDS-PAGE of rPoIFN-. Alpha. -linker-PoIL-2 protein purification in example 2 of the present invention, wherein M is a relative molecular weight standard of the protein; 1, purified rPoIFN-alpha-linker-PoIL-2 protein.

FIG. 8 shows the disease onset of the control group at 48h after PEDV challenge in example 5 of the present invention; 5/5 protection of a porcine interferon prevention group, wherein the left picture is a virus challenge control group, and all pigs of 5 pigs of the control group have PEDV infection typical diarrhea symptoms after 48 hours of virus challenge, and 5/5 morbidity occurs; the right panel shows the interferon prevention group, and no PEDV infection typical diarrhea symptoms appear in the pigs at 48h after challenge, and 5/5 protection is achieved.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is obvious that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The invention adopts overlapping extension PCR (SOE-PCR) method to construct the Porcine alpha interferon (PoIFN-alpha) and the Porcine interleukin 2 (Porcine interferon-2, poIL-2) gene into the PoIFN-alpha-linker-PoIL-2 chimeric gene through a gene flexible joint, and carries out soluble modification on the PoIFN-alpha-linker-PoIL-2 chimeric gene based on the codon preference of escherichia coli on the premise of not changing the original amino acid composition of the interferon. Cloning the modified PoIFN-alpha-linker-PoIL-2 gene to an expression vector pET-32a (+) for prokaryotic expression, screening out recombinant bacteria capable of stably and soluble expression, and purifying the expressed recombinant fusion protein by adopting a nickel-chromium affinity chromatography column.

The activity of specific immunoreaction of rPoIFN-alpha-linker-PoIL-2 protein, anti-PoIL-2 monoclonal antibody and anti-PoIFN-alpha monoclonal antibody is detected by an ELISA method, the inhibition activity of rPoIFN-alpha 0-linker-PoIL-2 protein on different cell lines to inhibit the proliferation of different viruses is detected by a cytopathic inhibition method, and the infection effect of the rPoIFN-alpha-linker-PoIL-2 protein on porcine epidemic diarrhea viruses is verified by an antiviral infection test. Through verification, a large amount of soluble expression is obtained in escherichia coli by the PoIFN-alpha-linker-PoIL-2 chimeric gene, and the molecular weight of the expressed rPoIFN-alpha-linker-PoIL-2 protein is about 55kD. The rPoIFN-alpha-linker-PoIL-2 protein is purified by a nickel-chromium affinity chromatographic column to achieve the purity of more than 90 percent; the purified rPoIFN-alpha-linker-PoIL-2 can generate specific immunoreaction with anti-PoIFN-alpha monoclonal antibody and anti-PoIL-2 monoclonal antibody, and the relative contents of the determined PoIFN-alpha protein and PoIL-2 protein are 49pg/mL and 195pg/mL respectively; the rPoIFN-alpha-linker-PoIL-2 protein has the activity of inhibiting virus proliferation on different cells, but has different activity of inhibiting virus proliferation on different cells, and the unit of the activity of inhibiting VSV on PK-15 is 1.8 alpha 110 ⁵ IU·mg ^-1 The unit of activity for inhibiting VSV on WISH cells was 2.5X 10 ⁵ IU·mg ^-1 The unit of activity for inhibiting PRV on PK-15 cells was 2.2X 10 ⁴ IU·mg ^-1 The unit of SVA-inhibiting activity on PK-15 cells was 1.3X 10 ⁵ IU·mg ^-1 The unit of activity for inhibition of PEDV on Vero cells was 3.2X 10 ⁴ IU·mg ^-1 (ii) a The result of an antiviral infection test shows that rPoIFN-alpha-linker-PoIL-2 soluble protein has obvious effect of resisting PEDV virus, and 5/5 protection is achieved.

The main reagents, plasmids and instruments used in the following examples are as follows: the expression vectors pET-32a (+), vesicular Stomatitis Virus (VSV), pseudorabies virus (PRV), seneca Virus (SVA) and epidemic diarrhea virus (PEDV) are all provided by animal epidemic prevention and control center in Henan province. Restriction enzymes EcoRI, hindIII, DNA Marker, protein molecular weight standards and the like were purchased from Takara; tryptone (Tryptone), yeast extract (Yeast extract) were purchased from Oxoid corporation; a protein Purification kit (His-Bind Purification kit, cat # 70239-3) was purchased from Novagen, and a DNA agarose gel kit and a BCA protein mass concentration determination kit were purchased from Bychotan Biotech. The gel imaging analysis system is a product of Alpha Inotech company in the United states; the ultrasonic cracker is a product of Sonics corporation in America.

The PEDV test toxicants used in the following examples were as follows: the virus for PEDV virus challenge is more than or equal to 1.0 multiplied by 10 per milliliter of virus content ^5.5 TCID50。

The test animals used in the following examples are as follows: the healthy and susceptible piglets aged 15 days are negative to PEDV nucleic acid in the anus swab and the serum sample, and the neutralizing antibody of the PEDV is less than or equal to 1: 4.

Example 1 construction of PoIFN-. Alpha. -linker-PoIL-2 chimeric Gene and expression vector thereof

1. Design and Synthesis of primers

The gene joint is a flexible joint (G4S) rich in glycine (G) and serine (S) ₃ 15 amino acids in total, and is designed by laboratories of the animal epidemic disease prevention and control center of Henan province. Based on the sequenced rpQE-30/PoIFN-alpha gene sequence (GenBank accession No.: AB 369102) and the rpQE-PoIL-2 gene sequence (accession No.: AB 194099) in GenBank, 4 primers were designed for SOE-PCR amplification using Oligo6.0 software, and the primer sequences were as follows: p1:5' CCGGAATTCTGTGACCTGCCTCTCAGACCC-; p2:5 'GCCACCGCCACCGCAGCCACCTCCCTCCGCTGAACCCTCCCTCC TTCTTCTGAGTCTG-3', the total length is 58bp, wherein the partial linker length is 39bp and is a downstream primer for amplifying the PoIFN-alpha-linker part of the PoIFN-alpha-linker-PoIL-2 chimeric gene; p3:5' and used as an upstream primer for amplifying the linker + PoIL2 part of the chimeric gene; p4:5' tacgggattccagtccagtgtgagatgc-. The above primers were synthesized by great Lianbao (TaKaRa) bioengineering technology.

2. Construction of PoIFN-alpha-linker-PoIL-2 chimeric gene

The construction of PoIFN-alpha-linker-PoIL-2 chimeric gene was carried out by referring to the method reported by Yan Rafin et al (Yan Rafin, wuzhiming, zhang Zhiling, hemin, liuguanhui, zhang Mingjun. Fusion expression and activity of porcine alpha interferon/interleukin 2 gene [ J ]. Animal husbandry and veterinary science, 2009,40 (02): 248-255.). A DNA recovery kit is used for recovering a PCR product of about 945bp, and both ends of the PCR product respectively carry EcoRI and HindIII restriction endonuclease sites.

The results show that 3 pieces of PoIFN-alpha-linker-PoIL-2 chimeric genes are successfully constructed by adopting an SOE-PCR method, and the nucleotide sequences are respectively shown as SEQ ID NO.1, 2 and 3. The size of the PCR amplification product of the PoIFN-alpha-linker is about 523 bp; the size of the linker-PoIL-2PCR amplification product is about 422 bp; the PCR identification is carried out by adopting the chimeric genes constructed by the P1/P4 primer, the sizes of PCR products of the three chimeric genes are about 945bp, and are consistent with the expected result (figure 1).

3. Soluble modification and cloning of PoIFN-alpha-linker-PoIL-2 chimeric gene

According to the codon preference of escherichia coli, the factors such as GC content and the like are comprehensively considered, and the PoIFN-alpha-linker-PoIL-2 chimeric gene is subjected to soluble modification. In order to obtain the chimeric gene capable of realizing efficient soluble expression, the invention carries out a great deal of screening and verification on the codon optimization mode of the PoIFN-alpha-linker-PoIL-2 chimeric gene, and finds that the efficient soluble expression of the PoIFN-alpha-linker-PoIL-2 chimeric gene can be realized by replacing rare codons with escherichia coli preference codons and ensuring the appropriate GC content not only according to the codon preference, and a lot of codon-optimized chimeric genes do not contain rare codons and have appropriate GC content, but the soluble expression quantity is still lower. The following examples illustrate 3 codon-optimized chimeric genes screened during development.

For the cloning operation, ecoRI sites were inserted at the 5 'end and HindIII sites at the 3' end of the PoIFN-. Alpha. -linker-PoIL-2 chimeric gene. The expected length of the amplified target fragment is 945bp. Connecting the modified PoIFN-alpha-linker-PoIL-2 gene (3 PoIFN-alpha-linker-PoIL-2 chimeric genes described in the 2, and 3 PoIFN-alpha-linker-PoIL-2 chimeric genes are different in codon optimized base, namely the optimized gene sequences are different and are respectively shown in SEQ ID NO. 1-3) with a pGEM-T Easy vector to construct a recombinant clone plasmid pGEM-T Easy-PoIFN-alpha-linker-PoIL-2, transforming JM109 competent cells, screening positive clone plasmids through a blue-white spot test, and carrying out PCR, plasmid double digestion and sequencing identification. Carrying out EcoRI and Hind III double enzyme digestion on correctly identified recombinant plasmids pGEM-TEAsy-PoIFN-alpha-linker-PoIL-2 and pET-32a (+), recovering a target gene fragment and a vector fragment, and connecting by T4 DNA ligase to construct a recombinant expression plasmid pET-32 a-PoIFN-alpha-linker-PoIL-2. Transforming E.coli BL21 (DE 3) competent cells by the recombinant expression plasmid, screening positive clones, extracting the plasmid, carrying out double enzyme digestion (EcoRI/Hind III) identification, and sending the correctly identified recombinant plasmid to Weijie Jie (Shanghai) trade Limited company for sequencing.

The 3 constructed soluble expression clone plasmids pGEM-TEAsy/PoIFN-alpha-linker-PoIL-2 were subjected to PCR amplification to obtain 3 specific bands of 945bp (FIG. 2A). Sequencing results prove that rT-PoIFN-alpha-linker-PoIL-2 is successfully constructed. The 3 constructed recombinant expression plasmids pET-32 a/PoIFN-alpha-linker-PoIL-2 are identified by PCR, and specific bands (B in figure 2) appear at 945bp positions. Specific bands appear at 945bp and 5900bp, which are identified by EcoRI and HindIII double digestion, and the sizes are consistent with the expectation (see C of figure 2). Sequencing comparison analysis is carried out on 3 positive recombinant expression plasmids pET-32 a/PoIFN-alpha-linker-PoIL-2 respectively, and results show that no mutation or deletion of nucleotide occurs and the insertion direction and position are correct. Indicating that rpET-32 a/PoIFN-alpha-linker-PoIL-2 expression plasmid is successfully constructed.

Example 2 expression and purification of rPoIFN-. Alpha. -linker-PoIL-2 protein

1. rPoIFN-alpha-linker-PoIL-2 protein expression and optimization of induced expression conditions

Selecting correct E.coli BL21 (DE 3) recombinant bacteria identified in example 1, optimally screening induced expression conditions such as IPTG concentration, temperature, time and the like by using BL21 empty bacteria and pET-32a empty vector as controls, centrifugally collecting bacterial precipitates after induced expression, adding a lysis buffer solution to resuspend the bacterial after freezing and thawing at-80 ℃, ultrasonically lysing in ice bath, centrifuging, collecting supernatant and precipitates, and analyzing the soluble expression condition of rPoIFN-alpha-linker-PoIL-2 protein by SDS-PAGE.

The result shows that after IPTG induction, 1 chimeric gene (the sequence is shown as SEQ ID NO. 1) in 3 recombinant expression plasmids PoIFN-alpha-linker-PoIL-2 constructed in the example 1 is efficiently expressed in E.coli.BL21 (DE 3), the protein expression amount accounts for more than 80 percent of the total protein of the thallus, the size is about 55kD and is consistent with the expected size, and the content of the target protein in the supernatant is obviously higher than that of the target protein in the precipitate (as shown in figure 3), which indicates that the recombinant protein PoIFN-alpha-linker-PoIL-2 has solubility; through SDS-PAGE electrophoretic analysis and thin-layer scanning analysis, the expression quantity of rPoIFN-alpha-linker-PoIL-2 protein expressed in the supernatant accounts for 80 percent of the total expression quantity of the whole thalli, and the size is about 55KD; and the expression quantity of rPoIFN-alpha-linker-PoIL-2 protein expressed in the sediment accounts for 10 percent of the total expression quantity of the whole thalli. In addition, the gene shown by SEQ ID NO.2 in the 2 genes can not be expressed, and the gene shown by SEQ ID NO.3 can not be stably and efficiently expressed.

As shown in FIG. 4, FIG. 5 and FIG. 6, the results of the optimization of the induction conditions show that when the IPTG concentration is 0.2mmol/L, the induction temperature is 25 ℃ and the induction time is 9 hours, the expression level of the target protein is the highest and then becomes stable.

2. Purification of rPoIFN-alpha-linker-PoIL-2 protein

And (3) centrifugally collecting the escherichia coli thalli subjected to induced expression, adding a lysis buffer solution, fully suspending and uniformly mixing, ultrasonically crushing, centrifuging, and collecting supernate. The obtained cell supernatant was purified by affinity chromatography according to the instruction of His-tag protein purification kit, and the eluted protein was collected and analyzed by 12% SDS-PAGE. Dialyzing at 4 deg.C to remove salt and imidazole, and collecting protein.

The results show that purified protein with purity of more than 90% is successfully obtained after rPoIFN-alpha-linker-PoIL-2 protein is purified by a nickel-chromium affinity chromatography column (FIG. 7).

3. Detection and removal of endotoxins

Extracting and removing endotoxin contained in the purified rPoIFN-alpha-linker-PoIL-2 protein by using Triton X-114, wherein the method comprises the following steps: adding 1% into the purified proteinTriton X-114, magnetically stirring at 4 deg.C for 60min, and mixing completely; placing in 30 deg.C water bath for 40min, stirring occasionally; centrifuging at 25 deg.C for 15min at 15000g, carefully removing the upper aqueous phase, and performing two cycles; with a ToxinSensor ^TM And detecting the endotoxin content in the sample by using the LAL endotoxin detection kit by a color development method.

The results show that the product is obtained by ToxinSensor ^TM And detecting by using a LAL endotoxin detection kit through a color development method, wherein the content of endotoxin in rPoIFN-alpha-linker-PoIL-2 protein before removing the endotoxin is 400EU/mL, and the content of the removed endotoxin is lower than 50EU/mL, so that the detection accords with the classical provisions of veterinary medicines.

Example 3 detection of rPoIFN-. Alpha. -linker-PoIL-2 protein-specific immunoreactivity

Detecting whether rPoIFN-alpha-linker-PoIL-2 protein can generate specific immunoreaction with anti-PoIFN-alpha and anti-PoIL-2 monoclonal antibodies by using a Porcine IFN-alpha ELISA detection kit and a Porcine IL-2ELISA detection kit so as to judge whether the rPoIFN-alpha-linker-PoIL-2 protein has the immunological activity of the PoIFN-alpha-linker-PoIL-2 protein, and quantifying the rPoIFN-alpha-linker-PoIL-2 protein. Detecting with reference to kit instructions, and performing ELISA reaction on purified rPoIFN-alpha-linker-PoIL-2 protein, poIFN-alpha in kit and positive control of PoIL-2 to obtain OD ₄₅₀ Comparing the values with a standard curve, and calculating the relative quantification of PoIFN-alpha and PoIL-2 in rPoIFN-alpha-linker-PoIL-2 protein.

The result shows that the purified rPoIFN-alpha-linker-PoIL-2 protein can react with anti-PoIFN-alpha and anti-PoIL-2 monoclonal antibodies, and the result shows that the rPoIFN-alpha-linker-PoIL-2 has the biological activity of specific immunoreaction with the PoIFN-alpha and anti-PoIL-2 monoclonal antibodies. And comparing the OD450 value of the purified rPoIFN-alpha-linker-PoIL-2 protein with a protein standard curve, and calculating to obtain the relative content of PoIFN-alpha protein in the rPoIFN-alpha-linker-PoIL-2 protein of about 49pg/mL and the relative content of PoIL-2 protein of about 195pg/mL according to a standard curve equation.

Example 4 detection of rPoIFN-. Alpha. -linker-PoIL-2 protein on inhibition of different viral proliferative Activity on different cells

The method for detecting the difference of rPoIFN-alpha-linker-PoIL-2 soluble protein in PK-15/VSV, WISH/VSV, PK-15/PRV, PK-15/SVA, vero/PEDV and the like by adopting a cytopathic inhibition methodInhibition of different viral proliferative activities on cell lines. After culturing the cells to a monolayer in a 96-well cell plate, 100. Mu.L of rPoIFN-. Alpha. -linker-PoIL-2 protein diluted 2-fold was added per well at 37 ℃ and 5% CO ₂ After 24 hours of incubation in an incubator, 100. Mu.L of 100TCID was added to the cells ₅₀ Viruses, a normal cell control group and a virus control group were simultaneously prepared and compared with inclusion body proteins (ZAMOISKII E. Evaluation of Reed-Muench method in determination of activity of biological preparations [ J. ]].Zhurnal mikrobiologii,epidemiologii i immunobiologii,1956,27(1).)。

Calculation of rPoIFN-. Alpha. -linker-PoIL-2 inhibitory Activity on different cell lines PK-15/VSV, WISH/VSV, PK-15/PRV, PK-15/SVA, vero/PEDV by the Reed-Muench method, the results are shown in Table 1. The rPoIFN-alpha-linker-PoIL-2 protein has higher virus proliferation inhibition activity in animal cells of different sources, and the titer of the recombinant soluble protein is higher than that of the inclusion body protein, and the specific results are as follows:

the detection result of the proliferation activity of the rPoIFN-alpha-linker-PoIL-2 protein on PK-15 cells for inhibiting VSV shows that the log of the dilution of interferon for inhibiting 50 percent of cytopathic effect ₂ X is 11.5, and X =2896 is calculated, namely the potency of rPoIFN-alpha-linker-PoIL-2 protein is 2.9X 10 ⁴ IU·mL ^-1 (1.8×10 ⁵ IU·mg ^-1 ) The titer of the inclusion body protein is 5.1 × 10 ³ IU·mL ^-1 (1.7×10 ⁴ IU·mg ^-1 ). The cells of the cell control group have no CPE, and the cells of the virus control group have CPE. The rPoIFN-alpha-linker-PoIL-2 soluble protein has higher VSV proliferation inhibiting activity on PK-15 cells than that of inclusion body protein.

The detection result of the PRV proliferation inhibiting activity of rPoIFN-alpha-linker-PoIL-2 protein on PK-15 cells shows that the log of the dilution of interferon for inhibiting 50 percent of cytopathic effect ₂ X is 9, X =512 is calculated, i.e. the potency of rPoIFN-alpha-linker-PoIL-2 protein is 3.6X 10 ⁴ IU·mL ^-1 (2.2×10 ⁴ IU·mg ^-1 ) The titer of the inclusion body protein is 6.4X 10 ² IU·mL ^-1 (2.1×10 ³ IU·mg ^-1 ). Cell control group has no CPE and virusCPE was present in all control cells. The rPoIFN-alpha-linker-PoIL-2 soluble protein has higher PRV proliferation inhibiting activity on PK-15 cells than that of the inclusion body protein.

The detection result of the SVA proliferation inhibiting activity of the rPoIFN-alpha-linker-PoIL-2 protein on PK-15 cells shows that the log2X of the dilution of interferon for inhibiting 50% of cytopathic effect is 11, and the calculation is X =2048, namely the titer of the rPoIFN-alpha-linker-PoIL-2 protein is 2.0X 10 ⁴ IU·mL ^-1 (1.3×10 ⁵ IU·mg ^-1 ) The titer of the inclusion body protein is 3.6 multiplied by 10 ³ IU·mL ^-1 (1.2×10 ⁴ IU·mg ^-1 ). The cells of the cell control group have no CPE, and the cells of the virus control group have CPE. The rPoIFN-alpha-linker-PoIL-2 soluble protein has higher SVA proliferation inhibiting activity on PK-15 cells than that of the inclusion body protein.

The result of the activity test of rPoIFN-alpha-linker-PoIL-2 protein for inhibiting VSV proliferation on WISH cells shows that the log2X of the dilution of interferon for inhibiting 50% of cytopathic effect is 10, and the calculation X =1024, namely the titer of rPoIFN-alpha-linker-PoIL-2 protein is 4.1 × 10 ⁴ IU·mL ^-1 (2.5×10 ⁵ IU·mg ^-1 ) The titer of the envelope protein is 1.3X 10 ³ IU·mL ^-1 (4.2×10 ³ IU·mg ^-1 ). The cells of the cell control group have no CPE, and the cells of the virus control group have CPE. Indicating that rPoIFN-alpha-linker-PoIL-2 soluble protein has higher VSV proliferation inhibiting activity on WISH cells than that of inclusion body protein.

The detection result of the rPoIFN-alpha-linker-PoIL-2 protein on Vero cells for inhibiting the PEDV proliferation activity shows that the logarithm of the dilution of interferon for inhibiting 50 percent of cytopathic effect is 8 log2X, and the calculated X =256, namely the titer of the rPoIFN-alpha-linker-PoIL-2 protein is 5.1X 10 ³ IU·mL ^-1 (3.2×10 ⁴ IU·mg ^-1 ) The titer of the inclusion body protein is 6.4 multiplied by 102IU mL ^-1 (2.1×10 ³ IU·mg ^-1 ). The cells of the cell control group have no CPE, and the cells of the virus control group have CPE. The rPoIFN-alpha-linker-PoIL-2 soluble protein has higher activity of inhibiting PEDV proliferation on Vero cells than that of the inclusion body protein.

TABLE 1 detection results of rPoIFN-alpha-linker-PoIL-2 protein inhibiting proliferation activity of different viruses on different cells

/>

Example 5 rPoIFN-. Alpha. -linker-PoIL-2 anti-PEDV infection assay

15 healthy susceptible piglets were randomly divided into 3 test groups, 5 for the challenge control group, 5 for the blank control group, 5 for the interferon prevention group, and 2 days before challenge, and pigs in the pig interferon prevention test group were injected with rPoIFN- α -linker-PoIL-2,2 mL/head/day, purified and endotoxin-removed by intramuscular injection at the neck for 7 days continuously. The test pigs of the toxin attacking control group and the interferon prevention group are subjected to toxin attacking in an oral mode, and 2 mL/head of the test pigs and a blank control group are synchronously orally taken with DMEM liquid. Within 10 days after the challenge, clinical symptoms of each pig (disease standard: the test pig has watery diarrhea, yellow or gray color, occasionally accompanied by symptoms such as vomit and mental depression, and the like, and severe pigs may die, wherein the diarrhea is an indispensable condition for determining the disease) are observed every day, and the disease condition of each group is counted.

The test results (figure 8) show that 24h after the challenge of the challenge control group, 1/5 pigs have PEDV infection typical diarrhea symptoms, 48h after the challenge, 5/5 pigs have PEDV infection typical diarrhea symptoms, and 5/5 of the pigs have diseases. The sick pigs are accompanied with mental depression and appetite reduction, 1/5 of the pigs have vomiting symptom, then gradually get leaner, and 2/5 of the pigs die. In an observation period of 1-10 days after the interferon prevention group attacks the toxin, 5 pigs in the PoIFN-alpha-linker-PoIL-2 prevention group (intramuscular injection) do not have PEDV infection typical diarrhea symptoms, and 5/5 of the pigs are protected. The control group had normal 5 pigs throughout the observation period and exhibited no symptoms of diarrhea typical of PEDV infection.

Alpha interferon is a kind of cell factor with broad spectrum antiviral, antitumor and immune activating activity on homogeneous cell. IFN-alpha belongs to I type interferon, and has the main functions of inhibiting virus propagation activity, resisting tumor activity, enhancing the ability of NK cells to kill virus infected cells, inhibiting virus proliferation and diffusion, enhancing the level of cellular immune response of organisms and the like. IL-2, as an important member of the immune factor network, has significant antiviral effects in addition to important roles in immune response and regulation. At present, human genetic engineering recombinant IFN-alpha and IL-2 preparations are used as therapeutic drugs in the aspects of preventing and treating viral diseases, autoimmune diseases, tumors, vaccine immunity enhancement adjuvants and the like. In recent years, viral infectious diseases such as porcine pseudorabies and porcine epidemic diarrhea are seriously harmful to the pig industry, and no specific medicine for preventing and treating the viral epidemic diseases is available at present. The gene engineering technology can utilize the cell factor gene to create broad-spectrum antiviral preparation, has no residue and no side effect, and does not cause harm to human health, so the preparation becomes an ideal preparation for replacing chemically synthesized antiviral drugs. Although many researchers have studied recombinant porcine alpha interferon and interleukin 2, the combined application thereof is less studied, and the expression product exists in the form of inclusion body or the expression amount is not high, although the inclusion body protein can obtain a certain amount of protein through denaturation and renaturation, a large amount of protein loss can be caused, and the biological activity of the protein can be unstable.

Although porcine interferon expression purification studies have been performed, most of these studies are in the laboratory stage, and the antiviral activity of porcine interferon was confirmed only at the cellular level, and data on antiviral infection in swine were lacking. On the premise of not changing the original amino acid composition of the interferon, the soluble modification is carried out on the PoIFN-alpha-linker-PoIL-2 gene according to the codon preference of escherichia coli, the utilization rate of low codons is obviously reduced through gene optimization, the influence of rare codons on protein expression is avoided, the GC content of the gene is improved, the transcription and translation efficiency is improved, and the expression quantity of recombinant protein is further improved. SDS-PAGE analysis proves that the finally obtained protein is soluble protein, the expression amount accounts for more than 80% of the total protein of the thallus, and the crushed supernatant can be directly purified by nickel column affinity chromatography to obtain a large amount of protein, thereby being beneficial to large-scale production.

The adopted pET-32a (+) is an efficient prokaryotic expression vector, contains a T7 promoter and a transcription termination signal, can code 6 histidine residues, and also has an E.coli TrxA gene, wherein the TrxA gene codes thioredoxin with 109 amino acids, and after being inserted by a multiple cloning site, an exogenous gene is fused and expressed with the TrxA gene, so that the stability of an expression product can be improved, and the N-terminal of the expression protein contains 6 × histidine, so that the purification by using an affinity chromatography column is easy.

In order to express the target protein to the maximum amount in the experimental environment, the expression of recombinant bacteria rPoIFN-alpha-linker-PoIL 2-pET-32a/BL21 is optimized and analyzed from three aspects of induction time, induction temperature and IPTG concentration. IPTG is an active inducing substance of beta-galactosidase, is an inducer with extremely strong action, is not metabolized by bacteria very stably, and IPTG with high concentration has certain cytotoxicity and can induce protein to express quickly to form inclusion bodies, so that the invention discovers that the induction efficiency of IPTG on rPoIFN-alpha-linker-PoIL-2 is very high, and a better induction effect can be achieved when the concentration is 0.2 mmol/L; the growth of the escherichia coli is slow in a low-temperature environment, the protein expression speed can be reduced, the correct folding of the protein is increased, and the solubility of the protein is promoted. The invention discovers that under the same induction condition, the expression quantity of rPoIFN-alpha-linker-PoIL-2 protein in supernatant is the highest when the rPoIFN-alpha-linker-PoIL-2 protein is induced at 25 ℃, and the low temperature is favorable for soluble expression of the protein; the growth speed of escherichia coli is reduced at low temperature, and protein expression can be promoted by prolonging the induction time. Therefore, the optimal expression conditions of rPoIFN-alpha-linker-PoIL-2 protein are determined as follows: 0.2mmol/LIPTG, induced at 25 ℃ for 9h.

The invention adopts a cytopathic inhibition method to determine that rPoIFN-alpha-linker-PoIL-2 protein inhibits the proliferation activity of different viruses on different cell lines. From the perspective of biological activity, the rPoIFN-alpha-linker-PoIL-2 protein has no significant difference in the potency of inhibiting VSV proliferation activity on PK-15 and WISH cell lines, and the PK-15 cells are homologous cells, so that the PK-15 cells are selected to determine the activity of inhibiting VSV proliferation by the rPoIFN-alpha-linker-PoIL-2 protein; the potency of rPoIFN-alpha-linker-PoIL-2 protein on PK-15 cells for inhibiting SVA proliferation activity is consistent with that of VSV proliferation activity. The activity of rPoIFN-alpha-linker-PoIL-2 protein has species specificity, and has higher biological activity on homologous cells than on heterologous cells, and the titer of the rPoIFN-alpha-linker-PoIL-2 protein for inhibiting SVA proliferation activity and VSV proliferation activity on PK-15 cells is far higher than that of PEDV inhibition activity on Vero cells; the rPoIFN-alpha-linker-PoIL-2 soluble protein has higher virus proliferation inhibition activity than that of rPoIFN-alpha-linker-PoIL-2 inclusion body protein on different cell lines, and the result of an antiviral infection test shows that the rPoIFN-alpha-linker-PoIL-2 soluble protein has obvious effect of resisting PEDV virus, can protect piglets against the attack of PEDV, and achieves 5/5 protection. Lays a foundation for the scale production, popularization and application of the pig recombinant pig alpha interferon/interleukin 2 preparation.

Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.

Claims (10)

1. The recombinant porcine alpha interferon/interleukin 2 fusion protein coding gene is characterized in that the nucleotide sequence of the coding gene is shown in SEQ ID NO. 1.

2. An expression cassette comprising a promoter and a gene encoding the recombinant porcine alpha interferon/interleukin 2 fusion protein of claim 1.

3. A recombinant vector comprising the gene encoding the recombinant porcine alpha interferon/interleukin 2 fusion protein of claim 1.

4. The recombinant vector according to claim 3, wherein the vector is pET-32a vector containing the gene encoding the recombinant porcine alpha interferon/interleukin 2 fusion protein of claim 1.

5. A recombinant bacterium comprising the gene encoding the recombinant porcine alpha-interferon/interleukin 2 fusion protein of claim 1, the expression cassette of claim 2, or the recombinant vector of claim 3 or 4.

6. The recombinant bacterium according to claim 5, wherein the recombinant bacterium is Escherichia coli.

7. The use of the encoding gene of the recombinant porcine alpha interferon/interleukin 2 fusion protein of claim 1, or the expression cassette of claim 2, or the recombinant vector of claim 3 or 4, or the recombinant bacterium of claim 5 or 6 in the preparation of recombinant porcine alpha interferon/interleukin 2 fusion protein.

8. A method of producing a recombinant porcine interferon-alpha/interleukin 2 fusion protein, the method comprising: culturing the recombinant bacterium of claim 5 or 6 to express the recombinant porcine alpha interferon/interleukin 2 fusion protein.

9. The method of claim 8, wherein during the culturing process, the expression of the recombinant porcine alpha interferon/interleukin 2 fusion protein is induced by IPTG with the concentration of 0.2-1.0mmol/L and the temperature of the induction is 20-30 ℃.

10. The method according to claim 8 or 9, characterized in that the method further comprises: collecting the culture solution and purifying the recombinant porcine alpha interferon/interleukin 2 fusion protein by affinity chromatography.

Images