CN115927281A - Ssp DnaB intein and application thereof in expression and separation of transdermal peptide - Google Patents

Abstract

The invention relates to a novel Ssp DnaB intein, the sequence of which is shown in SEQ ID No. 5. Also discloses a DnaB-cTAT fusion protein, the sequence of which is shown in SEQ ID No. 1. Also discloses the coding gene, expression plasmid, prokaryotic carrier and expression separation method of the protein. The intein used in the invention is an Ssp DnaB system, and has very high intein self-cleavage activity of about 85 percent after codon optimization and point mutation. The 1 st amino acid is mutated from cysteine Cys to alanine to inactivate the self-cleaving activity of the intein N-terminus.

Description

Ssp DnaB intein and application thereof in expression and separation of transdermal peptide

Technical Field

The invention belongs to the technical field of protein engineering, and particularly relates to an Ssp DnaB intein and application thereof in expression and separation of a transdermal peptide.

Background

The synthesis of small molecule polypeptides is largely divided into chemical synthesis and biosynthesis. Chemical synthesis utilizes a solid or liquid medium to sequentially add peptide chains one by one to the synthesis intermediates. The chemical synthesis method is suitable for synthesis of dipeptide or tripeptide, but for synthesis of longer polypeptide, the problems of more reaction steps, more byproducts and intermediate products, low yield, difficult purification and the like occur. Biosynthesis is to express polypeptide fusion protein in a host by using a protein expression technology of a biological system, and then obtain target polypeptide through protein purification and polypeptide release. The method has the advantages of no influence of the length of the polypeptide and the amino acid sequence, simple and efficient synthesis of the polypeptide, few by-products and industrial synthesis of the polypeptide. However, the biosynthesis method still needs the steps of strain crushing and protein purification, greatly improves the production cost of the polypeptide, reduces the synthesis scale of the polypeptide, and is an important speed-limiting step of the biosynthesis of the polypeptide. Therefore, the development of a polypeptide production process free from bacterial cell disruption and protein purification and the improvement of the expression efficiency of the polypeptide have important values for the industrial production of the polypeptide.

The traditional penetration enhancer has the defects of easy skin allergy and inflammation generation, high concentration, toxicity and ineffectiveness to macromolecules, and needs an instrument for assistance, and the physical penetration enhancing method has high cost and is inconvenient to carry, and the stratum corneum is easy to thin after long-term use, and the skin infection is easy to cause. The biological penetration promoting technology utilizes polypeptide molecules with skin penetration capacity, about 10-30 amino acids, and can effectively promote the penetration of macromolecules. The transdermal peptide has the advantages of no irritation, no skin allergy or injury, good compatibility between the medicine and the material, stable physicochemical property, quick action and long action time. Transdermal peptides are of many types, and TAT is most widely used for its low toxicity and high cell penetration. And backbone cyclization contributes to improved metathesis ability.

The purification of transdermal peptide after biosynthesis is difficult, the purification efficiency of transdermal peptide under the existing purification conditions is low, the purification amount is small, the nonspecific band is large, and the subsequent identification and transdermal effect experiment are difficult to perform.

The separation and purification of proteins is complicated, and proteins extracted from cells or proteins obtained from a solution containing proteins by precipitation, gradient centrifugation, salting out, etc. often contain impurities, which are removed while maintaining the biological activity of the proteins.

Affinity chromatography is the most commonly used method for protein purification. Which is retained based on specific binding of the target protein to the immobilized ligand, and other hetero proteins flow through the column. The method has the following problems: monoclonal antibodies are very expensive and need to be purified first; the monoclonal antibody has too strong binding force with the target protein, and the elution is carried out under harsh conditions, which can inactivate the target protein and destroy the monoclonal antibody; other proteins in the mixture, such as proteases, may also destroy the antibodies or bind them non-specifically; some mabs also dissociate from the resin during purification and become incorporated into the product, which also needs to be removed from the final product. The affinity column is typically applied at a later stage in the purification process when the specimen volume has been reduced and most of the impurities have been removed.

Glutathione S-transferase (GST) is one of the most commonly used affinity chromatography purification tags, and recombinant proteins bearing this tag can be purified using a Glutathione-cross-linked chromatography medium, but this method has the following disadvantages: first, the GST on the protein must fold properly to form a spatial structure that binds glutathione for purification by this method; secondly, the GST tag has up to 220 amino acids, and such a large tag may affect the solubility of the expressed protein, so that inclusion bodies are formed, which may destroy the natural structure of the protein, make structural analysis difficult, and sometimes even if the GST tag is removed by enzyme digestion after purification, the problem cannot be solved.

Another applicable affinity purification tag is a 6 histidine tag, wherein the imidazole side chain of histidine can be in affinity binding with metal ions such as nickel, zinc and cobalt, the target protein with the histidine tag is bound with a nickel column under neutral and weakly alkaline conditions, and the target protein is competitively eluted by imidazole at low pH. Histidine tags have many advantages over GST, firstly, since there are only 6 amino acids and the molecular weight is small, it is generally necessary to remove by enzymatic cleavage: secondly, the protein can be purified under the denaturation condition, and the binding force can still be kept in high-concentration urea and guanidine; in addition, the 6 histidine tag has no immunogenicity, and the recombinant protein can be directly used for injecting animals without influencing immunological analysis. Despite these advantages, the tag has disadvantages, such as easy formation of inclusion bodies in the target protein, difficulty in dissolution, poor stability, and misfolding. When the nickel column is used for purification, metal nickel ions are easy to fall off, leak out and mix into protein solution, not only can the amino acid side chain of target protein be damaged through oxidation, but also the column can nonspecifically adsorb protein, and the purification effect is influenced.

Most of the target proteins are fused and expressed together with protein tags, so that the target proteins can be conveniently expressed, detected, traced, purified and the like. Generally, in order not to affect the subsequent use of the target protein, a certain mode is selected to remove various labels on the expression band. Therefore, a protease recognition site can be added between the protein and the foreign protein when a vector is designed and constructed, so that the target protein fused with the tag is obtained by expression and purification, and then the tag is removed by means of protease digestion to obtain the complete target protein. Commonly used protease cleavage sites are: HRV 3C protein restriction enzyme cutting sites, TEV protein restriction enzyme cutting sites, intestinal kinase cutting sites, SUMO protein restriction enzyme cutting sites and the like. Although these cleavage sites are highly specific, the cleavage efficiency varies, and several amino acid residues remain after cleavage of the tag by commonly used proteases. And the cleavage efficiency of the protease is also influenced by the nature of the amino acid residues in the vicinity of the recognition site. The combined consideration of these factors increases the difficulty and complexity of carrier design, and the obtaining of highly pure and active protein requires a great deal of effort and cost.

The splicing reaction of inteins is a spontaneous process that does not require enzymatic catalysis. It is completed by 4 steps of nucleophilic reaction, including: 1) An N-S acyl rearrangement; 2) Transesterification reaction; 3) Cyclization of end amino acid Asn; 4) S-N acyl rearrangement. Compared with other affinity purification systems (such as immunoaffinity chromatography and metal chelating affinity chromatography), the intein-mediated affinity purification system can induce the occurrence of a cleavage reaction, so that the cleavage reaction can remove a purification tag during the purification process and obtain a target protein without any foreign sequence. Meanwhile, the trouble of using other means to remove the purification label is avoided.

Disclosure of Invention

The invention aims to provide an Ssp DnaB intein, the sequence of which is shown as SEQ ID No.5, the Ssp DnaB intein has high self-cleavage activity, and is particularly suitable for preparing small molecular polypeptides with the amino acid number of less than 50.

The invention also discloses a DnaB-cTAT fusion protein, the sequence of which is shown as SEQ ID No.1, and the cTAT can be efficiently expressed and separated through an intein self-cleavage system, so that the production cost of the cTAT is reduced.

The invention also discloses a coding gene of the DnaB-cTAT fusion protein, and the sequence of the coding gene is shown as SEQ ID No. 2.

The invention also discloses a pET28a-DnaB-cTAT expression plasmid for expressing the DnaB-cTAT fusion protein.

The invention also discloses a prokaryotic expression vector of the DnaB-cTAT fusion protein.

Preferably, the expression plasmid is pET28a-DnaB-cTAT described above, and is transformed into an E.coli host bacterium.

The invention also discloses an expression separation method of cTAT, which is characterized by comprising the following steps:

(1) Constructing pET28a-DnaB-cTAT expression plasmid;

(2) Transforming the pET28a-DnaB-cTAT expression plasmid into an escherichia coli BL21 (DE 3) host bacterium; selecting positive clones;

(3) Culturing positive clones, and inducing the expression of cTAT;

(4) Separating and purifying the cTAT.

Preferably, the specific method for constructing the pET28a-DnaB-cTAT expression plasmid in the step (1) is as follows:

A. and (2) amplifying pET28a exoskeletons by taking the plasmid pET28a as a template and pET28a-F, pET a-R as a primer, wherein the pET28a-R: tcgccagagatagcgtgatggtgatgatgatgatgatggctg (SEQ ID No. 3)

pET28a-F：cgtcgtcagatggaagaataactcgagcaccaccaccaccaccac(SEQ ID No.4)；

B. Synthesizing a DnaB-cTAT fragment;

C. pET28a exoskeletons and DnaB-cTAT fragments are mixed evenly, and pET28a-DnaB-cTAT expression plasmids are obtained by a seamless cloning method.

Preferably, the separated and purified cTAT in the step (4) is specifically: and centrifuging to obtain thalli after induced expression, re-suspending the thalli in a dissolving buffer solution, crushing, centrifuging to obtain a supernatant, purifying the supernatant by a Ni column, collecting flow-through liquid, adding an elution buffer solution to adjust the pH value of the flow-through liquid so that the flow-through liquid is acidic, cutting the intein DnaB and the transdermal peptide cTAT fusion protein, and collecting the cut eluent containing the cTAT fusion protein.

Preferably, the dissolution buffer is 20mM Tris.HCl,300mM NaCl, pH =8.0.

Preferably, the elution buffer is 20mM Tris.HCl,300mM NaCl, pH =6.0.

Drawings

FIG. 1 is a photograph of PCR products electrophoresis, wherein lanes 1 and 7 are marker, lanes 2, 3, 4 and 5 are PCR amplified transdermal peptide fragments, and 8,9 is a cloning vector fragment containing intein DnaB.

FIG. 2 is a photograph of DH5a competent screening positive transformants obtained by seamless cloning and ligating a vector fragment containing intein DnaB with a transdermal peptide gene fragment.

FIG. 3 is a photograph of plasmid transfection competence screening positive transformants for intein DnaB-transdermal peptide fusion expression vector.

FIG. 4 is an electrophoresis chart of SDS-PAGE detecting the expression of intein DnaB-transdermal peptide fusion protein. Lane 1 is marker, 2, 3, 4 are uninduced, and 5, 6 are induced.

FIG. 5 shows the results of HPLC detection of transdermal peptides purified by intein-mediated affinity purification system.

Detailed Description

The invention is further illustrated by the construction and validation of an expression isolation system for cTAT, and these specific examples should not be construed as in any way limiting the scope of the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1

1. Construction of transdermal-endo-cleavage peptide expression vector

pET28a is taken as a vector to construct a DnaB-cTAT fusion expression vector, a target gene fragment and a pET28a recombinant vector obtained by PCR amplification are seamlessly cloned and connected, and the electrophoresis result is shown in figure 1. Transforming the recombinant product into DH5 alpha competence and coating, selecting positive clone bacterial colonies, carrying out PCR identification and amplification on fragments containing target genes by using universal primers T7 and T7ter, selecting 4-10 positive clone bacterial colonies which are identified by PCR and accord with a theoretical molecular weight band, and sequencing, wherein the comparison consistency of a sequencing result and a target fragment sequence reaches 100%, as shown in figure 2. The plasmid pET28a-DnaB-cTAT vector transforms BL21 DE3 competent, kana resistance selection successfully transferred into the recombinant plasmid into the positive clone colony, as shown in FIG. 3.

2. Induction of expression of the intein DnaB-transdermal peptide

Inoculating the single colony cultured by selecting and streaking into 3 ml-5 ml LB liquid culture medium (adding 50mg/ml of antibiotic kana), shaking and culturing at 37 ℃ for 3 h-12 h to detect the OD value of 0.2-1.0, diluting with fresh culture medium according to the ratio of 1-10-1.

3. Mediated purification of transdermal peptides using intein-mediated affinity purification system

1) Collecting bacterial liquid, centrifuging at 8000r/min and 4 deg.C for 10min, discarding supernatant, and collecting bacterial precipitate;

2) Lysis buffer (20mM Tris.HCl,300mM NaCl, pH = 8.0) was added at a ratio of 1;

3) Ultrasonic (60% power, 5s ultrasonic stopping 5s ultrasonic crushing 10 min), high pressure crushing to crack thallus, centrifuging at 8000rpm and 4 deg.C for 30min to separate supernatant and precipitate, and detecting the supernatant by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), with the result shown in FIG. 4; the obtained supernatant is used for recombinant protein purification;

4) Passing the supernatant through a nickel column, filling NiIDA Beads into a proper chromatographic column (the loading amount is more than or equal to 40 mg/ml) or using a pre-packed column, and washing the filler by deionized water with the volume of 10 times that of the nickel column to remove alcohol;

5) Balancing the nickel column with lysine buffer in 5 times the volume of the nickel column;

6) Transferring the supernatant into a chromatographic column, and carrying out mild shaking on ice for 1h (or repeatedly passing the supernatant obtained in the step 3 through the column for 5 times) to fully combine the recombinant protein with Ni & lt 2+ >

7) Adding the mixed solution into a suspended and vertically fixed purification column, and standing for 10min until the filler Ni-NTA is settled at the bottom of the column; opening the covers at the top and the bottom of the tube in sequence, allowing the liquid to flow down naturally, and collecting the flow-through liquid FT;

8) Cutting intein and transdermal peptide fusion protein by adjusting the pH value of a buffer solution to be acidic by 10 times of volume wash buffer (20mM Tris.HCl,300mM NaCl, pH = 6.0), and collecting the cut eluent containing the transdermal peptide fusion protein;

9) HPLC is used to detect the transdermal peptide in the eluate collected in the previous step, and the result is shown in FIG. 5.

Claims (13)

1. An ssp DnaB intein characterised in that it has the sequence shown in SEQ ID No. 5.
2. 2. Use of the Ssp DnaB intein of claim 1 for expressing an isolated small molecule polypeptide.
3. 3. The use according to claim 2, wherein the number of amino acids in said small molecule polypeptide is less than 50.
4. 4. A DnaB-cTAT fusion protein is characterized in that the sequence of the fusion protein is shown as SEQ ID No. 1.
5. 5. The gene encoding a DnaB-cTAT fusion protein of claim 4, having a sequence as shown in SEQ ID No. 2.
6. 6. A pET28a-DnaB-cTAT expression plasmid expressing the DnaB-cTAT fusion protein of claim 4.
7. 7. A prokaryotic expression vector of the DnaB-cTAT fusion protein of claim 4.
8. 8. The prokaryotic expression vector according to claim 4, characterized in that the expression plasmid pET28a-DnaB-cTAT of claim 6 is transformed into host bacteria of Escherichia coli.
9. 9. An expression and separation method of a transdermal peptide cTAT is characterized by comprising the following steps:

   (1) Constructing pET28a-DnaB-cTAT expression plasmid;

   (2) Converting the pET28a-DnaB-cTAT expression plasmid into an escherichia coli host bacterium; selecting positive clones;

   (3) Culturing positive clones, and inducing the expression of cTAT;

   (4) Separating and purifying cTAT.
10. 10. The method for the isolation of expression of claim 9, wherein: the specific method for constructing the pET28a-DnaB-cTAT expression plasmid in the step (1) comprises the following steps:

    A. amplifying a pET28a exoskeleton by taking a plasmid pET28a as a template and pET28a-F, pET a-R as a primer;

    B. synthesizing a DnaB-cTAT fragment;

    C. after the pET28a exoskeletons and the DnaB-cTAT fragments are mixed evenly, pET28a-DnaB-cTAT expression plasmids are obtained by a seamless cloning method.
11. 11. The method for the isolation of expression of claim 9, wherein: the step (4) of separating and purifying cTAT specifically comprises the following steps: and centrifuging to obtain thalli after induced expression, re-suspending the thalli in a dissolving buffer solution, crushing, centrifuging to obtain a supernatant, purifying the supernatant by a Ni column, collecting flow-through liquid, adding an elution buffer solution to adjust the pH value of the flow-through liquid so that the flow-through liquid is acidic, cutting the intein DnaB and the transdermal peptide cTAT fusion protein, and collecting the cut eluent containing the cTAT fusion protein.
12. 12. The method for the isolation of expression of claim 11, wherein: the dissolution buffer was 20mM Tris.HCl,300mM NaCl, pH =8.0.
13. 13. The method for the isolation of expression of claim 8, wherein: the elution buffer was 20mM Tris.HCl,300mM NaCl, pH =6.0.

Images