CN115925704B - Method for detecting thrombin based on perylene derivative probe without marking - Google Patents
Method for detecting thrombin based on perylene derivative probe without marking Download PDFInfo
- Publication number
- CN115925704B CN115925704B CN202211542418.6A CN202211542418A CN115925704B CN 115925704 B CN115925704 B CN 115925704B CN 202211542418 A CN202211542418 A CN 202211542418A CN 115925704 B CN115925704 B CN 115925704B
- Authority
- CN
- China
- Prior art keywords
- thrombin
- perylene derivative
- aptamer
- buffer solution
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The application discloses a method for detecting thrombin based on a perylene derivative probe label-free in the technical field of biological analysis, which comprises the following steps: adding the reaction system into a detection system, detecting the fluorescence intensity by using a fluorescence spectrometer, and obtaining the concentration of thrombin through the fluorescence intensity; the detection system consists of a perylene derivative probe, a polycation polymer solution and a buffer solution, and the reaction system consists of thrombin, thrombin nucleic acid aptamer (ssDNA), thrombin aptamer complementary strand (C-ssDNA), exonuclease III, a solvent and the buffer solution. The method has the advantages of low cost of required materials, no need of fluorescent marking, no need of large-scale instrument, convenience, high efficiency, simple operation, mild reaction conditions, good stability, high sensitivity, good linear response within the range of 0-13.5 nM and low detection limit of 270pM.
Description
Technical Field
The invention relates to the technical field of biological analysis, in particular to a method for detecting thrombin based on a perylene derivative probe without marking.
Background
Thrombin is a serine proteolytic enzyme formed from thrombin precursors, and participates in the coagulation cascade, catalyzing the conversion of soluble fibrin into insoluble fibrin, playing an important role in blood coagulation and regulating coagulation. Therefore, quantitative detection of thrombin levels is of great importance.
In the prior art, there are many commonly used means for detecting thrombin, such as fluorescence spectroscopy, surface enhanced raman scattering, electrochemical sensors, chemiluminescent aptamer sensors, colorimetric sensors, and the like. Among them, the detection method based on fluorescence spectroscopy is increasingly used in biological analysis and biological sensing due to its advantages of simplicity, sensitivity, rapidness, wide detection range, etc. Jin et al,2021 constructed a fluorescence detection method for thrombin recognition with an aptamer (Microchemical Journal,2021,160: 105649.). Yu et al 2021 developed a novel fluorescent sensor array based on cationic polymer-induced perylene probe self-assembly to distinguish between different concentrations of adulterated milk with 100% cross-validation accuracy (Food Chemistry,2021, 343:128492.).
The aptamer is a DNA or RNA oligonucleotide fragment obtained by in vitro screening by a ligand index enrichment system evolution technology (Systematic evolution of ligands by exponential enrichment, SELEX), is also called as a chemical antibody, and can recognize multiple targets such as metal ions, small molecules, polypeptides, proteins, cell surface antigens, even whole cells and the like with high specificity. Compared with antibodies, the aptamer has the advantages of small size, easiness in synthesis, easiness in modification, high stability, wide ligand range, low toxicity, low immunogenicity, stronger tissue penetrability, flexibility in design and the like, and has been widely applied to various aspects of disease diagnosis, biosensors, aptamer medicaments and the like. Similarly, a variety of thrombin nucleic acid aptamers have been screened for effective recognition of thrombin.
However, most of the methods for detecting enzyme activities reported at present have the disadvantages of requiring fluorescent labeling, poor stability, high cost and the like.
Disclosure of Invention
Aiming at the defects of the prior art, the invention designs a method for detecting thrombin based on a perylene derivative probe without marking.
One of the purposes of the invention is to provide an application of a perylene derivative probe in detecting thrombin, wherein the perylene derivative probe is N, N' -di (L-alanine group) perylene diimide (named as ProbeA), and the structural formula is shown as follows:
the second object of the invention is to provide a method for detecting thrombin based on perylene derivative probe without labeling, which is characterized by comprising the following steps:
adding a thrombin-containing object to be detected into a reaction system, adding the reaction system into a detection system, detecting the fluorescence intensity by using a fluorescence spectrometer, and obtaining the concentration of thrombin through the change of the fluorescence intensity;
the reaction system comprises thrombin nucleic acid aptamer (ssDNA), thrombin aptamer complementary strand (C-ssDNA), exonuclease III, a solvent and a buffer solution which are mixed;
the detection system is formed by mixing a perylene derivative probe with negative charges, a polycation polymer with positive charges, a solvent and a buffer solution;
in the detection system, the structural formula of the perylene derivative probe with negative charges is as follows:
wherein, in the detection system, the structural formula of the positively charged polycation polymer is as follows:
wherein n=100 to 2000.
3051-89-4, product number 479144, molecular weight 65000, n=1140;
CAS No. 3051-89-4, product number 479136, molecular weight 17000, n=298; CAS No. 3051-89-4, product number 479136, molecular weight 15000, n=263.
Further, the object to be detected is an aqueous solution, serum, saliva or cell lysate.
Further, in the detection system, the concentration of the perylene derivative probe is 5nM to 1. Mu.M.
Further, in the detection system, the concentration of the polycationic polymer is 0.01 to 50nM. The concentration is preferably 0.01 to 20nM.
Further, in the reaction system, the concentration of thrombin aptamer is 0.1nM to 50nM. The concentration is preferably 1nM to 20nM.
Further, in the reaction system, the concentration of the complementary strand of the thrombin nucleic acid aptamer is 0.1nM to 100nM. The concentration is preferably 1nM to 50nM.
Further, the sequence of the thrombin nucleic acid aptamer is: GGTTGGTGTGGTTGG, AGTCCGTGGTAGGGCAGGTTGGGGTGACT, ATAGGTTGGTGTGGGTTGG, CTATCAGTCCGTGGTAGGGCAGGTTGGGGTGACT or GGTTGGTGTGGTTGGTGTGGTTGG. The sequence of the thrombin aptamer complementary strand is: AACCACACCAA, TCACCCCAACCTGCCCTACCACGGA, AACCCACACCAACCT, TCACCCCAACCTGCCCTACCACGGACTGAT or AACCACACCAACCACACCAA.
Further, the solvent is water or an organic solvent, and the buffer solution is Tris-HCl buffer solution, PBS buffer solution, MOPS buffer solution or HEPES buffer solution. The solvent is preferably water or an organic solvent, and the buffer is preferably Tris-HCl buffer.
Further, in the reaction system, the concentration of the exonuclease III is 0.1 to 1U/. Mu.L. The concentration is preferably 0.2 to 0.4U/. Mu.L.
Further, the thrombin concentration is measured at 0 to 13.5nM.
The invention principle is as follows: (1) The perylene derivative probe monomer with negative charges shows strong fluorescence in an aqueous solution, and the fluorescence intensity of the aggregated perylene derivative probe is reduced. After adding the polycationic polymer with positive charges to the solution of the perylene derivative probe, strong static electricity, hydrophobicity and interaction lead to the aggregation of the perylene probe, and the fluorescence of the perylene derivative probe is effectively quenched. When single-stranded DNA such as ssDNA, C-ssDNA, etc. is added to a solution of the polymer-perylene derivative probe, the strong electrostatic attractive interaction between the polymer and the single-stranded DNA weakens the binding of the perylene derivative probe aggregates to the polycationic polymer. The released perylene derivative probe then assumes a monomeric state in aqueous solution and an enhanced fluorescent signal is detected by a fluorescence spectrometer. (2) When thrombin is not added, the thrombin aptamer and the thrombin aptamer complementary strand form a double chain through the base complementation principle, and the exonuclease III can cut off the thrombin aptamer complementary strand, only the thrombin aptamer is left, and a sufficient amount of DNA is not complexed with the polycation polymer, and the perylene derivative probe is still combined with the polycation polymer to be in an aggregation state, so that fluorescence quenching is caused. (3) When thrombin is added, the thrombin aptamer and thrombin are preferentially combined together due to high affinity of the thrombin aptamer and thrombin, so that the thrombin aptamer and the complementary strand of the thrombin aptamer cannot be combined together, the complementary strand of the thrombin aptamer cannot be cut off by adding exonuclease III, the complementary strand of the thrombin aptamer can be combined with a polycationic polymer, and the perylene derivative probe is in a monomer state, and the fluorescence intensity is recovered. In short, the fluorescent intensity is lower when thrombin exists, and the fluorescent intensity is higher when thrombin does not exist.
Compared with the prior art, the invention has the beneficial effects that:
the method for detecting thrombin based on perylene derivative probe without marking can quantitatively detect thrombin by adopting a method without marking, and has the advantages of low cost of required materials, no need of large-scale instruments, convenience, high efficiency, simple construction method, basically no toxicity, mild reaction condition, good selectivity, good stability, high sensitivity, good linear response within the range of 0-13.5 nM and detection limit as low as 270pM.
The detection method has stronger specificity, and the perylene derivative probe does not directly interact with the aptamer, so the phenomenon that false positive fluorescent signals are easy to generate as long as substances capable of cutting off the aptamer or carrying out electrostatic and other non-specific binding with the aptamer exist is avoided.
Drawings
FIG. 1 is a schematic diagram of a method for label-free detection of thrombin based on perylene derivative probes in accordance with the present invention.
FIG. 2 is a plot of the response of the addition of different concentrations of polycation (ploycation) polymer to perylene derivative probes in example 1 of the present invention.
FIG. 3 shows the fluorescence intensity change of the detection system of the perylene derivative probe and the polycationic polymer after cleavage with different cleavage times (Time) after thrombin, thrombin aptamer complementary strand and addition of exonuclease III in example 2 of the present invention.
FIG. 4 is a graph showing the response of the addition of Thrombin (Thrombin) at various concentrations to the assay system in example 3 of the present invention.
FIG. 5 is a schematic diagram showing the specificity of the detection system for thrombin in example 4 of the present invention.
Detailed Description
Further details are provided below with reference to the specific embodiments.
In the following technical schemes, perylene derivative probes, polycationic polymers, thrombin aptamer complementary strand, exonuclease III, solvents and buffers are all commercially available.
Fig. 1 is a principle of a method for detecting thrombin based on a perylene derivative probe without marking, and english notes of the method are respectively as follows: thrombin (Thrombin), thrombin aptamer (Thrombin aptamer), thrombin aptamer complementary strand (Thrombin aptamer complementary chain), polycation (ploycation) polymer, perylene derivative probe (ProbeA), exoenzyme III (exoIII).
Example 1:
the perylene derivative probe A (N, N' -di (L-alanine group) perylene diimide) solution (the solvent is water), the polycation polymer (n=298) solution (the solvent is water), water and Tris-HCl buffer solution (5mM Tris,5mM NaCl,pH7.4) are mixed to obtain a detection system with the final concentration of the perylene derivative probe of 50nM and the final concentration of the polycation polymer of 0 nM-1.6 nM, and the fluorescence intensity is detected by a fluorescence spectrometer.
FIG. 2 is a graph showing the response of the addition of different concentrations of polycationic polymer to perylene derivative probe A in example 1 of the present invention, as can be seen from FIG. 2, the fluorescence intensity of the perylene derivative probe gradually decreases as the addition concentration of polycation increases from 0 to 1.6nM, and then reaches the plateau, the concentration of polycationic polymer preferably being 1nM.
Example 2:
mixing perylene derivative probe A (N, N' -di (L-alanine group) perylene diimide) solution (the solvent is water), polycation polymer (n=298) solution (the solvent is water), water and Tris-HCl (5mM Tris,5mM NaCl,pH 7.4) buffer solution to obtain a detection system with the final concentration of perylene derivative probe of 50nM and the concentration of polycation polymer of 1nM, and then mixing thrombin, 2nM thrombin aptamer and thrombin aptamer (ssDNA) as follows: AGTCCGTGGTAGGGCAGGTTGGGGTGACT,10nM thrombin aptamer complementary strand, thrombin aptamer complementary strand (C-ssDNA): TCACCCCAACCTGCCCTACCACGGA, mixing 0.2U/. Mu.L of exonuclease III, and then performing enzyme digestion in a water bath at 37 ℃ for 0min, 15min, 30min, 45min and 60min respectively to form a reaction system, and then adding the reaction system into a detection system to detect the fluorescence intensity of the reaction system by using a fluorescence spectrometer.
FIG. 3 shows the effect of different cleavage times in the reaction system of example 2 of the present invention on the change of fluorescence intensity in the detection system, and it can be seen from FIG. 3 that the cleavage time of exonuclease III is optimal for 30 min.
Example 3:
the perylene derivative probe A (N, N' -di (L-alanine group) perylene diimide) solution (the solvent is water), the polycation polymer solution (the solvent is water), the water and Tris-HCl (5 mM Tris-HCl,5mM NaCl,pH 7.4) buffer solution are mixed to obtain a detection system with the final concentration of the perylene derivative probe of 50nM and the final concentration of the polycation polymer of 1nM, and thrombin with different concentrations (0, 0.34nM, 0.68nM, 1.01nM, 1.35nM, 3.38nM, 6.75nM, 10.13nM, 13.5 nM), 2nM thrombin aptamer and thrombin aptamer (ssDNA) are: AGTCCGTGGTAGGGCAGGTTGGGGTGACT,10nM thrombin aptamer complementary strand, thrombin aptamer complementary strand (C-ssDNA) is: TCACCCCAACCTGCCCTACCACGGA,10nM thrombin aptamer complementary strand, 0.2U/. Mu.L exonuclease III is mixed and then digested in a water bath at 37 ℃ for 30min to form a reaction system, and then added into a detection system, and the fluorescence intensity is detected by a fluorescence spectrometer.
FIG. 4 is the presentResponse curves for thrombin at various concentrations added to the assay system in inventive example 3. As can be seen from FIG. 4, the fluorescence of the detection system increases with increasing thrombin concentration, R 2 The detection system has good linear relation with fluorescence intensity and small data deviation in the range of 0-13.5 nM, and the detection limit is as low as 270pM. The sensor array has higher reproducibility and stability in the aspect of detecting thrombin.
Example 4:
the perylene derivative probe A (N, N' -di (L-alanine group) perylene diimide) solution (the solvent is water), the polycation polymer solution (the solvent is water), the water and the Tris-HCl (5 mM Tris-HCl,5mM NaCl,pH 7.4) buffer solution are mixed to obtain a detection system with the final concentration of the perylene derivative probe of 50nM and the final concentration of the polycation polymer of 1nM. Thrombin (Thrombin), trypsin (papain), CEA (carcinoembryonic antigen), lysozyme (Lysozyme) and all proteases were added separately and mixed together, 2nM Thrombin aptamer, thrombin aptamer (ssDNA) as: AGTCCGTGGTAGGGCAGGTTGGGGTGACT,10nM thrombin aptamer complementary strand, thrombin aptamer complementary strand (C-ssDNA) is: TCACCCCAACCTGCCCTACCACGGA, mixing 0.2U/. Mu.L of exonuclease III, and then adding the mixture into a detection system after the enzyme digestion time of the mixture in a water bath kettle at 37 ℃ is 30 minutes to detect the fluorescence intensity of the mixture by using a fluorescence spectrometer.
Fig. 5 shows the specific detection of thrombin by the sensor array for label-free detection of thrombin based on perylene derivative probe according to the present invention, and the english notes are respectively: blank (Blank), thrombin (Thrombin), papain (Trypsin), carcinoembryonic antigen (CEA), lysozyme (Lysozyme), and all proteases were mixed (mix). As can be seen from fig. 5, only the thrombin group showed a 14-fold increase in fluorescence relative to the blank group, the mixed group showed little difference in fluorescence from the thrombin group, and the other groups showed no significant difference from the control group, indicating that the presence of interfering proteins in the detection system did not affect the detection of thrombin.
The foregoing is merely exemplary embodiments of the present invention, and specific structures and features that are well known in the art are not described in detail herein. It should be noted that modifications and improvements can be made by those skilled in the art without departing from the structure of the present invention, and these should also be considered as the scope of the present invention, which does not affect the effect of the implementation of the present invention and the utility of the patent. The protection scope of the present application shall be subject to the content of the claims, and the description of the specific embodiments and the like in the specification can be used for explaining the content of the claims.
Claims (5)
1. A method for detecting thrombin based on perylene derivative probe label-free, which is characterized by comprising the following steps:
adding a thrombin-containing object to be detected into a reaction system, adding the reacted system into a detection system, detecting the fluorescence intensity by using a fluorescence spectrometer, and obtaining the concentration of thrombin through the change of the fluorescence intensity;
the reaction system comprises thrombin nucleic acid aptamer (ssDNA), thrombin aptamer complementary strand (C-ssDNA), exonuclease III, a solvent and a buffer solution which are mixed;
the detection system is formed by mixing a perylene derivative probe with negative charges, a polycation polymer with positive charges, a solvent and a buffer solution;
in the detection system, the structural formula of the perylene derivative probe with negative charges is as follows:
in the detection system, the concentration of the perylene derivative probe is 5-nM-1 mu M; the concentration of the polycation polymer is 0.01-50 nM; in the reaction system, the concentration of thrombin aptamer is 0.1-nM-50 nM; the concentration of the complementary strand of thrombin aptamer is 0.1. 0.1 nM-100. 100nM.
2. The method according to claim 1, characterized in that: the object to be detected is aqueous solution, serum, saliva or cell lysate.
3. The method according to claim 1, characterized in that: the thrombin nucleic acid aptamer has the sequence as follows: GGTTGGTGTGGTTGG, AGTCCGTGGTAGGGCAGGTTGGGGTGACT, ATAGGTTGGTGTGGGTTGG, CTATCAGTCCGTGGTAGGGCAGGTTGGGGTGACT or GGTTGGTGTGGTTGGTGTGGTTGG.
4. The method according to claim 1, characterized in that: the solvent is water or an organic solvent, and the buffer solution is Tris-HCl buffer solution, PBS buffer solution, MOPS buffer solution or HEPES buffer solution.
5. The method according to any one of claims 1 to 4, wherein: the concentration of thrombin detected is 0 to 13.5. 13.5nM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211542418.6A CN115925704B (en) | 2022-12-02 | 2022-12-02 | Method for detecting thrombin based on perylene derivative probe without marking |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211542418.6A CN115925704B (en) | 2022-12-02 | 2022-12-02 | Method for detecting thrombin based on perylene derivative probe without marking |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115925704A CN115925704A (en) | 2023-04-07 |
| CN115925704B true CN115925704B (en) | 2023-06-30 |
Family
ID=86697374
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211542418.6A Active CN115925704B (en) | 2022-12-02 | 2022-12-02 | Method for detecting thrombin based on perylene derivative probe without marking |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115925704B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115436335B (en) * | 2022-09-16 | 2023-08-25 | 遵义医科大学 | Method for detecting thrombin based on perylene derivative probe without marking |
-
2022
- 2022-12-02 CN CN202211542418.6A patent/CN115925704B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN115925704A (en) | 2023-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Ultrasensitive colorimetric detection of protein by aptamer–Au nanoparticles conjugates based on a dot-blot assay | |
| Gao et al. | Exonuclease I-assisted general strategy to convert aptamer-based electrochemical biosensors from “signal-off” to “signal-on” | |
| Liu et al. | A novel aptamer-mediated CuInS 2 quantum dots@ graphene oxide nanocomposites-based fluorescence “turn off–on” nanosensor for highly sensitive and selective detection of kanamycin | |
| CN109116040B (en) | Method for detecting cocaine based on dimercapto aptamer | |
| Ma et al. | Structure-switching fluorescence aptasensor for sensitive detection of chloramphenicol | |
| EP3841218B1 (en) | Nucleic acid based detection methods | |
| CN107841527A (en) | It is a kind of to utilize aptamer and the fluorescence detection method of magnetic material detection fibrin ferment | |
| Kivirand et al. | Biosensors for the detection of antibiotic residues in milk | |
| CN112893864A (en) | Silver nanocluster prepared based on hairpin template and application of silver nanocluster in chloramphenicol detection | |
| Chen et al. | Cascade signal amplification strategy by coupling chemical redox-cycling and Fenton-like reaction: Toward an ultrasensitive split-type fluorescent immunoassay | |
| Peng et al. | An innovative “unlocked mechanism” by a double key avenue for one-pot detection of microRNA-21 and microRNA-141 | |
| Xie et al. | Rational design of an allosteric G-quadruplex aptamer probe for ultra-sensitive detection of melamine in milk | |
| ATE383389T1 (en) | PHOTO-GRAPTING ELECTROPOLYMERS, THEIR PRODUCTION AND THEIR USE AS SUPPORTS FOR DETECTION PROBE SPECIFICALLY IN BIOSENSOR SYSTEMS | |
| CN110553991B (en) | Biological/chemical detection reagent and detection method based on hollow gold nanoparticle-DNA compound | |
| CN115925704B (en) | Method for detecting thrombin based on perylene derivative probe without marking | |
| CN115436335B (en) | Method for detecting thrombin based on perylene derivative probe without marking | |
| Li et al. | Ultrasensitive detection of microRNAs based on click chemistry-terminal deoxynucleotidyl transferase combined with CRISPR/Cas12a | |
| Zhang et al. | Dual-target nucleic acid sequences responsive electrochemiluminescence biosensor using single type carbon dots as probe for SARS-CoV-2 detection based on series catalytic hairpin assembly amplification | |
| CN113549678B (en) | Method and kit for detecting biomolecules based on fluorescence or naked eyes of split-type G-quadruplex nuclease | |
| Huang et al. | Ultrasensitive detection of microRNA-21 in human serum based on the confinement effect enhanced chemical etching of gold nanorods | |
| CN113969308A (en) | Nucleic acid detection method based on gene editing and flow analysis technology | |
| CN103399005A (en) | Method for determining lysozyme based on interaction between carboxylation carbon nanoparticles and DNA (Deoxyribose Nucleic Acid) | |
| Davis et al. | General introduction to biosensors and recognition receptors | |
| US20080044805A1 (en) | Biopolymer-Dye Complex and Use as a Bioassay | |
| US20220049258A1 (en) | Aptamer against irinotecan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |