CN115918676A - Brevibacillus halotolerans strain and application thereof in preparation of biocontrol microbial inoculum - Google Patents

Abstract

The invention discloses a biocontrol microbial inoculum of Brevibacillus halotolrans with strain number of Z-9 and application thereof, wherein the biocontrol microbial inoculum belongs to a new bacterium Brevibacillus halotolrans Z-9 in the salt-tolerant Brevibacillus genus obtained by separating rhizosphere soil of Xinjiang Tushuke, aral cotton and red dates, the diameters of inhibition zones of the strain Z-9 against Zaocys nigrospora piricola and Verticillium dahliae are 23.32mm and 25.68mm respectively, the biocontrol microbial inoculum contains catechol type siderophore which is negative and contains hydroxamic acid, the minimum value of As/Ar ratio is 0.682 +/-0.021, and the iron production capacity is highest. When the biocontrol microbial inoculum prepared by the strain Z-9 is applied to a field, the disease indexes of cotton verticillium wilt and jujube black spot are reduced to 7.14 and 8.34 respectively, and the control effect is as high as 78.07%. The Brevibacillus halotolerans Z-9 strain and the biocontrol microbial inoculum prepared by the strain have high efficiency on the jujube black spot and the cotton verticillium wilt, have no toxic or pathogenic side effects and the like, and have wide application value on the biological control of the jujube black spot and the cotton verticillium wilt.

Description

Brevibacillus halotolerans strain and application thereof in preparation of biocontrol microbial inoculum

The invention relates to a divisional application named as Brevibacillus halotolerans and application thereof in preparing a bio-control microbial agent, which is applied by an applicant at 10/19/2021, wherein the application date of the original application is 10/19/2021, the application number is 202111218751.7, and the invention is named as Brevibacillus halotolerans and application thereof in preparing the bio-control microbial agent.

Technical Field

The invention relates to the technical field of microbial strains and application thereof, in particular to a novel Brevibacillus halotolerans Z-9 strain in salt-tolerant Brevibacillus and the technical field of application of a biocontrol bacterium agent prepared by the same in preparation of a medicament for preventing and treating cotton verticillium wilt and date fruit black spot.

Background

The verticillium wilt of cotton was first reported in 1914 in Virginia, and then spread to dozens of countries and regions including China, causing great loss to the yield of cotton, and becoming a main obstacle to high and stable yield of cotton. The Verticillium wilt of cotton is a cotton soil-borne disease caused by Verticillium dahliae Kleb, the Verticillium wilt of cotton can be attacked during the whole growth period of the cotton, generally, the Verticillium wilt of cotton begins to show symptoms at 3-5 true leaf stages, the cotton buds grow in the middle and later stages and then are attacked in a large amount in the field, the cotton buds and the cotton bolls are rare after the attack, the cotton bolls crack in advance, the yield is reduced, xinjiang is the most main cotton production base in China, and the yield accounts for about 85% of the whole country. The main prevention and cure methods of cotton verticillium wilt are breeding disease-resistant variety, chemical prevention and cure, biological prevention and cure, etc. The method is characterized in that a disease-resistant variety is cultivated, because an effective disease-resistant source is lacked, a high-disease-resistant variety which is successfully cultivated at present does not exist, an effective bactericide is not available for chemical prevention and control, environmental pollution is easily caused after long-term use, and the chemical prevention and control is limited by pesticide effect and use mode and is difficult to play a role; biological control many microorganisms have been demonstrated to have biocontrol effects and some have been gradually applied. Many biocontrol microorganisms can produce active substances such as various antibiotics, extracellular enzymes and the like, and the spores have strong stress resistance, so the biocontrol microorganisms have good application prospect in the aspect of preventing and treating soil-borne diseases.

Lin Zhongmin, etc. in 2001, a new disease on the jujube in Shanxi province, named jujube black spot, was first reported. The black spot disease of the jujube fruits mainly occurs in leaves and floral organs and infects fruits at the later stage, the disease infection latent period on the jujube fruits is long, and the symptoms begin to appear in the white mature period of the jujube fruits from 8 months to 9 months. The typical field symptoms of the jujube black spot are that dark brown to black round spots appear on the waist or the trunk of the surface of the jujube at the initial stage, as the jujube grows up, the later spots are enlarged continuously to form round or some irregular black spots, the spots generally appear on the navel or the top of the jujube, the pulp becomes black and hard, the pulp of the jujube black spot is easy to separate, the pathogens of the jujube black spot are considered to be mainly caused by fungi such as phoma (phomas), streptomyces (alternaria) and colletotrichum (colletorrichum), the general fruit rate is about 30 percent, the diseased jujube orchard reaches more than 80 percent, the yield and the quality of the jujube are reduced, the jujube cannot be stored, the commercial property of the jujube is seriously influenced, the great economic loss is caused to jujube farmers, and the problem to be solved urgently in production is solved. The jujube black spot is latently infected in the jujube after invading the jujube at the early stage, and the peak of disease onset begins to be reached by the coloring period of the jujube, so that the early reduction of the infection of germs to the jujube flower and the jujube is very important for preventing and treating the disease. However, the flowering period of Xinjiang red dates reaches about 100 days, and the chemical bactericide is applied in the flowering period, so that the red dates easily fall flowers and fruits, which causes certain difficulty in preventing and treating the black spot disease of the red dates. The screening has good prevention effect on the black spot disease of the jujube, and the biopesticide which is safe to the jujube flower has important application value for preventing and treating the black spot disease of the jujube.

Biological control has been receiving more and more attention in recent years because of its advantages such as strong specificity, high control effect, good durability of drug effect, and no environmental pollution. With the intensive research on the salt-tolerant Brevibacillus halodurans, documents report on new species of the salt-tolerant Brevibacillus halodurans at home and abroad, and at present, no document or patent reports on the application of the salt-tolerant Brevibacillus halodurans in the prevention and treatment of the black spot disease of jujube fruits and the verticillium wilt of cotton.

Disclosure of Invention

Aiming at the technical current situation that the prior art does not record the application of salt-tolerant Brevibacillus brevis in the prevention and control of jujube black spot and cotton verticillium wilt, the invention aims to provide a new Brevibacillus halotolerans Z-9 biocontrol microbial inoculum in Brevibacillus brevis and the application thereof, the new Brevibacillus halotolerans Z-9 in Brevibacillus obtained by separating Xinjiang Tupistachio Shuke, aral cotton and red date rhizosphere soil is used for preparing the biocontrol microbial inoculum by utilizing the Brevibacillus halotolerans Z-9, the biocontrol microbial inoculum is applied to preparing the medicines for preventing and controlling the jujube black spot and the cotton verticillium wilt, the Brevibacillus halotolerans Z-9 has diameters of 23.32mm and 25.68mm respectively for the cotton verticillium wilt and the jujube black spot, the biocontrol microbial inoculum contains a catechol type iron carrier, the hydroxamic acid type iron carrier is negative, the minimum value of As/Ar ratio is 0.021682, and the highest iron production capacity is 0.021 ++.682. Through field tests, the disease indexes of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum are reduced to a certain extent, the disease index is 7.14, and the prevention and treatment effect on cotton verticillium is the best, and reaches 78.07%; the Brevibacillus halotolerans Z-9 biocontrol bactericide is diluted by 50 times and applied to the jujube black spot, the prevention and treatment effect on the jujube black spot is good, the disease index is reduced to 8.34, the morbidity is inhibited to 9.58%, and the prevention and treatment effect is as high as 78.07% after the 3 rd application. The Brevibacillus halotolerans Z-9 and the biocontrol microbial inoculum prepared by the Brevibacillus halotolerans Z-9 have high efficiency on cotton verticillium wilt and jujube black spot, have no toxic or pathogenic side effects and the like, and have wide application value in preparing medicines for preventing and treating cotton verticillium wilt and jujube black spot.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

the invention provides a Brevibacillus halotolerans Z-9 biocontrol microbial inoculum which is obtained by fermenting a new strain Brevibacillus halotolerans Z-9 in Brevibacillus halodurans, wherein the viable count of Brevibacillus halotolerans Z-9 is not less than 10 ⁸ CFU/mL。

The invention obtains a new strain Brevibacillus halotolerans Z-9, separates and screens the rhizosphere soil of Xinjiang Tushuke and Aral cotton and red date, and verifies that the obtained Bacillus (Bacillus) belongs to a typical new strain in the salt-tolerant Brevibacillus in the scope of Bacillus (Bacillus) through the well-known strain system molecular level identification and the strain physiological and biochemical system test verification, the strain salt-tolerant Brevibacillus is preserved in the common microorganism center of China Committee for culture Collection management, and the preservation number is: CGMCC No.15005, preservation date: 12/2017, 04/month.

The gene sequence of the strain Brevibacillus halotolerans Z-9 is shown as SEQ ID NO. 1.

In the invention, the liquid fermentation medium of Brevibacillus halotolerans Z-9 is as follows: by mass ratio, the soybean cake powder is 2.0%, the yeast powder is 3.5%, the molasses is 1.0%, the NaCl is 0.5%, and the balance is water, and the pH value is 7.0.

Meanwhile, the invention provides a preparation method of the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum, which comprises the following steps:

(1) Activating Brevibacillus halotolerans with the strain number of Z-9 stored at low temperature on a TSA plate culture medium, picking a single colony on the TSA slant culture medium, and culturing for 48h in an incubator at 30 ℃ to obtain the activated Brevibacillus halotolerans Z-9.

(2) Using a sterile inoculating loop to scrape a loop of the strain Brevibacillus halotolerans Z-9 activated in the step (1) to inoculate the strain in 100mL of TSA liquid culture medium, and performing shake culture for 14-16h at the temperature of 28-32 ℃ and the rotating speed of a shaking table of 150-180r/min to obtain Brevibacillus halotolerans Z-9 seed liquid, wherein the content of viable bacteria is not less than 1 multiplied by 10 ⁸ cfu/mL for use.

(3) Inoculating the Brevibacillus halotolerans Z-9 seed liquid obtained in the step (2) into a triangular flask filled with 100mL of liquid fermentation medium according to the inoculation amount of 0.5-1.5% by mass-volume ratio for shake flask fermentation, and performing shake culture at 28-32 ℃ and 160-200r/min for 48-72h to obtain Brevibacillus halotolerans Z-9 fermentation liquid.

(4) Detecting the quantity of the thalli and the spores in the fermentation liquid obtained in the step (3), when mature spores in the fermentation liquid account for 90% of the total quantity of the spores and the thalli, putting the fermentation liquid into a storage tank, adding sodium benzoate with the mass ratio of 0.1-0.3%, adjusting the pH value to 6.0, and ensuring that the number of the viable spores is 1 multiplied by 10 ⁸ -1×10 ⁹ cfu/mL, namely preparing the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum.

The preparation method of the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum comprises the steps of inoculating 1% of Brevibacillus halotolerans Z-9 seed liquid, fermenting at the temperature of 29 ℃ and fermenting for 56 hours.

According to the preparation method of the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum, the preservative sodium benzoate is added according to the addition amount of 0.2% by mass ratio.

The invention provides an application of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum in preparing a medicament for preventing and treating cotton verticillium wilt.

The invention provides an application of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum in preparing a medicine for preventing and treating jujube black speck.

By implementing the invention in the above specific technical scheme provided by the invention, the following can be obtained

Has the beneficial effects that:

(1) The invention provides a new strain Brevibacillus halotolerans Z-9, which is proved to belong to a typical new strain in the salt-tolerant bacillus category by the well-known and acknowledged molecular level identification of a strain system and the test and verification of a physiological and biochemical system of the strain, and further needs to be preserved according to the legal requirements.

(2) The Brevibacillus halotolerans Z-9 and the biocontrol bactericide prepared by the Brevibacillus halotolerans Z-9 are applied to preparation of medicines for preventing and treating cotton verticillium wilt and jujube fruit black spot, the diameters of inhibition zones of Brevibacillus halotolerans Z-9 cotton verticillium wilt and jujube fruit black spot are 23.32mm and 25.68mm respectively, the Brevibacillus halotolerans Z-9 biocontrol bactericide contains catechol type siderophores which are negative, the minimum value of As/Ar ratio is 0.682 +/-0.021, and the highest iron production capacity is +/-plus. Through field tests, the disease indexes of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum are reduced to a certain extent, the disease index is 7.14, and the prevention and treatment effect on cotton verticillium is the best, and reaches 78.07%; the Brevibacillus halotellans Z-9 biocontrol bactericide is diluted by 50 times and applied to better control the black spot disease of the jujube fruits, the disease index is reduced to 8.34, the morbidity is inhibited to 9.58 percent, the control effect is as high as 78.07 percent after the 3 rd application, and the Brevibacillus halolerans Z-9 biocontrol bactericide has wide application value in preparing medicines for controlling cotton verticillium wilt and jujube black spot disease.

Drawings

FIG. 1 is a diagram of a phylogenetic tree constructed by strain Z-9 based on the 16S rDNA sequence.

FIG. 2 is a colony morphology of strain Z-9.

Detailed Description

The present invention will be described below by way of examples, but the present invention is not limited to the following examples. All raw and auxiliary materials selected for use in the present invention, as well as methods for culturing the selected bacterial species, are well known and used in the art, and all percentages referred to herein are by weight unless otherwise indicated.

The cotton verticillium wilt pathogenic bacteria and jujube fruit black spot pathogenic bacteria adopted in the invention are common strains, can be purchased from common strains by other public channels such as China general microbiological culture Collection center (CGMCC) and the like, and the selected strain culture methods are well known and selected in the field.

The liquid fermentation culture medium adopting Brevibacillus halotolerans Z-9 is as follows: by mass ratio, bean cake powder 2.0%, yeast powder 3.5%, molasses 1.0%, naCl 0.5%, and water in balance, and pH is 7.0.

Example 1: separation, screening and identification of Brevibacillus halotolerans Z-9

(I) separation and purification

In 2016 years, pear flower is collected from rhizosphere soil of Xinjiang Tumushuke and Aral cotton and red dates, 10g of rhizosphere soil of the cotton and the red dates is taken to be put into 90mL of sterilized water, shaking culture is carried out at 150rpm for 32min to prepare suspension, then 1mL of the suspension is taken to be put into a 9mL of sterile water triangular flask, and 10mL of the suspension is prepared by sterile water ⁵ 、10 ⁶ Taking 200ul of each dilution, coating TSA culture medium plates, repeating each treatment for 3 times, placing the culture medium at 30 ℃ for culturing for 2d at constant temperature, selecting a single colony, transferring to LB culture medium, streaking and purifying, and storing the purified strain in glycerol at-70 ℃ for later use.

(II) Classification and identification

Brevibacillus halolelanes Z-9 (hereinafter referred to as "strain Z-9")) 16Sr DNA gene sequence determination and analysis:

(1) Extraction of PCR template DNA

Inoculating the strain Z-9 into a TSA culture medium, shaking and culturing at the rotation speed of 180r/min and the temperature of 30 ℃ for 10 hours, centrifugally collecting thalli, and extracting genome DNA by adopting a novel plant genome DNA rapid extraction kit.

(2) PCR amplification

PCR amplification primers for 16Sr DNA:

forward primer 27F: AGAGTTTGATCCTGGCTCAG;

reverse primer 1492R: TACGGYTACCTTGTTACGACTT.

The reaction system is shown in Table 1:

table 1: reaction system

Composition of	Volume/. Mu.L
		2XMix	25
27F	1
		1492R	1
Fungus sample template	1
		ddH 2 O	22

(3) Sequence determination

The PCR amplification product is subjected to electrophoresis detection and purification and then sequenced, 16S rDNA of the strain Z-9 is sequenced, a partial ordered sequence of 16SrDNA is obtained by splicing DNA star software, the sequence is shown as SEQ ID NO:1, BLAST homologous sequence retrieval (the accession number is KP 100051) is respectively carried out on Gen Bank, MEGA 5.0 software commonly adopted in the field is utilized to establish a phylogenetic tree (repeated sampling is carried out for 100 times) by a Neighbor-Joining method, and the result is shown in the attached figure 1. Comparison analysis shows that the 16Sr DNA gene sequence of the strain Z-9 has the highest homology with Brevibacillus halolorans LAM0312 (T) (accession number: KJ 627768) and the similarity is 98.79%, in a phylogenetic tree constructed by the 16Sr DNA gene sequence, the 16Sr DNA sequence of the strain Z-9 has the closest genetic relationship with Brevibacillus halolorans strain LAM0313 (accession number: KT 346371) and the confidence coefficient is 98, which shows that the strain Z-9 has extremely high support rate as a new strain and has excellent stability in the phylogenetic tree, and the strain number Z-9 is a typical new strain in the category of Bacillus halodurans of Bacillus through comprehensive judgment of similarity and homology and identification of strains and identification of the molecular level of a strain system known in the field.

Based on the biological characteristics, the strain Z-9 is identified as a new strain in the bravibacillus halotolerans branch. The strain has been deposited in the Budapest treaty International Collection of microorganisms: china general microbiological culture Collection center (CGMCC), address: west road No.1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101, date of deposit: 04 days 12 months 2017, with preservation number CGMCC No.15005.

Example 2: determination of physiological and biochemical characteristics of Brevibacillus halotolerans Z-9

The strain Z-9 grows well on the TSA culture medium, the morphology of the Z-9 cultured on the TSA culture medium for 2d is shown in the attached figure 2, the edges of colonies are smooth, the colonies are smooth and light brown, the optimal growth temperature is 28-34 ℃, the diameter is 0.5-3.5mm after the Z-9 is cultured on the TSA culture medium at 30 ℃ for 2 days, cells are gram-positive, spores form a rod shape, the width is 0.2-0.8 mu m, the length is 1.5-4.0 mu m, peripheral flagella move, the optimal growth temperature is 30 ℃, and the pH is 7.0-8.0.

The physiological and biochemical properties of the strain Z-9 are shown in Table 2.

Table 2: comparison of physiological and biochemical Properties between Strain Z-9 and its related model strains

The strain Z-9 gram-positive bacterium, rod-shaped, is able to utilize arabinose but not cellobiose, is able to grow in the absence of sodium chloride and is able to tolerate up to 12% (w/v) sodium chloride. Catalase-positive, oxidase-positive, and reduce nitrate to nitrite. The cells tested positive for Wo Gesi-Prostacoul, but negative for methyl red, egg yolk reaction and hydrogen sulfide production. The hydrolysis reaction of casein and starch is positive. The V-P test and the physiological and biochemical test of catalase are positive, the gelatin hydrolysis test and the physiological and biochemical test of urease are negative, and the test of salt requirement and salt tolerance shows that the pH value is 7-8. Through testing the morphological characteristics and physiological and biochemical characteristics of the strain Z-9, the strain Z-9 is identified as a Brevibacillus halotolerans new species according to the analysis of Bacillus and microbial taxonomy and common bacteria system identification manual, wherein the physiological and biochemical characteristics have greater similarity with gram-positive bacteria Bacillus.

By integrating the results of homology comparison analysis and biochemical test comparison of 16S rDNA genes, the strain Z-9 provided by the invention has a distinct difference with the strains in the same genus range of common Brevibacillus brevis (Brevibacillus halotolrans) and has the characteristics of new strains in the same genus of the Brevibacillus brevis.

Example 3: preparation of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum

In this embodiment, on the basis of embodiment 1-2, the method for preparing Brevibacillus halotolerans Z-9 biocontrol microbial inoculum specifically comprises the following steps:

(1) Activating Brevibacillus halotolerans Z-9 stored at low temperature on a TSA plate culture medium, selecting a single colony on the TSA slant culture medium, and culturing for 48h in an incubator at 30 ℃ to obtain the activated Brevibacillus halotolerans Z-9 strain.

(2) Using a sterile inoculating loop to scrape a loop of the strain Brevibacillus halotolerans Z-9 activated in the step (1) to inoculate the strain in 100mL of TSA liquid culture medium, and performing shake culture for 14-16h at the temperature of 28-32 ℃ and the rotating speed of a shaking table of 150-180r/min to obtain Brevibacillus halotolerans Z-9 seed liquid, wherein the content of viable bacteria is not less than 1 multiplied by 10 ⁸ cfu/mL, spare.

(3) Inoculating the Brevibacillus halotolerans Z-9 seed liquid obtained in the step (2) into a triangular flask filled with 100mL of liquid fermentation medium according to the inoculation amount of 0.5-1.5% by mass-volume ratio for shake flask fermentation, and performing shake culture at 28-32 ℃ and 160-200r/min for 48-72h to obtain Brevibacillus halotolerans Z-9 fermentation liquid.

(4) Detecting the quantity of the thalli and the spores in the fermentation liquid obtained in the step (3), when mature spores in the fermentation liquid account for 90% of the total quantity of the spores and the thalli, putting the fermentation liquid into a storage tank, adding sodium benzoate with the mass ratio of 0.1-0.3%, adjusting the pH value to 6.0, and ensuring that the number of the viable spores is 1 multiplied by 10 ⁸ -1×10 ⁹ cfu/mL, namely preparing the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum.

Example 4: preparation of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum

In this embodiment, based on embodiments 1 to 3, in a preparation method of a Brevibacillus halolerans Z-9 biocontrol microbial inoculum, an inoculation amount of a Brevibacillus halolerans Z-9 seed solution is 1%, a fermentation temperature is 29 ℃, a fermentation time is 56 hours, and a preservative sodium benzoate is added in an amount of 0.2% by mass.

Example 5: preparation of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum

In this embodiment, based on embodiments 1 to 3, in the preparation method of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum, the inoculation amount of the Brevibacillus halolerans Z-9 seed solution is 0.5%, the fermentation temperature is 28 ℃, the fermentation time is 48 hours, and the preservative sodium benzoate is added in an amount of 0.1% by mass.

Example 6: preparation of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum

In this embodiment, based on embodiments 1 to 3, in the preparation method of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum, the inoculation amount of the Brevibacillus halolerans Z-9 seed solution is 1.5%, the fermentation temperature is 32 ℃, the fermentation time is 72 hours, and the preservative sodium benzoate is added in an amount of 0.3% by mass.

Example 7: preparation of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum

In this embodiment, based on embodiments 1 to 3, in the preparation method of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum, the inoculation amount of the Brevibacillus halolerans Z-9 seed solution is 1.2%, the fermentation temperature is 30 ℃, the fermentation time is 64 hours, and the preservative sodium benzoate is added in an amount of 0.2% by mass.

Example 8: brevibacillus halotolerans Z-9 inhibiting effect on cotton verticillium wilt and jujube fruit black spot

(1) Plate antagonism test of strain Z-9 on verticillium dahliae and alternaria nipecuroides

Activating Brevibacillus halotolerans Z-9 on a TSA culture medium by adopting a plate bacteriostasis method, transferring into 50mL TSA culture solution, and performing shaking culture at 180rpm at 28 ℃ for 2d for later use, wherein the bacteria content is not less than 5.5 multiplied by 10 ⁸ cfu/mL。

Picking Verticillium dahliae Kleb and Alternaria alternata colonies (Alternaria alternata) which are preserved on a test tube slope by using a sterile inoculating loop, dotting the colonies at the center of a PDA plate, placing the PDA plate in a constant temperature incubator for culturing for 7-10d, punching holes on a cotton Verticillium wilt bacterium plate and a jujube black spot bacterium plate by using a puncher with the inner diameter of 5mm, picking 15-20 punched fungus cakes, inoculating the punched fungus cakes into a 500mL triangular flask filled with sterilized and cooled 200mL Czapek's liquid culture medium, and performing oscillation culture at 25 ℃ and 150r/min for 7d to obtain the fermentation mother solution for Verticillium wilt bacterium gossypii and jujube black spot bacterium. Sucking 0.5mL of fermentation mother liquor with a pipette, transferring into a test tube containing 4.5mL of sterile water, and blowing and sucking for several times to mix uniformly to obtain 10 ^-1 Diluting the solution; suction 10 ^-1 Diluting with 0.5mL of water, transferring into a test tube containing 4.5mL of sterile water, and blowing and sucking for several times to mix uniformly to obtain 10 ^-2 And (4) diluting the solution. Suction 10 ^-2 0.1mL of the diluent is coated on a PDA culture medium plate to obtain a pathogenic bacteria plate.

Antagonistic bacteria are preliminarily screened by adopting a plate confronting method. Brevibacillus halolelans Z-9 is point-connected on a pathogen plate, 5 points are connected on each plate, each treatment is repeated for 3 times, after standing for 20-30min, the plate is placed in a constant temperature incubator at 25 ℃ for culturing for 5-7d, whether a bacteriostatic circle is generated or not is observed, strains generating the bacteriostatic circle are recorded, the diameter of the strains is measured, and the result is shown in Table 3.

Table 3: results of bacteriostatic test on Z-9 strain

As can be seen from the results in Table 3, the diameters of the inhibition zones of Brevibacillus halotolerans Z-9 provided by the invention for verticillium dahliae and datefruit alternaria are 23.32mm and 25.68mm respectively, which shows that Brevibacillus halotolerans Z-9 has obvious inhibition effect on the growth of verticillium dahliae and datefruit alternaria and has very good biological control potential when being applied to the preparation of medicines for preventing and treating verticillium dahliae and datefruit alternaria.

(2) Plate-related assay for bacterial strain Z-9 cell wall degrading enzyme

Cell wall degrading enzyme plate detection: preparing a detection culture medium according to the culture, placing for 2d after plate inversion, drilling a hole with the diameter of 6mm on a chitinase, glucanase, cellulase and protease detection culture medium, taking 100 mu L of antagonistic bacteria fermentation liquor by using a pipettor, placing the antagonistic bacteria fermentation liquor into the hole, using an NB culture medium to replace the fermentation liquor as a reference, culturing for 48h at the constant temperature of 30 ℃, dyeing the cellulose and glucan detection culture medium and the culture medium by using 10-15 mL of Congo red solution with the concentration of 0.1% for 20min, repeatedly washing by NaCl for 3 times, and measuring the diameter of an enzymolysis ring by using a vernier caliper, wherein the specific results are shown in Table 4.

Table 4: analysis of outer diameter and variance of enzymolysis transparent ring

Note: different letters represent significant differences between different species of the same enzyme (p < 0.05)

As can be seen from the data in Table 4, the sizes of the chitinase, protease, dextranase and cellulase enzymatic transparent rings are 15.23mm,29.12mm,23.97mm and 6.32mm, respectively.

(3) Enzyme activity test of Z-9 cell wall degrading enzyme of strain

Weighing a proper amount of anhydrous glucose, N-acetylglucosamine and L-tyrosine, placing the anhydrous glucose, N-acetylglucosamine and L-tyrosine in an oven at 105 ℃ to be dried to constant weight, respectively and accurately weighing 1.000g to prepare 1mg/mL glucose standard solution, 1mg/mL N-acetylglucosamine standard solution and 0.1mg/mL L-tyrosine standard solution, and establishing a cell wall degrading enzyme activity standard curve.

The adding amount of the glucose standard solution is started from 0, the gradient of 0.1mL is gradually increased to 0.6mL, 7 groups of samples are totally added with 3.0mL of DNS solution, the volume of distilled water is increased to 10mL, and a glucose standard curve is established. The standard curve of N-acetylglucosamine is established as above, the initial adding amount of N-acetylglucosamine standard solution is 0.25mL,0.05mL is increased in gradient, 7 groups of samples are totally added with distilled water to 1.5mL, 1.5mL of LDNS is added to ensure the constant volume to be 7.5mL, and the standard curve of L-tyrosine is established.

The substrate reacts with the crude enzyme solution for 30min under certain reaction conditions (glucan, chitin and cellulose are bathed for 30min at 50 ℃ and casein is bathed for 20min at 37 ℃) to generate 1 mu g of glucose/tyrosine which is an enzyme activity unit. Dissolving 0.5% colloidal chitin, 0.5% CMC-Na, 1% dextran in 0.1mol/L acetic acid-sodium acetate buffer (pH 4.5), and dissolving 0.5% casein in 0.02mol/L phosphate buffer (pH 7.5). Measuring the content of glucan after reaction by using a DNS method, adjusting the content to the wavelength of 540nm, and recording the OD value of a sample; and determining the amount of casein after reaction by a forskolin-phenol method, adjusting the amount to the wavelength of 680nm, recording the OD value, and replacing the crude enzyme solution with the inactivated crude enzyme solution as a control. Diluting the fermentation stock solution to 10 ^-5 、10 ^-6 、10 ^-7 Then coating, culturing at 30 deg.C for 24 hr, counting bacterial colony number, and determining activity of dextranase, chitinase, protease, and cellulase.

According to the standard curve of the enzyme activity of the cell wall degrading enzyme, the enzyme activity of Brevibacillus halolerans Z-9 is respectively 3.25IU/ml of chitinase, 16.82IU/ml of protease, 9.58IU/ml of glucanase and 6.23IU/ml of cellulase.

(3) Test for type of siderophore produced by strain Z-9

Taking 4mL of MKB fermentation liquor fermented by the strain Z-9 for 4d, centrifuging at 10000r/min for 10min, and reserving supernate for later use. The Arnow method and the ferric perchlorate method identify the type of the siderophore.

Collecting 1mL of the supernatant of antagonistic bacteria, sequentially adding 1mL of 0.5mol/L HCl and 1mL of molybdate solution (NaNO) ₂ 10 g，Na ₂ MoO ₄ 10g, distilled water is added to a constant volume of 100 mL) to turn yellow, then 1mL of NaOH with the concentration of 0.5mol/L is added, the solution turns red from yellow and keeps for 15min without changing color, and the catechol type siderophore is proved to exist.

And (3) testing the hydroxamic acid type iron carrier by a ferric perchlorate test, taking 0.5mL of each of the Z-9 standby supernatant, adding 2.5mL of 5mmol/L ferric perchlorate solution, wherein the hydroxamic acid type iron carrier exists when the color turns red, and the hydroxamic acid type iron carrier does not exist when the color turns yellow. Controls were sterilized MKB liquid medium.

And (3) judging the siderophore production capacity: the absorbance ratio As/Ar is decreased by 0.2 and increased by one "+", and the siderophore production capacity of the strain is divided, and the absorbance ratio As/Ar of the bacteria with higher siderophore production capacity (+++) is lower than 0.5.

The result of identifying the type of the siderophore is as follows: the bacterial strain Z-9 shows a reddening phenomenon, the color does not change within 15min, and the contrast does not change, which shows that the bacterial strain Z-9 contains the catechol-type siderophore. The result of the ferric perchlorate test indicates that the strain Z-9 contains hydroxamic acid type siderophore which is negative.

On the basis of determining siderophores, the test further detects siderophore production ability of the strain Z-9, and the data in Table 5 show that the minimum value of As/Ar ratio of the strain Z-9 is 0.682 +/-0.021, and the highest siderophores production ability is "+".

Table 5: visual table for producing siderophore capability of Z-9 strain

Example 9: application of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum in prevention and control of bergamot pear blossom blight

(1) Test for cotton verticillium wilt prevention effect

Test time, place: in 2020, xinjiang shaya county

The test varieties are: no. 84 cotton field, sowing in field test cotton and applying with seedling water 75L·hm ^-2 The Brevibacillus halotolerans Z-9 biocontrol microbial inoculum is applied with water for 75 L.hm for the second time and the third time respectively ^-2 The Brevibacillus halotolerans Z-9 biocontrol microbial inoculum. The adjacent cotton without pesticide is used as a contrast, and the other field management measures are the same in treatment. The drip irrigation application mode adopts a movable pressurization drip irrigation mode, is carried out within about 2 hours before dripping is finished, and the microbial inoculum is added into a dispensing box of a drip irrigation system and is dripped along with water to finish application. The contrast is divided into a clear water contrast group (CK) and a common medicament contrast, and the clear water contrast is treated by drip irrigation with clear water.

The disease grading criteria are as follows:

stage 0: good growth without manifestation of disease; level 1: slight yellowing of leaves; and 2, stage: moderate or severe yellowing of leaves, wilting; and 3, level: plant wilting, severely curling leaves; 4, level: the plant withers seriously, and the stem vascular bundle begins to brown; and 5, stage: the whole plant withered, the stem vascular bundle became yellow brown, the plant died, and the test results are shown in table 6.

Control effect (%) = [ (control disease index-control disease index)/control disease index ] × 100%

Table 6: the field control effect of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum on cotton verticillium wilt is obtained

Treatment of	Incidence (%)	Index of disease condition	Relative control effect (%)
				Z-9	8.23	7.14	78.07
Control of	39.56	32.56	--

As can be seen from the data in Table 6, the index of the verticillium wilt of cotton treated by clear water (control) is 32.56, and the index of the verticillium wilt of cotton is reduced after the drip irrigation treatment of the bio-control agent, wherein the index of the disease of cotton fields after the bio-control agent is applied is 7.14, and the prevention and treatment effect on the verticillium wilt is the best, which reaches 78.07%.

(2) Test for preventing and treating black spot of jujube fruit

Test methods test time, place: shaya county in Xinjiang in 2020

The test varieties are as follows: jun date; the test is carried out by arranging the biological waterproof agent for treatment and the clear water for comparison, and each treatment is repeated for 3 times for 6 cells. 2 adult trees were fixed per cell. The sprayer for the test starts to spray 50 times of Brevibacillus halotolerans Z-9 biocontrol fungicide diluent for 1 time in the middle ten days of 8 months, and the pesticide is respectively sprayed once in the last ten days and the last ten days of 9 months, and the total number is 3 times. When the pesticide is applied, the whole plant is uniformly sprayed, on the premise of no flowing of the pesticide liquid, and the water and fertilizer management and the farm work operation are normally carried out in the test period. The average daily temperature during the test was 31 ℃ and the relative humidity was 68%. The soil is sandy loam, fertile and sufficient in fertilization.

The survey was conducted once in the first, middle and last 10 months, and the whole test was conducted 3 times. 2 plants in each cell are investigated, all fruits of 2 branches are investigated in the left direction and the right direction of each plant, and the total fruit number, the diseased fruit number and the diseased spot number are recorded. And respectively calculating the control effect of each processing cell. During the application period, the treatment is observed to have no phytotoxicity on the jujube fruits, and the specific results are shown in table 7.

The disease grading method comprises the following steps: level 0: no disease spots; level 1: the area of the disease spots accounts for less than 5% of the whole fruit area; and 3, level: the lesion area accounts for 6 to 10 percent of the whole fruit area; grade 5; the lesion area accounts for 11-20% of the whole fruit area; 7, level; the lesion area accounts for more than 20% of the whole fruit area.

The disease index and the prevention and treatment effect are calculated by the method that the disease index = [. Sigma (the number of all levels of diseased fruits multiplied by the relative level value)/(the total number of investigation fruits multiplied by 9) ] multiplied by 100

Control effect (%) = [ ∑ (blank disease index-medicament treatment disease index)/blank disease index ] × 100 table 7: big Tian Fangxiao of Brevibacillus halotolerans Z-9 biocontrol microbial inoculum for jujube black spot disease

Treatment of	Incidence (%)	Index of disease condition	Relative control effect (%)
				Z-9	9.58	8.34	78.07
Control	43.61	37.46	--

As can be seen from the data in Table 7, the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum provided by the invention is diluted by 50 times and sprayed with Tian Zaoshu, so that the control effect on the black spot disease of the jujube fruits is better and is obviously higher than that of the control; after the 3 rd time of pesticide application, the control effect of the Brevibacillus halotolerans Z-9 biocontrol microbial inoculum is as high as 78.07%.

The tests show that Brevibacillus halotolerans Z-9 separated from soil at rhizosphere of Xinjiang Tupistachio, aral cotton and red dates, the biocontrol microbial inoculum prepared by utilizing Brevibacillus halotolerans Z-9, the diameters of inhibition zones of Brevibacillus halotolerans Z-9 for verticillium dahliae and jujube black spot pathogen are 23.32mm and 25.68mm respectively, the carrier contains catechol type siderophore, the carrier containing hydroxamic acid type siderophore is negative, the minimum value of As/Ar ratio is 0.682 +/-0.021, and the highest iron production capacity is "+". Through field tests, the disease indexes of the Brevibacillus halolerans Z-9 biocontrol microbial inoculum are reduced, the disease indexes are 7.14, and the prevention and treatment effect on the verticillium wilt is the best, and reaches 78.07%; the Brevibacillus halotolerans Z-9 biocontrol bactericide is diluted by 50 times and applied to the jujube black spot, the prevention and treatment effect on the jujube black spot is good, the disease index is reduced to 8.34, the morbidity is inhibited to 9.58%, and the prevention and treatment effect is as high as 78.07% after the 3 rd application. The Brevibacillus halotolerans Z-9 and the biocontrol microbial inoculum prepared by the Brevibacillus halotolerans Z-9 have high control effect on cotton verticillium wilt and jujube black spot, have no toxic or pathogenic side effects and the like, and have wide application value in preparing medicines for controlling cotton verticillium wilt and jujube black spot.

The above examples are merely illustrative for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. This need not be, nor should it be exhaustive of all embodiments. And obvious variations or modifications can be made while remaining within the scope of the present invention.

Claims (1)

1. An application of biocontrol agent in preparing medicine for preventing and treating jujube fruit melanosis is disclosed.

Images