CN115901892A - Method and device for detecting DNA and target object using DNA as recognition molecule - Google Patents

Abstract

The invention relates to a polymer sensitive membrane ion selective electrode, in particular to a method and a device for detecting DNA and a target object (such as antibiotic) taking the DNA as a recognition molecule. The method comprises the steps of detecting a target object containing DNA, DNA derivatives or using DNA as identification molecules in a sample to be detected, and utilizing a potential sensor of an ion exchanger doped polymer membrane ion selective electrode to change the potential of the ion exchanger doped polymer membrane electrode through the charge of the DNA or the interaction between the DNA identification molecules and the target object, thereby realizing the quantitative/qualitative detection of the DNA, the DNA derivatives or the target object using the DNA as the identification molecules in the sample. In the invention, DNA is simultaneously used as an identification element and an indicator ion, so that the application range is wide and the universality is realized; the electrode has quick response, simple operation and good practical application prospect.

Description

Method and device for detecting DNA and target object using DNA as recognition molecule

Technical Field

The invention relates to a polymer sensitive membrane ion selective electrode, in particular to a method and a device for detecting DNA and a target object (such as antibiotic) taking the DNA as a recognition molecule.

Background

DeoxyriboNucleic Acid (abbreviated as DNA) is a macromolecular polymer composed of deoxynucleotides. Deoxyribonucleotides consist of a base, deoxyribose, and phosphate. Wherein, the basic groups are 4 types: adenine (a), guanine (G), thymine (T) and cytosine (C). The base arrangement in a DNA molecule is varied, resulting in different properties of each deoxynucleotide chain, thereby imparting different properties to the DNA. DNA has different amounts of charge in a particular solution and the conformation of different DNAs is also different. As an ion, DNA can induce a potential response on a polymer-sensitive membrane electrode.

Aptamer (Aptamer) is a structured oligonucleotide sequence (RNA or DNA) obtained by a Systematic Evolution of Ligands (SELEX) through in vitro screening technology-index enrichment, has strict recognition capability and high affinity with corresponding target molecules (proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules and the like), and is combined with the corresponding target substances through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interaction, electrostatic attraction and the like with high affinity and strong specificity.

Most of the existing DNA sensors mostly use optical instruments as detection means, however, the methods are easily interfered by complicated substrate turbidity and chromaticity, secondly, most of DNA sensor arrays simply select non-specific sensing units, large-scale instruments are needed, and the instruments are complicated in structure and high in cost and are not suitable for rapid field detection. It is still a difficult problem to develop a DNA sensor that has a simple structure, low cost, and is easy to miniaturize. The potential sensor based on the polymer membrane ion selective electrode is simple to manufacture, simple and convenient to operate, high in response speed, free of expensive instruments and suitable for rapid field detection. However, since the phosphoribosyl chain and the base are both aqueous molecules, single-stranded DNA is strongly hydrophilic; the double-stranded DNA forms a conjugated structure due to base complementary pairing, intermolecular acting force reaches 'saturation', a hydration hydrogen bond is not relied on, and the outer side hydrophilic phenomenon is formed due to the action of a phosphoribosyl chain and the hydrogen bond in water. The strong hydrophilic DNA molecules are difficult to directly enter the polymer sensitive membrane phase and interact with the recognition molecules in the polymer membrane phase, so that the existing method is difficult to directly detect the DNA molecules. Conventional polyion-selective electrodes measure the potential response of the electrode at zero current, a process that is non-equilibrium. However, when low concentrations of polyions are measured, the extraction process is slow in the non-equilibrium state and the electrode response time is long. The research generally adopts a stirring method to improve the mass transfer rate of the polyion, thereby shortening the response time and improving the detection sensitivity. Meanwhile, the conventional polyion-selective electrode is difficult to be used for detecting large substances such as DNA, aptamer and the like.

Disclosure of Invention

The invention aims to provide a method and a device for detecting DNA and a target object (such as antibiotic) taking the DNA as a recognition molecule.

In order to achieve the purpose, the invention adopts the technical scheme that:

a method for detecting DNA and the target object using DNA as identification molecule includes such steps as using the potential sensor of ion-exchanger doped polymer membrane ion-selective electrode to change the potential of said electrode by the charge of DNA or the interaction between DNA identification molecule and target object, and quantitatively/qualitatively detecting the single-stranded DNA, DNA derivative or target object using DNA as identification molecule.

The detection adopts the technology of open circuit potential detection.

The detection can be carried out under zero current; potentiometry at zero current was performed by inserting a reference electrode and a working electrode together into a measuring cell and recording the potential change using an electrochemical external measuring device.

When the object to be detected is DNA or a derivative thereof, adding the object to be detected into a buffer solution to enable the DNA or the derivative thereof in the object to be detected to have negative charges; then adding a DNA fragment matched with the DNA to be detected into the liquid to be detected to change the charge of the DNA of the object to be detected, and further changing the potential of the polymer membrane electrode doped with the ion exchanger, thereby realizing the quantitative/qualitative detection of the DNA and the DNA derivative; wherein the buffer solution is pH 6.8-8.0 buffer solution (such as phosphate buffer solution, tris-hydrochloric acid buffer solution, disodium hydrogen phosphate-citric acid buffer solution, potassium dihydrogen phosphate-sodium hydroxide buffer solution, etc.);

when the object to be detected takes DNA as the recognition molecule, the DNA is taken as the recognition molecule and the signal conduction molecule to interact with the corresponding target object in the liquid to be detected, so that the DNA charge and the charge density are changed, and further the potential of the polymer membrane electrode doped with the ion exchanger is changed, thereby realizing the detection of the target object; wherein the recognition molecule DNA is added to a buffer solution, which is a buffer solution having a pH of 6.8 to 8.0 (for example, a phosphate buffer, a Tris-hydrochloric acid buffer, a disodium hydrogen phosphate-citric acid buffer, a potassium dihydrogen phosphate-sodium hydroxide buffer, etc.).

When the DNA is detected, the DNA fragment matched with the DNA or the DNA serving as the recognition molecule is fixed on a magnetic material to obtain the DNA functionalized magnetic bead.

The DNA for detecting the DNA is a single DNA chain which is formed by connecting bases with the same or different types and numbers in a phosphodiester bond mode; the DNA derivative is the modified DNA or the aptamer which is combined with a target object through covalent bonds, hydrogen bonds, van der Waals force, hydrophobic interaction, electrostatic attraction and the like with high affinity and strong specificity, the former is further that a product obtained after the functional group of the DNA is modified by certain small molecular compounds is the DNA derivative, wherein the product with the modified 3 'end becomes the 3' end derivative of the DNA, and the product with the modified 5 'end becomes the 5' end derivative of the DNA.

The DNA fragment matched with the DNA to be detected is a single-stranded DNA fragment which can be complementary with the single strand of the DNA to be detected.

The object to be detected is a target object taking DNA as a recognition molecule, the recognition molecule is fixed on a magnetic material to obtain a DNA functionalized magnetic bead, and the DNA is used as the recognition molecule and a signal conduction molecule and interacts with a target object in the liquid to be detected, so that the DNA functionalized magnetic bead changes the potential of the polymer membrane electrode doped with the ion exchanger, and the qualitative/quantitative detection of the target object in the liquid to be detected is realized.

The magnetic material is magnetic ferroferric oxide particles, magnetic beads, a magnetic material wrapped by gold or nano-gold and a magnetic material modified by a specific functional group.

The DNA or DNA derivatives in the DNA functionalized magnetic beads interact with the target object in the sample to be detected (the DNA can interact with functional groups on the surface of the target molecules), so that the DNA charges and charge densities in the DNA functionalized magnetic beads are changed, the amount of the DNA on the DNA functionalized magnetic beads effectively extracted to the polymer sensitive membrane is reduced under the action of an external magnetic field, the potential change of the electrode is caused, and the qualitative/quantitative detection of the target object in the liquid to be detected is realized.

The polymer membrane electrode is placed in an electrochemical cell, an external magnetic field is adopted to control the effective extraction of the DNA derivative functionalized magnetic beads before and after the combination with the antibiotics to be detected to the polymer sensitive membrane phase, and the potential change of the electrode is recorded. According to the potential change of the electrodes before and after the action of the DNA derivative and the antibiotic, the potential sensor can realize the high-sensitivity detection of the antibiotic in the aqueous solution.

The DNA used as the recognition molecule is a single DNA chain which is formed by connecting the same or different types and the number of bases in a phosphodiester bond mode; the DNA derivative is the modified DNA.

The DNA or DNA derivative serving as the recognition molecule is fixed on the magnetic beads, and specifically, the DNA or DNA is modified, and the DNA derivative or DNA derivative is modified and fixed on the magnetic beads;

for example, DNA having an amino group and/or a carboxyl group at either end is reacted with carboxylated (or aminated) magnetic beads, and the DNA is immobilized on the magnetic beads;

reacting DNA of which the 3 'end and/or the 5' end is modified with aminothiol with magnetic beads of which the surfaces are thiolated, and fixing the DNA on the magnetic beads;

reacting DNA (deoxyribonucleic acid) with a3 'end and/or a 5' end marked by Biotin (Biotin) with streptavidin modified magnetic beads, and fixing the DNA on the magnetic beads;

if the two ends of the DNA derivative have amino and/or carboxyl at random, the DNA derivative reacts with carboxylated (or aminated) magnetic beads and is fixed on the magnetic beads;

if the DNA derivative is subjected to reaction between DNA with the amino mercaptan modified at the 3 'end and/or the 5' end and magnetic beads with thiolated surfaces, fixing the DNA derivative on the magnetic beads;

the polymer film comprises, by weight, 20-80% of a film matrix, 20-80% of a plasticizer, and the balance of an ion exchanger;

the ion exchanger is an anion exchanger; wherein the anion exchanger is tridodecyl methyl ammonium chloride, tridodecyl methyl ammonium chloride derivatives, tritetradecyl methyl ammonium chloride derivatives, tetradodecyl ammonium chloride derivatives, hexadecyltrimethyl ammonium bromide derivatives, hexadecyltrimethyl ammonium chloride derivatives, didodecyldimethylammonium chloride or didodecyldimethylammonium chloride derivatives, guanidine or guanidine derivatives. Preferably hexadecyltrimethylammonium chloride and hexadecyltrimethylammonium chloride derivatives.

The film substrate is polyvinyl chloride, polyurethane, polybutyl acrylate, polyetherimide, rubber or sol-gel film; the plasticizer is o-nitro phenyl octyl ether, di-2-ethylhexyl decyl ester, dibutyl sebacate or dioctyl sebacate;

the target substance is antibiotic, protein, virus, bacteria, cell, heavy metal ion, antibiotic, and small molecule.

The antibiotics can be tetracycline antibiotics (tetracycline, terramycin, chlortetracycline and the like), sulfonamide antibiotics (sulfadiazine, sulfathiazole, sulfamonomethoxine and the like), quinolone antibiotics (enrofloxacin, norfloxacin, ciprofloxacin and the like), beta-lactam antibiotics (penicillins, cephalosporins and the like), aminosaccharide antibiotics (streptomycin, gentamicin, neomycin, kanamycin and the like), macrolide antibiotics (erythromycin, tylosin and the like), amidol antibiotics (also known as chloramphenicol antibiotics, florfenicol, thiamphenicol and the like) and the like. The target substance includes proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules, and the like, which are bound with a nucleic acid Aptamer (Aptamer) with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der waals forces, hydrophobic interactions, electrostatic attraction, and the like.

Meanwhile, the recognition molecule of the antibiotic is

DNA sequence ACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT of terramycin, DNA sequence CATCCGTCACACCTGCTCCACCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC recognizing sulfanilamide, DNA sequence TGGGGGTTGAGGCTAAGCCGA recognizing kanamycin of aminoglycoside antibiotics ACTTCAGTGAGTTG-TCCCACGGTCGGCGAGTCGGTGGTAG recognizing chloramphenicol of amidol antibiotics or random sequence having recognition effect on pathogenic bacteria, microorganisms, DNA sequence TCTCTGAGCCCGGGTTATTTCAGGGGGA recognizing enrofloxacin of quinolone antibiotics, DNA sequence AGGAATTCACGTCTCACTGGATTCACG-CACGCCAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG recognizing erythromycin of macrolide antibiotics, and the like. The DNA is a DNA chain which is formed by connecting bases of the same or different types and numbers in a phosphodiester bond mode; the DNA derivative is an aptamer that binds with a target substance with high affinity and strong specificity through covalent bond, hydrogen bond, van der waals force, hydrophobic interaction, electrostatic attraction, and the like.

The device of the detection method is a potential sensor of an ion exchanger doped polymer membrane ion selective electrode, which comprises a detection cell, a working electrode, a reference electrode, a counter electrode and an electrochemical external measuring device; the working electrode is a polymer membrane ion selective electrode doped with an ion exchanger and is arranged in the detection cell, and the working electrode, the reference electrode and the counter electrode are respectively connected with an electrochemical external measuring device.

The ion selective electrode of the polymer membrane doped with the ion exchanger is a polymer membrane with the doped ion exchanger adhered to the bottom of the electrode; or, a conducting layer can be additionally arranged between the bottom of the electrode and the polymer film.

The polymer membrane electrode can be a traditional polymer sensitive membrane electrode with internal liquid filling, a novel solid electrode or a printed electrode.

The electrochemical external measuring device is an electrochemical workstation, an ion meter or a potentiometer.

The reference electrode can be a saturated calomel electrode or a silver-silver chloride electrode; the auxiliary/counter electrode may be a platinum wire.

The working electrode of the printed electrode can be a carbon electrode covered by a polymer sensitive film, the reference electrode can be a silver-silver chloride electrode, and the auxiliary electrode can be a platinum sheet electrode.

The device includes an externally applied magnetic field.

The detection principle is as follows: the invention uses DNA as recognition molecule and signal conduction molecule, which interacts with the corresponding target object in the liquid to be detected, so that the potential of the polymer membrane electrode doped with ion exchanger changes, and the target object can be detected rapidly and quantitatively/qualitatively; most of DNA with high charge density and large negative charge is modified with magnetic beads, and then the potential change caused by the extraction or the adsorption of the DNA to the surface of the polymer membrane electrode doped with the ion exchanger is controlled by an external magnetic field, so that obvious and quick response is realized. The invention can realize the detection of various substances by utilizing different sequence DNAs to recognize different target molecules, thereby having universality.

The invention has the advantages that:

1. the method realizes direct potential response to DNA, and successfully solves the problem of direct potential analysis of hydrophilic recognition molecules; as a universal hydrophilic recognition molecule direct potential detection method, the method can be flexibly supplemented and fused with other analysis methods, provides new beneficial supplementation for the prior art, and greatly expands the application space and scene of the potential analysis method.

2. The invention realizes the real-time rapid potential detection of DNA by using the polymer membrane added with the ion exchanger; the electrode has simple structure and simple and convenient operation, and can be produced in large scale; the device does not need to depend on complex instruments and equipment, can be carried about, and realizes the on-site rapid detection of the target object.

3. The invention uses the polymer film doped with anion exchanger to realize the implementation of rapid potential detection of DNA; the ion exchanger added in the polymer membrane is an anion exchanger; DNA with negative charges in the buffer solution is fixed on magnetic beads, under the action of a magnetic field, the DNA is driven to reach the surface of the polymer membrane and is effectively extracted into the membrane, and the DNA interacts with an anion exchanger in the polymer membrane to generate ion exchange, so that the potential of the polymer membrane is changed; the alkyl chain structure of the doped anion exchanger directly influences the potential response, and according to the number of alkyl chains, tridodecyl methyl ammonium chloride, tetradodecyl ammonium chloride, hexadecyl trimethyl ammonium bromide and didodecyl dimethyl ammonium chloride are selected; according to the experimental results, the doped anion exchanger is preferably cetyltrimethylammonium chloride, a cetyltrimethylammonium chloride derivative.

4. The DNA derivative is used as a new recognition molecule in the detection process, not only can realize the selective recognition of the target object, but also the characteristic of the polyion of the DNA derivative can be used for the signal conduction of the potential signal.

5. The invention adopts an external magnetic field to control the DNA functionalized magnetic beads to be directly extracted to the surface of the polymer sensitive membrane electrode, and generates rapid and high-sensitivity potential response. The extraction process is simple and rapid. In addition, under the condition of an external magnetic field, the DNA coupled magnetic beads can realize the rapid separation and enrichment of the target object and eliminate the matrix effect of the background solution.

The corresponding target substance for detection comprises protein, virus, bacteria, cells, heavy metal ions, antibiotics, small molecules and the like which are combined with Aptamer (Aptamer) with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der waals force, hydrophobic interaction, electrostatic attraction and the like.

Drawings

FIG. 1 is a graph showing the potential response of DNA detected by an anion exchanger (cetyltrimethylammonium bromide) based polymer membrane electrode provided by an embodiment of the present invention.

FIG. 2 shows the results of oxytetracycline test with selected DNAs and a standard curve according to an embodiment of the present invention; wherein, a is a real-time response curve, and b is a correction curve.

Fig. 3 is a schematic diagram and an object diagram of a sensor device based on a printed electrode according to an embodiment of the present invention.

FIG. 4 is a graph showing the potential response of polymer membrane electrode detection DNA based on different ion exchangers according to the embodiment of the present invention.

Fig. 5 is a schematic diagram and an object diagram of a sensor device based on a polymer sensitive membrane electrode with an internal liquid filling according to an embodiment of the present invention.

Fig. 6 is a schematic diagram and an object diagram of a sensor device based on an all-solid-state ion-selective electrode according to an embodiment of the present invention.

Fig. 7 is a schematic flow chart of a process based on printed electrodes according to an embodiment of the present invention.

Detailed Description

The present invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The following examples were conducted in accordance with conventional methods and conditions, and experimental methods without specifying specific conditions were used.

The DNA and the derivatives thereof can generate ion potential response on the polymer membrane electrode doped with the ion exchanger, thereby realizing the potential detection of the DNA.

Further, after the DNA and the derivatives thereof are used as recognition molecules and signal conduction molecules and interact with the target, bases in the DNA and the derivatives thereof can interact with functional groups on the surface of the target, so that the charge quantity and the charge density of the surface of the DNA are changed, the electrode potential change of the DNA and the derivatives thereof on the surface of the sensitive film sensor is further caused, and the potential detection of the target can be realized.

In order to improve the detection sensitivity, the printed electrode is arranged on a small flat magnet, and an external magnetic field is adopted to control the effective extraction of the DNA functionalized magnetic beads to a polymer sensitive membrane phase, so that the electrode potential change is generated. In the measurement, the change in potential between the working electrode and the reference electrode on the printed electrode was recorded using an electrochemical system. The device is as follows: the working electrode and the reference electrode on the printed electrode are respectively connected with an electrochemical system. And inserting the printed electrode into a detection cell containing a detection solution. The detection cell is placed on a small flat plate magnet. And the detection of the object to be detected is realized by adopting an open-circuit potential measurement technology. In the invention, DNA is used as a recognition element and an indicator ion at the same time, and the application range is wide.

Example 1

The device comprises a detection cell, an ion selective polymer membrane electrode, a reference electrode, a counter electrode and an electrochemical external measuring device. The ion selective polymer membrane electrode is arranged in a detection cell, and the ion selective polymer membrane electrode, the reference electrode and the counter electrode are respectively connected with an electrochemical external measuring device. Wherein, the reference electrode is a silver-silver chloride electrode, and the counter electrode is a platinum wire electrode.

1. Preparation of ion selective polymer membrane electrode

170.32mg polyurethane, 170.32mg o-nitrophenyloctyl ether, 13.57mg hexadecyltrimethylammonium bromide and 0.619mg tetra (4-chlorophenyl) ammonium borate are dissolved in 3mL tetrahydrofuran, are uniformly stirred and then are dripped to the surface of a working electrode of a printing electrode, and the polymer membrane electrode is used for standby after the tetrahydrofuran is volatilized.

Potentiometric determination of DNA

DNA (GTGCAGCGATGTTTCCGGTGC) is negatively charged in phosphate buffer solution (1mM, pH 7) with pH 7 to obtain DNA buffer solution, adding magnetic beads (ferroferric oxide particles and derivatives thereof) into the prepared DNA buffer solution, mixing and incubating for 60 min,

meanwhile, taking a phosphate Buffer solution (Buffer) with pH 7, a DNA Buffer solution (ssDNA) and a phosphate Buffer Solution (MBs) with pH 7 added with magnetic beads as controls, respectively adding 10 mu L of the Buffer solution into a working electrode with a printed electrode placed in a detection cell, and respectively marking the open-circuit potentials for detection as E1 and E2; preparing a phosphate Buffer solution (1mM, pH 7), placing the printed electrode in a detection cell, and measuring the open-circuit potential and recording as Buffer; preparation of DNA containing a Single Strand (1.0X 10) ^-5 M) in phosphate buffer (1mM, pH 7), placing the printed electrode in a detection cell, and recording the open circuit potential as ssDNA; the real-time response curve is shown in fig. 1.

As can be seen from FIG. 1, when the DNA is not immobilized on the magnetic beads, the potential response of the DNA is small and almost identical to that of the background solution (i.e., buffer); the potential response change obtained using the magnetic bead based method is significantly larger than the DNA potentiometry without the magnetic beads.

Example 2

The device comprises a detection cell, a printed electrode, an electrochemical external measuring device and an external magnetic field as shown in figure 3; the printed electrode is arranged in the detection cell, a magnetic field is applied, and the working electrode and the reference electrode of the printed electrode are respectively connected with an electrochemical external measuring device. The working electrode printed electrode was obtained in the preparation manner described in example 1 above.

2. Potentiometric determination of oxytetracycline

DNA derivatives (aptamer: ACGTTGACGCTGGTGCCCGGTTGTGG-TGCGAGTGTTGTGT) have negative charges in phosphate buffer solution (1mM, pH 7) at pH 7, phosphate buffer solution (1mM, pH 7) containing DNA is prepared, and the DNA derivatives and magnetic bead (ferroferric oxide particles and derivatives thereof) dispersion are mixed and incubated for 60 minutes; preparing phosphoric acid buffer solutions of Oxytetracycline (OTC) with different concentrations, mixing and incubating the phosphoric acid buffer solutions with DNA functionalized magnetic beads for 60 minutes, placing a printed electrode in a detection cell, and taking 10 mu L of Oxytetracycline (1.0X 10) with different concentrations ^-6 、1.0×10 ^-7 、1.0×10 ^-8 、1.0×10 ^-9 M) dripping a phosphoric acid buffer solution mixed with the DNA functionalized magnetic beads into a working electrode in the detection cell, and recording the potential change. The detection process is shown in fig. 7, and the real-time response curve and the calibration curve are shown in fig. 2.

The real-time response curve is shown in fig. 2a, the correction curve is shown in fig. 2b, and as can be seen from fig. 2, the method can be used for measuring the potential of the oxytetracycline, and the potential difference value is gradually increased along with the increase of the concentration of the oxytetracycline. Under the optimal conditions, the linear measurement range of the potential aptamer sensor to the oxytetracycline is 1-1000nM. The optimal conditions refer to the pH value of the buffer solution of 7 and the magnetic field attraction of 9kg.

Example 3

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows

The polymer membrane component is 175.2mg of polyurethane, 175.2mg of o-nitrophenyloctyl ether and 0.6mg of tridodecyl methyl ammonium chloride, which are weighed and dissolved in 3.2mL of tetrahydrofuran, and the mixture is stirred uniformly for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charge in the buffer solution to be detected can be measured after the electrode is dried.

Example 4

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows

The ion selective electrode membrane component is 175.2mg of polyurethane, 175.2mg of o-nitrooctyl ether and 0.6mg of tetradodecyl ammonium chloride, and the components are weighed, dissolved in 3.2mL of tetrahydrofuran, and stirred uniformly for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charge in the buffer solution to be detected can be measured after the electrode is dried.

Example 5

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows:

the ion selective electrode membrane component is 175.2mg of polyurethane, 175.2mg of o-nitro benzene octyl ether and 0.6mg of didodecyl dimethyl ammonium chloride, and the components are weighed, dissolved in 3.2mL of tetrahydrofuran, and stirred uniformly for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charges in the buffer solution to be detected can be detected after the electrode is dried.

Example 6

The preparation of the middle polymer membrane of the ion selective polymer membrane electrode is as follows

The polymer membrane component is 175.2mg of polyvinyl chloride, 175.2mg of o-nitrophenyl octyl ether and 0.6mg of tridodecyl methyl ammonium chloride, which are weighed and dissolved in 3.2mL of tetrahydrofuran, and the mixture is stirred uniformly for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charge in the buffer solution to be detected can be measured after the electrode is dried.

Example 7

The ion-selective polymer membranes prepared in examples 1, 4, 5 and 6 were assembled into electrodes as described in example 1, and potential changes were recorded by potentiometry according to the method for measuring the potential of DNA described in example 1. The resulting potential changes were compared, and the degree of potential change was as shown in FIG. 4.

As can be seen from FIG. 4, the preferred cetyltrimethylammonium chloride as an ion exchanger can obtain a more significant potential change of the polymer membrane; when the didodecyldimethylammonium chloride is used as an ion exchanger, a more significant potential change can be obtained compared to tridodecylmethylammonium chloride and tetradodecylammonium chloride.

Example 8

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows

170.32mg of polyvinyl chloride, 170.32mg of o-nitrophenyloctyl ether, 13.57mg of hexadecyl trimethyl ammonium bromide and 0.619mg of tetradodecyl ammonium tetrakis (4-chlorophenyl) borate are weighed and dissolved in 3mL of tetrahydrofuran, and the mixture is uniformly stirred and then dripped on the surface of a working electrode of a printing electrode to be used as a polymer membrane electrode for standby after the tetrahydrofuran is volatilized.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charge in the buffer solution to be detected can be measured after the electrode is dried.

Example 9

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows

The ion selective electrode membrane component is 175.2mg of polyurethane, 175.2mg of o-nitrocetophenone and 0.6mg of tetradodecyl ammonium chloride, and the components are weighed and dissolved in 3.2mL of tetrahydrofuran, and are uniformly stirred for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charges in the buffer solution to be detected can be detected after the electrode is dried.

Example 10

The difference from example 1 is that the polymer membrane in the ion-selective polymer membrane electrode was prepared as follows

The ion selective electrode membrane component is 175.2mg of polyurethane, 175.2mg of o-nitro benzene octyl ether and 0.6mg of didodecyl dimethyl ammonium chloride, and the components are weighed, dissolved in 3.2mL of tetrahydrofuran, and stirred uniformly for later use.

The obtained polymer film is attached to an electrode substrate to obtain an electrode, and the DNA with negative charge in the buffer solution to be detected can be measured after the electrode is dried.

Example 11

The difference from example 1 is that an ion selective polymer membrane electrode was prepared as follows

170.32mg polyurethane, 170.32mg o-nitrophenyloctyl ether, 13.57mg hexadecyltrimethylammonium bromide and 0.619mg tetra (4-chlorophenyl) ammonium tetrakis (dodecyl) borate are weighed and dissolved in 3mL tetrahydrofuran, the mixture is poured into a glass ring with the inner diameter of 5cm fixed on a glass plate after being uniformly stirred, and after the tetrahydrofuran is volatilized, the film is cut into small circular sheets with the diameter of 3mm by using a puncher and is pasted on a liquid transfer gun head with a PVC pipe at the bottom to be used as a polymer film electrode for standby.

The device comprises a detection cell, a traditional polymer membrane electrode with internal liquid filling, an electrochemical external measuring device and an external magnetic field as shown in figure 5.

Example 12

Preparing a novel all-solid-state ion selective polymer membrane electrode: 170.32mg polyurethane, 170.32mg o-nitrophenyloctyl ether, 13.57mg cetyl trimethylammonium bromide, 0.619mg tetradodecyl ammonium tetrakis (4-chlorophenyl) borate were dissolved in 3mL tetrahydrofuran and stirred well. And (3) dropwise adding 10 mu L of membrane solution onto the solid electrode, and airing.

The device comprises a detection cell, a novel all-solid-state ion selective polymer membrane electrode, an electrochemical external measuring device and an external magnetic field as shown in figure 6.

Example 14

DNA (ACGTTGACGCTGGGTGCCCGGTTTGTGGTGCGAGTGTTGTGT) carries negative charges in Tris-hydrochloric acid buffer solution (1mM, pH 7) to obtain DNA buffer solution, magnetic material wrapped by nano-gold is added into the prepared DNA buffer solution, mixed incubation is carried out for 60 minutes, after magnetic separation and washing, 10 mu L of DNA is added into a working electrode of which a printed electrode is arranged in a detection cell, and the measured open-circuit potential is marked as E1; adding a solution of positively charged polypeptide (RRRRRRRRR) to mask the DNA from negativityElectric charge, incubation for 60 minutes, magnetic separation, and then adding 10 mu L of the mixture into a working electrode with a printed electrode placed in a detection cell, and measuring open-circuit potential and recording as E2; adding oxytetracycline (1.0 × 10) capable of reacting with DNA ^-6 M), incubating for 60 minutes, carrying out magnetic separation, then adding 10 mu L of the solution into a working electrode with a printed electrode placed in a detection cell, and recording the open-circuit potential as E3;

the results show that E2 is obviously reduced compared with E1, E3 is obviously increased compared with E2, but is still smaller than E1; the negative charge of DNA is masked by the polypeptide with positive charge, and the composite solution is reacted with oxytetracycline to further change the potential of the polymer membrane, so that the qualitative/quantitative potential determination of the oxytetracycline can be realized.

Example 15

The difference from the embodiment 14 is that,

adding a magnetic material modified by a specific functional group into a prepared DNA-1 (GTGCAGCGATGTTTCCGGTGC) disodium hydrogen phosphate-citric acid buffer solution, mixing and incubating for 60 minutes, performing magnetic separation, washing, adding 10 mu L of the mixture into a working electrode with a printed electrode in a detection cell, and measuring the open-circuit potential as E1; adding DNA-2 (GGCAGGACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT) disodium hydrogen phosphate-citric acid buffer solution partially matched with the DNA, incubating for 60 minutes, performing magnetic separation, washing, adding 10 mu L of the buffer solution to a working electrode with a printed electrode in a detection cell, and measuring the open-circuit potential as E2; adding oxytetracycline (1.0 × 10) capable of reacting with DNA-2 ^-6 M), incubating for 60 minutes, taking 10 mu L of the mixture after magnetic separation, adding the mixture into a working electrode with a printed electrode placed in a detection cell, and recording the measured open-circuit potential as E3;

the results show that E2 is obviously increased compared with E1, and E3 is obviously reduced compared with E2 and still larger than E1; through the interaction of oxytetracycline and DNA-2, the polymer membrane potential is further changed, and qualitative/quantitative potential measurement of oxytetracycline can be realized.

Example 16

The difference from the embodiment 15 is that,

adding gold-coated magnetic material into prepared DNA-1 (GTGCAGCGATGTTTCCGGTGC) potassium dihydrogen phosphate-sodium hydroxide buffer solution, mixing, incubating for 60 min, magnetically separating, and adding DNA-2 (GGC) partially matched with the DNAAGGACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT) potassium dihydrogen phosphate-sodium hydroxide buffer solution, incubating for 60 min, performing magnetic separation, washing, adding 10 μ L of the buffer solution to a working electrode with a printed electrode in a detection cell, and measuring open-circuit potential as E1; adding a DNA-3 (CTACTCTCATCCGTCACA) buffer solution partially matched with the DNA-2, incubating for 60 minutes, carrying out magnetic separation, washing, adding 10 mu L of the buffer solution into a working electrode with a printed electrode placed in a detection cell, and measuring the open-circuit potential as E2; adding oxytetracycline (1.0X 10) capable of reacting with DNA-2 ^-6 M), incubating for 60 minutes, carrying out magnetic separation, then adding 10 mu L of the solution into a working electrode with a printed electrode placed in a detection cell, and recording the open-circuit potential as E3;

the result shows that E2 is obviously increased compared with E1, and E3 is obviously reduced compared with E2 and is smaller than E1; through the interaction of the oxytetracycline and DNA-2, DNA-3 is replaced, the potential of the polymer membrane is further changed, potential signal amplification is realized, and qualitative/quantitative potential measurement of the oxytetracycline can be realized.

Example 16

Selecting a DNA aptamer sequence CATCCGTCACACCTGCTCCACCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC with selective recognition function on sulfanilamide, and marking the DNA aptamer sequence with biotin according to the prior art, namely biotin-CATCCGTCACACCTGCTCCA-CCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC; and then detecting sulfanilamide:

sulfonamide was detected by the potentiometric sensor obtained in example 1, and an open circuit potential measurement technique was used for the measurement. A phosphate buffer solution (1mM, pH 7) containing DNA was prepared, and mixed with streptavidin (streptavidin) -modified magnetic beads (commercially available), and after incubation for 30min, the beads were washed 2 times with 1mM phosphate buffer solution (containing 1mM sodium chloride) having a pH of 7.4 to prepare DNA-modified magnetic beads. 10. Mu.L of DNA-modified magnetic beads were added dropwise to the electrode, and the open-circuit potential E1 was measured.

The sulfanilamide was formulated in a conventional manner to different concentrations (1.0X 10) ^-6 、1.0×10 ^-7 、1.0×10 ^-8 、1.0×10 ^{- 9} M) phosphate buffer solution;

and mixing the obtained 10 mu L of DNA modified magnetic beads with the obtained sulfanilamide solutions with different concentrations, incubating for one hour, washing for 2 times after incubation, and diluting to 10 mu L. And (3) dropwise adding 10 mu L of the diluted solution containing sulfanilamide with different concentrations onto an electrode for potential measurement to obtain the potential change E2 of bacteria with different concentrations.

And calculating the potential change (the potential difference of E1 and E2) caused by the DNA modified magnetic beads on the electrode before and after incubation with the sulfanilamide, and plotting the logarithm of the sulfanilamide concentration to draw a standard curve.

As can be seen from the above potential measurement of sulfanilamide, the added sulfanilamide is recognized and bound by the corresponding aptamer DNA, resulting in the change of the aptamer DNA charge density before and after incubation, and the potential difference value is gradually increased along with the increase of the sulfanilamide concentration.

Example 17

The difference from example 16 is that:

selecting a DNA aptamer sequence TGGGGGTTGAGGCTAAGCCGA with selective recognition effect on aminoglycoside antibiotics (kanamycin), and marking the DNA aptamer sequence with biotin according to the prior art, namely biotin-TGGGGGTTGAGGCTAAGCCGA; kanamycin was detected.

From the above-mentioned potential measurement available for kanamycin, the added kanamycin is recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, and the potential difference gradually increases with the increase in kanamycin concentration.

Example 18

The difference from example 16 is that:

selecting a DNA aptamer sequence ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGT-GGTAG with selective recognition effect on amide alcohol antibiotics (chloramphenicol), and labeling the DNA aptamer sequence with biotin according to the prior art, namely biotin-ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAG; and then detecting chloramphenicol. From the above-mentioned potential measurement of chloramphenicol, added chloramphenicol was recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, and the potential difference gradually increased with the increase in chloramphenicol concentration.

Example 19

The difference from example 16 is that:

selecting a DNA aptamer sequence TCTCTGAGCCCGGGTTATTTCAGGGGGA with selective recognition effect on quinolone antibiotics (enrofloxacin), and marking the DNA aptamer sequence with biotin according to the prior art, namely biotin-TCTCTGAGCCCGGGTTATTTCAGGGGGA; and detecting the enrofloxacin. From the above potential measurement of enrofloxacin, the added enrofloxacin is recognized and bound by the corresponding aptamer DNA, causing the change of the aptamer DNA charge density before and after incubation, and the potential difference value gradually increases with the increase of the enrofloxacin concentration.

Example 20

The difference from example 16 is that:

selecting a DNA aptamer sequence AGGAATTCACGTCTCACTGGATTCACGCACGC-CAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG with selective recognition effect on macrolide antibiotics (erythromycin), and marking the DNA aptamer sequence with biotin according to the prior art, namely biotin-AGGAATTCACGTCTCACTGGATTCACGCACGCCAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG; and then detecting the erythromycin. From the above potential measurement of erythromycin, the added erythromycin is recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, and the potential difference gradually increases with the increase in the erythromycin concentration.

Example 21

The difference from example 16 is that:

selecting a DNA aptamer sequence GTACTTAATTTGAGGTGACGGGCACGTGAAACAGGCGAG with a selective recognition effect on protein (trypsin), and labeling the DNA aptamer sequence with biotin according to the prior art, namely biotin-GTACTTAATTTGAGGTGACGGGCACGTGAAACAGGCGAG; further, trypsin was detected. From the above-mentioned potential measurement with trypsin, the added trypsin is recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, and the potential difference gradually increases with the increase in the trypsin concentration.

Example 22

The difference from example 16 is that:

selecting DNA aptamer sequence CACTTTCCGGTTAATTTATGCTCTACCCGTCCACCT-ACCG with selective recognition effect on virus (B.1.1.7SARS-CoV-2), and labeling it with biotin according to the prior art, namely biotin-CACTTTCCGGTTAATTTATGCTCTACCCGTCCACCTACCG; further, B.1.1.7SARS-CoV-2 was detected. From the above potential measurement in B.1.1.7SARS-CoV-2, the added B.1.1.7SARS-CoV-2 was recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, and the potential difference gradually increased with the increase in the concentration of B.1.1.7SARS-CoV-2.

Example 23

The difference from example 16 is that:

selecting a DNA aptamer sequence TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC with selective recognition effect on bacteria (E.coli), and marking the DNA aptamer sequence with biotin, namely biotin-TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC, according to the prior art; coli was further detected. From the above potential measurement on e.coli, the added e.coli is recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, with the potential difference gradually increasing with the increase in e.coli concentration.

Example 24

The difference from example 16 is that:

heavy metal ion (Pb) is selected ²⁺ ) DNA aptamer sequence GGTTGGTGTGGTTGG with selective recognition function, and is marked by biotin according to the prior art, namely biotin-GGTTGGTGTGGTTGG; and then for Pb ²⁺ And (6) detecting. From the above-mentioned point of Pb ²⁺ Potential measurement of added Pb ²⁺ Is recognized and bound by the corresponding aptamer DNA, causing a change in the aptamer DNA charge density before and after incubation, with Pb ²⁺ The potential difference value gradually increases with the increase of the concentration.

Example 25

The difference from example 2 is that:

the device comprises a detection cell, a printed electrode, an electrochemical external measuring device and an external magnetic field as shown in figure 3; the printed electrode is arranged in the detection cell, a magnetic field (a magnet with different fixed magnetic field strengths) is applied, and a working electrode and a reference electrode of the printed electrode are respectively connected with an electrochemical external measuring device. The working electrode ion-selective polymer membrane was obtained in the manner described in example 1 above, and the uniformly stirred polymer membrane was introduced into a glass cup having an inner diameter of 5cm and fixed on a glass plate, and after the tetrahydrofuran was volatilized, the membrane was cut into a small disk having a diameter of 3mm using a punch and attached to a pipette tip having a PVC pipe at the bottom to form a polymer membrane electrode.

Example 26

The difference from example 2 is that:

the device comprises a detection cell, a printed electrode, an electrochemical external measuring device and an external magnetic field as shown in figure 3; the printed electrode is arranged in the detection cell, an external magnetic field (an electromagnet with fixed and adjustable magnetic field intensity) is applied, and a working electrode and a reference electrode of the printed electrode are respectively connected with an electrochemical external measuring device. The working electrode ion-selective polymer membrane was obtained in the preparation method described in example 1 above, and 10 μ L of the membrane solution stirred uniformly was dropped on the solid electrode, and dried to obtain a polymer membrane electrode.

Example 27

The difference from the principle that the Aptamer (Aptamer) and the target substance in the above embodiment are bound with high affinity and strong specificity through covalent bond, hydrogen bond, van der waals force, hydrophobic interaction, electrostatic attraction, etc., resulting in conformational change of the Aptamer, causing change in charge density thereof, and performing direct potential detection is that:

the principle and the method are that partial base complementary pairing is carried out by introducing other single-stranded DNA and the single-stranded DNA fixed on the magnetic beads, and then the single-stranded DNA on the magnetic beads is combined with a target substance to cause complementary strand substitution, so that the charge density of the DNA on the magnetic beads is changed to carry out direct potential detection.

Example 28

The difference from example 27 is that:

the principle and the method are that partial base complementary pairing is carried out by introducing other single-stranded DNA and the single-stranded DNA fixed on magnetic beads, and then the introduced single-stranded DNA is combined with a target substance to cause complementary strand substitution, so that the charge density of the DNA on the magnetic beads is changed to carry out direct potential detection.

The examples are not limited to the above examples and include those in which the target is detected by covalent bonds, hydrogen bonds, van der waals forces, proteins such as hydrophobic interaction and electrostatic attraction, which bind to aptamers (aptamers) with high affinity and strong specificity, { epsilon-p protein, betSub>A lactamase enzyme protein, betSub>A 1-arrestin, betSub>A 0-thrombin protein, alphSub>A-CGRP protein, alphSub>A-bungarotoxin and cardiotoxin, alphSub>A 6 betSub>A 4 protein, alphSub>A 4 integrin, yes-related protein (YAP), YAP WW1 protein, XMRVRT protein, XISub>A protein, WWP1 protein, WT and M3 enzyme proteins, VWF A1 domain protein, VSGs protein, VP35 protein, VP1 protein, von Willebrand factor protein, vitamin D protein, virally encoded hemagglutinin protein, viral tat protein, vero cytotoxic protein, vascular endothelial growth factor protein vascular endothelial growth factor Sub>A (VEGF-Sub>A) protein, vascular endothelial growth factor VEGF165 protein, VCLD protein, vascular endothelial growth factor (VEGF x 165) protein, vc2 protein, vasopressin protein, VASN protein, vascular growth factor receptor 2 (VEGFR 2) protein, vanillin protein, vacciniSub>A virus protein, USP14 protein, urinary creatinine protein, upSub>A protein, UCH37 protein, U1 Sub>A protein, tyrosine kinase-7 (PTK 7) protein, tumor necrosis factor-alphSub>A (TNF α) protein, tryptophan protein, TRPV1 protein, muscle calcium T (TnT) protein, muscle calcium (TI) protein, tropomyosin-related kinase receptor type B (TrkB) protein, tropomyosin, triclosan protein, transferrin receptor protein, TRPV1 protein, thrombospondin protein, and the like, transcription factor proteins, TPB proteins, TB proteins, tospovirus N protein, tomSys protein, toll-like receptor (TLR) 3, 7, 8 and 9 proteins, tobramycin protein, TO 1-biotin protein, TNF-a protein, TLR-9 protein, tim-3 protein, thrombospondin-1 (TSP-1) protein, thrombin, apoE, PAI-1, igE, lysozyme, carcinoembryonic antigen, hirudin, prostate Specific Antigen (PSA) and 4-1BB protein, thioflavin T (ThT) protein, soluble interleukin 2 receptor a (sIL-2 Ra) protein, N-peptide and U1A protein, mAb 2G12 protein, human immunodeficiency virus reverse transcriptase (HIV-1 RT) protein, arabidopsis thaliana thiC TPP protein, TGF-beta protein, TGFR 2 protein, TGF-Beta1 protein, tfR protein, TF AP-1 (5 ECdsAP 1) protein, TEV protease gene protein, tetraphenylvinylene protein, tetramethylrhodamine protein, tetracycline (TET) protein, tetR protein, tenascin-C protein, TCF4 protein, TCF and beta-catenin protein, TBP protein, tb protein, tau441 protein, TATA-box binding protein, RNA hairpin protein of interest, taq polymerase protein, T.cruzi flagellar protein, sgammac protein, synaptosome associated protein 25 (cSNAP-25), surface glycoprotein (gp 120), sulforhodamine B protein, sulfadimetridine protein, STX protein, streptavidin (SA) protein, STIV protein, STIP1 protein, stat5 protein, STAT3 dimerization domain protein, STAT1 protein, STAT protein, staphylococcal Enterotoxin B (SEB), beta-lactoglobulin beta-catenin protein, beta-bungarotoxin protein, sphingosine 1-phosphate protein, soluble interleukin 5 receptor protein of SPC protein, smpB protein, small malachite green protein, SMAD4 protein, SLAMF7 protein, sip1 protein, siglec-5 protein, sialyl-Lewis-X protein, shp2 protein, new Hill's receptor protein, sGP protein, serum albumin pre-fibrillar amyloid aggregates, serotonin protein, sec7 domain of cytomucin protein, sec7 domain of cytohesin-1 protein, SEC7 domain of cytohesin-1 protein, SEB protein, sea protein, selectin, SCs protein, SARS-CoV-2 protein, SARS-CoV helicase protein, SAM-I riboswitch protein, salmonella invasion protein A (SipA) protein, salmonella enteritidis protein, salmonella serotype typhimurium protein, salmonella typhimurium protein, salmonella typhi protein, and Mycoplasma orientalis protein, salmonella proteins, SAH proteins, S-adenosylmethionine proteins, S845GluA1AMPA proteins, S100A8 proteins, S100 calbindin B (S100B. Gene ID # 6285), S.typhimurium proteins, staphylococcus aureus proteins, and methods of making and using the same RTA protein, RT enzyme protein, RT protein, rstA protein, rrm protein, RNase E protein, RNAP protein, RNA-dependent RNA polymerase (RdRp) protein, RNA-dependent RNA polymerase protein RNA helicase protein DHX9 protein, RIG-I protein, ricin, ribozyme protein, riboflavin protein, rHuEPO-a protein, rHuEPO protein, rhoGEFs protein, rhoA protein, rhD antigen protein, rev protein, RET protein, rep N-terminal protein, relA protein, recombinant human erythropoietin-alpha (rHuEPO-alpha) protein, rb1 protein, rasGASH 3 protein, lei Pamei<xnotran> , RAP1 , raf-1 , RAD52 , RAC , G , IgG , PTK7 , PSMA , PSA , prPs , prP , , 1B (PTP 1B) , E , C, A, (PSMA) , , , 1 , (proGRP) , PQQGDH , PPV , (PCBs) , - α -D- (a-PDGA) - , p-nosyl-l- (PSL) , pLDH , , , CVD , pfLDH , pfEMP1 , Ara h1 , PE , PD-L1 , PDGFR β , DGF-BB, PDGF-AB, PDGF-AA , PCSK9 , PCNA , PC-3 , pBT-SmpB pBT-ArfA , , (PRR) , , PAP , PAT , pAF , PAE , p4E , P2DNA IV (Dpo 4) , P16 , P , (OTC) , OX40 , A (OTA) , , OPN , (ZP) , , </xnotran> OFL protein, nucleolin receptor protein, nucleocapsid protein, NS5B viral protein, NS3 protease domain protein, NS2 protein, NS1 protein, nox protein, novel recombinant anti-neuregulin protein, norovirus protein, nogo-66 receptor (NgR) protein, nonstructural 5B (NS 5B) polymerase, NMM protein, nicotinic acetylcholine receptor, N-glycosylated peptide fragment of vascular endothelial growth factor protein, NGAL protein, NF-. Kappa.B protein, NFAT5 protein, neuropeptide nociceptin/orphan FQ (N/OFQ) protein, neomycin-B, neomycin protein, NCp7 protein, NCL protein, nampt protein, myoglobin protein, myelin Basic Protein (MBP), myelin protein, mutS protein, mutant p53 protein, mutant Huntington protein, musashi-1 (MSI 1) protein, murine norovirus protein, murine nociceptin-1 protein, murine MUc-mut 1 (MUC 1) protein, MTC 8 protein, mTC 8 protein, MTC4 protein, MT1-MMP protein, MSCs protein, MS2-MBP protein, MS2-CP protein, PP7 protein, MS2 coat protein, MRP1-CD28 protein, MREs protein, MPT64 protein, mPAPs protein, mouse Lcn2 (mLcn 2) protein, morin protein, monomeric L-selectin protein, MLL1 protein, MK protein, mitochondrial cytochrome c protein, miRNA-21 protein, minT1-LF protein, mIgG2b protein, miRNA protein, microcystin-LR (MC-LR) protein, METH protein, mEND protein, MDM2 protein, mCRP protein, MCP-1 protein, MCF-7R cell protein, mb protein, manLAM and M.H 37Rv protein, manganese ion protein, MAGE-A3 protein, M2-PK protein, M1 influenza virus protein, lysozyme analyte protein, lysozyme zxft 8978 protein ergotamine, ergoline and wheat keratin proteins, lysine proteins, lymphocytic leukemia proteins, lung cancer receptor tyrosine kinase AXL protein, L-selectin protein, LPSs protein, listeria monocytogenes protein, listeria protein, lipopolysaccharide protein, lipoarabinomannan protein, LH protein, leishmania protein, lead (II) protein, low density lipoprotein, latelet-derived growth factor (PDGF) protein, L-argininamide protein, LAG3 protein, lactoferrin, lactate dehydrogenase protein, ku70 protein, KRAzR protein, KRAS protein, kinase protein, kanamycin protein, K88 protein, K Homologous (KH) protein, JAB1/CSN5 protein, IXa protein, isoleucine protein, isoflavone aglycone, berberine hydrochloride, jatrorrhizine hydrochloride, acaridine, geniposide, oxymatrine and ziziposide A proteins, irinotecan protein, IRES protein, intracellular cancer-associated microRNA protein, intrinsic A protein, interleukin 6 receptor (IL-6R) protein, interferon-gamma protein, interferon protein, integrin alpha 6 beta 4 protein, insulin Receptor (IR) protein, IMP3 protein, immunoglobulin M (IgM) -and immunoglobulin D (IgD) protein, immunoglobulin E (IgE) protein, ricin, imidacloprid protein, ile, tryptophan, his, phe, tyrosine, arginine and leucine protein, IL-6R domain 3 (IL-6R D3) protein, IL-6R protein, IL-6 protein, IL4Ra protein, IL-1 alpha protein, IL-17A protein, IL-10 receptor protein, igG protein, IGF-IIR protein, IGF-I protein, DNA binding protein 1 inhibitor, ICOS protein, hypoxanthine protein<xnotran>, 1 (HIV-1) Rev , α - , α (TNF-a) , (TfR) , 7 (PTK 7) , HPA-1a , LIN28A , (HLE) , (IL) -10 4-1BB , 6 , 1 , (HIV RT) , H4 , 2 (HER 2) , E2F3 , I (cTnI) , B CD20 , a- (Tmb) , ApoA1 , 8-oxoG DNA 1 (hOGG 1) , HTLV-I Rex , hTERT , hspX , HSP90, α V β 5 Contactin-1 , hsp70 , hsp27 , HSL , HSF1 , hsc70 , HRP-II , HPV-16L1VLPs , HPV16E7 , (HCP) , (HL) , hMMP-9 , HMGB1 , HIV-RT , HIV-1Tat , HIV-1RT , HIV-1RNase H , HIV-1 (RT) , HIV-1Rev , HIV-1PR , </xnotran> <xnotran> HIV-1 , HIV-1 , HIV-1 gp120, HIV (HIVRT) , HIV , his , hIgE , HIF-1 α , hfq , hFc1 , hepG2 , (cMet) , , , , (HA) , , HE4 , HDV , HCV-CRE , HCV NS3 , HCV , , hCG , , HBsAg , HA , HAT , H4-K16Ac , H3 , H1-HA1 , GST-5363 zxft 5363 13 , GRK2 , gremlin-1 , G- , GPCR-AAB , GPC3 , GP120 , , , , gluR1 , GLP-1 , , gk-S15 , GFP , GDH , (GLuc) , G </xnotran>alectin-1 protein, FQ protein, FOXM1 protein, folate protein, fokI protein, flavin mononucleotide protein, FIXa protein, FIX protein, fibronectin, fibrin D-dimer, fibrinogen and fibrinogen gamma chain protein, FGFR3 protein, FGFR1 protein, FGFR protein, ferritin producing protein, fc domain protein, FB1 protein, factor IXa protein, factor IX protein exosome proteins, exosite I proteins, eukaryotic initiation factor 4A (eIF 4A) proteins, ethanolamine proteins, ETA-AABs proteins, estrogen receptor alpha (ERa) proteins, E-selectin proteins, escherichia coli thioredoxin a (TrxA) proteins, escherichia coli RNA polymerase, ESAT-6 proteins, ERa proteins, ERBB3 receptor proteins, ERBB2 proteins, EPO proteins, epirubicin proteins, epinephrine proteins, EPO proteins, and the like epidermal growth factor receptor variant III protein, epidermal Growth Factor Receptor (EGFR) protein, epCAM protein, enhanced green fluorescent protein (eGFP) protein, endotoxin protein, endothelin B-type receptor (ETBR) protein, endoglin, enantiomer protein, eIF4G protein, eIF4E protein, eIF4A protein, EGFRvIII protein, EGFR1, MMP7, CA6, KIT, CRP, C9 and SERPINA3 protein, eEF1A protein, escherichia coli protein AlkB protein, dxl protein, D-vasopressin protein, HBV core protein, ds-Px protein, drosophila B52 protein, D-peptide protein, doxorubicin (DOX) protein, dopamine protein, DOCK8 protein, DNA polymerase protein, HBDMI protein, DFHBI and fluorescent protein, dexamethasone (N) protein, DENV-2EDIII protein, DENV-2ED3 protein, DEHP protein, DEC205 protein, cytohesin-2 protein, cytoadhesin protein, cytochrome C protein, cystatin C protein, cypB protein, cyclophilin B protein, cyclin-dependent protein kinase protein, cyclin-dependent kinase 2 (Cdk 2) protein, CTX3 protein, CTx protein, cTnI protein, CTLA-4 protein, C-terminal peptide protein, cry1Ab protein, CRP protein, CRMP2 protein, creatine Kinase MB (CKMB) protein, creatine kinase type B protein, C-reactive protein (CRP) protein, clara protein, CPS protein, cortisol protein, COM protein, large intestine cancer protein, colon cancer receptor protein, coenzyme A (CoA) protein, codeine protein, coat protein (MCP), coagulation factor VIII protein, C-Met and CD71 protein, cMb protein, cJun protein, cyclopropyl proteinA flexacin protein, a cholesterol esterase protein, a chloramphenicol protein, a CFP-10.ESAT-6 heterodimer protein, a CFP-10 protein, a ceruloplasmin (Cp) protein, a cell surface receptor protein, a cell surface nucleolin, a cell surface antigen protein, a cell nucleus protein, a cell membrane protein tyrosine kinase 7 (PTK 7) protein, a CDK2 protein, a CD71 protein, a CD30 receptor protein, a CD28 protein, a CD200R1 agonist protein, a CD200R1 protein, a CD19 protein, a CD18 protein, a CD133 protein, a CD117 protein, a CD109 protein, a CD105 protein, a CCR5 protein, a CCK-BR protein, a CC chemokine receptor 5 (CCR 5) protein, a CBD3 protein, a cathepsin E protein, a Carbonic Anhydrase IX (CAIX) protein, a caprolactam protein, a CAP protein, a cancer biomarker PDGF-BB protein cancer biomarkers MUC-1 protein, campylobacter jejuni protein, campylobacter protein, camptothecin (CPT) protein, canoglobin protein, calcitonin gene-related peptide (CGRP) protein, calcineurin protein, CA125 protein, CA I protein, C5a and C5a-desArg protein, C4-HSL protein, btuB protein, BSA protein, cloth Lu Danbai, bovine thrombin protein, bovine prion protein (bPrP) protein, bovine pregnancy related glycoprotein (bPAGs) protein, bantt protein, boNT/A protein, bleomycin (BLM) protein, bisphenol A (BPA) protein, biofilm protein, BIM protein, bevacizumab protein, beta1-AAB protein, beta1 (II) -AABs protein, benzylguanine protein, bcs1 protein, B cell lymphoma protein, B cell activator receptor (BAFF-R) protein, BAFF-R protein, bacillus thuringiensis spore protein, bacillus anthracis spore protein, B1-CT protein, bacillus subtilis glyQS T-box protein, B.cereus fluoride riboswitch protein, A beta binding partner protein, A beta 42 protein, A beta 40 protein, AVP protein, ATP and GTP protein, ATP and ADA protein, a-synuclein, arsenin, argininamide and related ligands, argininamide protein, ara h1 protein, AR protein, APC protein, anti-lysozyme protein, anti-FLAG M2 antibody protein, annexin A2 (ANXA 2) protein, angiopoietin-2 and thrombospondin-2, angiopoietin protein, ang2 protein, ang1 protein, beta amyloid peptide protein, amyloid protein, AMPA receptor protein, AML1 protein, AML cell protein, aminoglycoside protein, amino protein, AMGs protein, ALP proteinPL2 protein, alpha4 integrin protein, ALP protein, alkB protein, aldehyde inactivated botulinum neurotoxin type A protein, AK protein, AIB1-CID protein, AGR2 protein, AGEs protein, ag85 protein, AFM1 protein, aflatoxin M1 protein, aflatoxin B2 protein, aflatoxin B1 protein, advanced glycation end product (AGE) protein, adipocyte protein, ADH protein, adenosine deaminase (addition) protein, adenosine protein, adenine and guanine protein, acute myeloid leukemia 1 (AML 1) protein, active protein kinase protein, activated Protein C (APC) protein, acetylcholinesterase protein, ABF1 protein, ABA protein, A549 cell protein, 8-OhdG protein, 5' -AMP-activated protein kinase (AMPK) protein, 4-1BB-OPN protein, 4-1BB protein, 3CD protein, 2G12 protein, 8978-trinitrotoluene 891 protein, 890-beta-AM protein, 17 beta-globin protein, (CGRP-16-beta-S) protein, ribosomal RNA-beta-protein, viruses { vesicular stomatitis virus, venezuelan equine encephalitis virus, staphylococcus aureus virus, respiratory syncytial virus, prion, mycotoxin patulin virus, murine norovirus, methicillin-resistant staphylococcus aureus (MRSA) virus, influenza virus (a/California/2009/07, h1n1), influenza virus, huNoV virus, human cellular prion, HIV-1 virus, HIV virus, hepatitis B and C virus (HBV, HCV virus), hepatitis delta virus, hepatitis B virus, hepatitis C virus, and the like, H5N1 virus, H5N1 avian influenza virus, escherichia coli virus, apple Stem pock point virus (ASPV), vibrio parahaemolyticus virus }, bacteria { Salmonella typhimurium, pseudomonas aeruginosa, vibrio alginolyticus, listeria monocytogenes, lactobacillus acidophilus, escherichia coli, mycobacterium tuberculosis, salmonella enterica, bacillus anthracis, }, cells { CD30 cell marker }, cells { Vibrio parahaemolyticus cells, vascular Smooth Muscle Cells (VSMC) cells, vibrio alginolyticus cells, U87MG cells, U87-EGFRvIII cells, polymorphonuclear myelogenous suppressor cells (PMN-MDSCs) cells, TIM 3-expressing lymphocytes, TICs cells, TESA cells, T cells, staphylococcus aureus (S.aureus) cells, SMMC-7721 cells, skeletal muscle cells, SK-BR-3 breast cancer cells, salmonella typhimurium cells, salmonella O8 cells, salmonella cells, SA cells, S.typh cellsS.parathyphi a cells, grouper Brain (GB) cells, ramos target cells, prostate cancer stem cells, prostate cancer cells (DU 145), breast cancer cells (MCF-7), cervical cancer cells (HeLa), porcine endothelial precursor cells, PMDC05 cells, PL45 cells, PCa-3M-1E8 cells, PANSORBIN cells, PANC-1 tumor cells, pseudomonas aeruginosa cells, ovarian cancer cells, NK-type leukemia (NKL) cells, mycoplasma infected cells, mycobacterium tuberculosis cells, MRSA cells, mouse tumor vascular endothelial cells (mTECs), maver-1 lymphoma cells, LH86 cells, K562 leukemia cancer cells, HUVEC cells, human embryonic kidney 293 (HEK-293) cells, HSPB1 cells, HL-60 cells, HER-2 cells, hepG2 cells, hepatoma cells, HCT116 cells, EB cells, gram negative bacteria cells, gastric cancer cells, nasopharyngeal virus positive cancer cells, AGS cells, escherichia coli O157 cells: H7 cells, escherichia coli O111 cells, E6/E7-HTECs cells, circulating Tumor Cells (CTC), CHO-K1 cells, CEM-CCRF cells, CCRF-CEM cells, campylobacter jejuni cells, burkitt lymphoma cells, bifidobacterium cells, BG1 cells, A549 lung cancer cell line subgroup cells, A549 lung cancer cells, A2780Rcis cell line cells }, heavy metal ions { As (III), zinc ions, uranium ions, titanium ions, silver ions, platinum (II) ions, potassium ions, pb (II) ions, mercury ions, mg (II) ions, gadolinium (III) ions, cadmium (II) ions }, antibiotics { Chloramphenicol (CAP) }, penicillin G (PEN), patulin (PAT), ofloxacin (OFL), neomycin, tobramycin, kanamycin, enrofloxacin, doxorubicin, daunomycin, ciprofloxacin (CIP), ampicillin (AMP) }, small molecules { alpha-bungarotoxin, zinc oxide, zearalenone (ZEN), fumonisin, tumor necrosis factor a, tumor Necrosis Factor (TNF), trpRS, bisphenol A }, other compounds { zeolite imidazole scaffold-8 (ZIF-8), tryptophan, transferrin receptor (TfnR), the trans-activating response element of HIV-1 (TAR), thrombin (Thr), adenosine Triphosphate (ATP), tetrahydrocannabinol (THC), tetanus toxoid, tDNA, TAR BRU variants, sudan III, stilbenterone, steroid testosterone, STAT3, ssDNA, spiropyran isomers, saxitoxin, SAM-1, SAM clam VI, xm alpha, preQ1, radon, dopamine, P-selectin, tea-leaf toxin, ochratoxin (HAT), the drug (ochratoxin), and the like<xnotran> -A (OTA), , , , microRNA-34a (miR-34 a), -LR, , , , , L- , β - , (IPS), invA , hsp70-ATP, hoechst , HIV RNAs, , (FMN), S- (SAM), GMP (c-di-GMP), d-RNA G- (rG 4), , (CYN), , 5' - (AMP), , (BNP), (BT) HD-73 , (ABA), , 2- , , , , , , (ZEN), (VWF), D, B, , (TA), T, (TO 1), (TPP), (TPP), TGF- β II (T β RII), , , , T-2 , , (SDM), , , , S- , </xnotran> S-adenosylmethionine (SAM), ricin A chain (RTA), quinine, poly (etherimide) (PEI), polystyrene (PS), poly [ ethylene-co- (vinyl acetate)]<xnotran> (PEVA), , , N- IX (NMM), N- (Neu 5 Ac), T-2, mucin-1, MUC-1, MSK, mnSOD, (MTA), , (MA), meCbl, MC-LR, MBI-eEF1 5754 zxft 5754, , (MG), l- (l-3252 zxft 3252), l- , (LPS), L- , l- , l- (l-Arm), , (HBP), hnRNP A1, hGlyR α 1, hEPOR, , , -AGEs, , , , , GDF8, GDF11, galNAc, (FMN), , , fePP, , (DCF), DFHO (3532 zxft 3532- -4- -2- ) , (DNR), DFHBI, DFHBDI, DFBHI-1 3425 zxft 3425 (AP-ATP (R4 e), , </xnotran>Sex T lymphocyte related antigen, cytochrome c (Cyt c), cytidine, cylindroendosperm, cyclic diguanosine monophosphate, cyclic dinucleotide, cyclic double GMP, cyclic AMP-GMP, coenzyme A

Cocaine, clenbuterol (CLB), citrulline, cholera toxin, cellulose, cdTe quantum dots, cdGMP, carboxymethylcellulose (CMC), carbofuran, c-AMP-GMP, B-type natriuretic peptide (BNP), boNT, A β oligomers, azaaromatics, atrazine, a-syn oligomers, arsenite, aod pfl riboswitch compounds, α -hemolysin, aldicarb compounds, AFB1 compounds, AFB2 compounds, acetamiprid compounds, 5-hydroxytryptophan (5-HTP), 3'-cGAMP, 3,5-difluoro-4-hydroxybenzylidene imidazolidinone (HBDFI), 2' -deoxyguanosine compounds, 2,4,6-trinitrotoluene (TNT), 19-Nortestosterone (NT), 17- β -estradiol compounds } and the like. />

Sequence listing

<110> institute of tobacco pipe coastal zone of Chinese academy of sciences

<120> method and apparatus for detecting DNA and target substance using DNA as recognition molecule

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgttgacgc tggtgcccgg ttgtggtgcg agtgttgtgt 40

<210> 2

<211> 76

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

catccgtcac acctgctcca cccactacac tcatccgtca cacctgctcc ccccactggg 60

tgttcggtcc cgtatc 76

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgggggttga ggctaagccg a 21

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acttcagtga gttgtcccac ggtcggcgag tcggtggtag 40

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctctgagcc cgggttattt caggggga 28

<210> 6

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aggaattcac gtctcactgg attcacgcac gccaaggact gcacttaagg ttagatagcc 60

ccatgcagtg agtcaggata tcg 83

Claims (10)

1. A method for detecting DNA and a target substance using DNA as a recognition molecule, comprising the steps of: the method comprises the steps of detecting a target object containing DNA, DNA derivatives or using DNA as identification molecules in a sample to be detected, and utilizing a potential sensor of an ion exchanger doped polymer membrane ion selective electrode to change the potential of the ion exchanger doped polymer membrane electrode through the charge of the DNA or the interaction between the DNA identification molecules and the target object, thereby realizing the quantitative/qualitative detection of the DNA, the DNA derivatives or the target object using the DNA as the identification molecules in the sample.

2. The DNA and the method for detecting a target substance using the DNA as a recognition molecule according to claim 1, wherein:

when the object to be detected is DNA or a derivative thereof, adding the object to be detected into a buffer solution to enable the DNA or the derivative thereof in the object to be detected to have negative charges; then adding a DNA fragment matched with the DNA to be detected into the liquid to be detected to change the charge of the DNA of the object to be detected, and further changing the potential of the polymer membrane electrode doped with the ion exchanger, thereby realizing the quantitative/qualitative detection of the DNA and the DNA derivative; wherein the buffer solution is pH 6.8-8.0;

when the object to be detected takes DNA as the recognition molecule, the DNA is taken as the recognition molecule and the signal conduction molecule to interact with a corresponding target object in the liquid to be detected, so that the DNA charge and the charge density are changed, and further the potential of the polymer membrane electrode doped with the ion exchanger is changed, thereby realizing the detection of the target object; wherein, the recognition molecule DNA is added into a buffer solution, and the buffer solution is a buffer solution with the pH value of 6.8-8.0.

3. The method for detecting DNA and a target substance using DNA as a recognition molecule according to claim 2, wherein: when the DNA is detected, the DNA fragment matched with the DNA or the DNA serving as the recognition molecule is fixed on a magnetic material to obtain the DNA functionalized magnetic bead.

4. The DNA and the method for detecting a target substance using the DNA as a recognition molecule according to claim 3, wherein: the object to be detected is a target object taking DNA as a recognition molecule, the recognition molecule is fixed on a magnetic material to obtain a DNA functionalized magnetic bead, and the DNA is used as the recognition molecule and a signal conduction molecule and interacts with a target object in the liquid to be detected, so that the DNA functionalized magnetic bead changes the potential of the polymer membrane electrode doped with the ion exchanger, and the qualitative/quantitative detection of the target object in the liquid to be detected is realized.

5. The method for detecting DNA and a target substance using DNA as a recognition molecule according to claim 4, wherein: the DNA or DNA derivatives in the DNA functionalized magnetic beads interact with the target object in the sample to be detected, so that the DNA charges and charge density in the DNA functionalized magnetic beads are changed, the amount of the DNA on the DNA functionalized magnetic beads effectively extracted to the polymer sensitive membrane is reduced under the action of an external magnetic field, the potential of the electrode is changed, and the qualitative/quantitative detection of the target object in the liquid to be detected is realized.

6. The method for detecting DNA and a target substance having DNA as a recognition molecule according to any one of claims 1 to 5, wherein: the polymer film comprises, by weight, 20-80% of a film matrix, 20-80% of a plasticizer, and the balance of an ion exchanger; the ion exchanger is an anion exchanger; wherein the anion exchanger is tridodecyl methyl ammonium chloride, tridodecyl methyl ammonium chloride derivatives, tritetradecyl methyl ammonium chloride derivatives, tetradodecyl ammonium chloride derivatives, hexadecyltrimethyl ammonium bromide derivatives, hexadecyltrimethyl ammonium chloride derivatives, didodecyldimethylammonium chloride or didodecyldimethylammonium chloride derivatives, guanidine or guanidine derivatives.

7. The method for detecting DNA and a target substance having DNA as a recognition molecule according to any one of claims 1 to 5, wherein: the target is an antibiotic, a protein, a virus, a bacterium, a cell, a heavy metal ion, an antibiotic or a small molecule.

8. An apparatus for the detection method according to claim 1, wherein: the potentiometric sensor with the ion exchanger doped polymer membrane ion selective electrode comprises a detection cell, a working electrode, a reference electrode, a counter electrode and an electrochemical external measuring device; the working electrode is an ion exchanger doped polymer membrane ion selective electrode and is arranged in the detection cell, and the working electrode, the reference electrode and the counter electrode are respectively connected with an electrochemical external measuring device.

9. The apparatus of claim 8, wherein: the ion selective electrode of the polymer membrane doped with the ion exchanger is a polymer membrane with the doped ion exchanger adhered to the bottom of the electrode; or, a conducting layer or a transduction layer can be additionally arranged between the bottom of the electrode and the polymer film.

10. The apparatus of any one of claims 8-9, wherein: the device includes an externally applied magnetic field.

Images