CN115896277A

CN115896277A - Tumor detection method and application

Info

Publication number: CN115896277A
Application number: CN202110903691.6A
Authority: CN
Inventors: 王辉; 何东华; 刘蕊
Original assignee: Singlera Genomics Shanghai Ltd; Jiangsu Fuyuan Biotechnology Co ltd
Current assignee: Singlera Genomics Shanghai Ltd; Jiangsu Fuyuan Biotechnology Co ltd
Priority date: 2021-08-06
Filing date: 2021-08-06
Publication date: 2023-04-04

Abstract

The application relates to a tumor detection method and application, in particular to a method for confirming the existence of liver tumor, evaluating the formation or formation risk of the liver tumor and/or evaluating the progress of the liver tumor, which comprises the step of evaluating the existence and/or the content of the modification state of a DNA region or a fragment thereof where a marker gene is located in a sample to be detected. The present application also relates to nucleic acids, nucleic acid sets and/or kits for assessing the state of modification of a region of DNA, and methods of making the same.

Description

Tumor detection method and application

Technical Field

The application relates to the field of biomedicine, in particular to a tumor detection method and application.

Background

The search for more efficient tumor markers is always an important direction in tumor-related research, and the plasma free DNA detection technology based on liquid biopsy has higher requirements for the discovery of the tumor markers. The basic principle is as follows: after the tumor cells die, free DNA is released to enter blood, and the tumor signals in the very early stage can be detected by detecting the relevant information of the tumor cells such as DNA mutation, DNA methylation, miRNA, histone modification and the like in the blood. It has been found that DNA methylation change may occur earlier than DNA mutation, and is a more effective detection marker for early tumor screening.

However, in the early cancer, the number of tumor cells released into the blood is very small, and the field is in urgent need to find more effective detection markers for liver tumor. Therefore, there is a need to develop a method and/or a kit that can efficiently read the epigenetic information from extracellular free DNA in very limited amounts in biological samples by detecting accurate, stable, and effective biomarkers of liver cancer, and preferably, the method should be easily deployed and reliably applied in hospital clinical laboratories.

Disclosure of Invention

In one aspect, the present application provides a method for confirming the presence of, assessing the risk of or forming a liver tumor, and/or assessing the progression of a liver tumor, comprising determining the presence and/or amount of a modification state of a DNA region or fragment thereof in which a BCAT1 gene is located in a test sample.

In one aspect, the present application provides a method for assessing the methylation status of a liver tumor-associated DNA region, comprising determining the presence and/or amount of a modification status of a DNA region or fragment thereof in which a BCAT1 gene is located in a test sample.

In one embodiment, the DNA region is derived from human chr12:24964295-25102393.

In one embodiment, the method further comprises obtaining nucleic acids in the test sample.

In one embodiment, the nucleic acid comprises cell-free nucleic acid.

In one embodiment, the test sample comprises a tissue, cell, and/or bodily fluid.

In one embodiment, the sample to be tested comprises plasma.

In one embodiment, the method further comprises transforming the DNA region or fragment thereof.

In one embodiment, the base having the modified state and the base not having the modified state form different species upon transformation.

In one embodiment, a base with said modified state is not substantially altered after transformation, and said base without said modified state is altered to another base different from said base after transformation, or is cleaved after transformation.

In one embodiment, the base comprises cytosine.

In one embodiment, the modification state comprises a methylation modification.

In one embodiment, the additional base comprises uracil.

In one embodiment, the conversion comprises conversion by a deaminating agent and/or a methylation sensitive restriction enzyme.

In one embodiment, the deaminating agent comprises bisulfite or an analog thereof.

In one embodiment, the method of determining the presence and/or amount of a modification state comprises confirming the presence and/or amount of a substance formed after the transformation of a base having the modification state.

In one embodiment, the method of determining the presence and/or amount of a modification state comprises determining the presence and/or amount of a region of DNA or fragment thereof having the modification state.

In one embodiment, the presence and/or amount of a DNA region or fragment thereof having the modified state is determined by a fluorescent Ct value detected by the fluorescent PCR method.

In one embodiment, the presence of, or the risk of, liver tumor formation is determined by confirming the presence of a modification state of the DNA region or fragment thereof and/or the presence of a higher level of a modification state of the DNA region or fragment thereof relative to a reference level.

In one embodiment, the method further comprises amplifying the DNA region or fragment thereof in a test sample prior to determining the presence and/or amount of the modification of the DNA region or fragment thereof.

In one embodiment, the amplification comprises PCR amplification.

In another aspect, the present application also provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, comprising determining the presence and/or amount of a modification state in a test sample selected from the following group of DNA regions, or complements thereof, or fragments thereof: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application also provides a method for determining the methylation state of a DNA region, comprising determining the presence and/or amount of a modification state selected from the following DNA regions, or complementary regions thereof, or fragments thereof, in a test sample: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In one embodiment, the method comprises providing a nucleic acid capable of binding a nucleic acid comprising a region selected from the group consisting of the DNA regions of: the amino acid sequence of SEQ ID NO: 1. SEQ ID NO:8 and SEQ ID NO:12.

in one embodiment, the method comprises providing a nucleic acid capable of binding a nucleic acid comprising a region selected from the group consisting of the DNA regions of: human chr12:25102016-25102110 in origin, human chr12:25101992-25102093 in origin, human chr12:25079051-25079133 in origin and human chr12:25056027-25056134 in origin.

In one embodiment, the method comprises providing a nucleic acid selected from the group consisting of: SEQ ID NO: 2. the amino acid sequence of SEQ ID NO: 5. SEQ ID NO:9 and SEQ ID NO:13.

in one embodiment, the method comprises providing a nucleic acid selected from the group consisting of: SEQ ID NO:3 and 4, SEQ ID NO:6 and 7, SEQ ID NO:10 and 11 and SEQ ID NO:14 and 15.

In one embodiment, the disease comprises a tumor.

In one embodiment, the nucleic acid comprises cell-free nucleic acid.

In one embodiment, the test sample comprises plasma.

In one embodiment, the base comprises cytosine.

In one embodiment, the modification state comprises a methylation modification.

In one embodiment, the additional base comprises uracil.

In one embodiment, the amplification comprises PCR amplification.

In another aspect, the present application also provides a nucleic acid comprising a sequence capable of binding to the DNA region of the BCAT1 gene, or the complementary region thereof, or a region transformed therefrom, or a fragment thereof.

In another aspect, the present application provides a method for preparing a nucleic acid comprising designing a nucleic acid capable of binding to a DNA region in which a BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a modified state of the above-mentioned fragment, based on the DNA region, or a complementary region thereof, or the above-mentioned transformed region, or the above-mentioned fragment.

In another aspect, the present application also provides a nucleic acid set comprising a sequence capable of binding to a region of DNA in which the BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a fragment thereof.

In another aspect, the present application provides a method for preparing a nucleic acid set comprising designing a nucleic acid set capable of amplifying a DNA region in which a BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a modified state of the above-mentioned fragment, based on the DNA region, or the complementary region thereof, or the above-mentioned region transformed therefrom, or the above-mentioned fragment.

In another aspect, the present application also provides a kit comprising a nucleic acid of the present application and/or a set of nucleic acids of the present application.

In another aspect, the present application also provides the use of the nucleic acid of the present application, the nucleic acid set of the present application and/or the kit of the present application in the preparation of a disease detection product.

In another aspect, the present application also provides the use of a nucleic acid of the present application, a nucleic acid set of the present application and/or a kit of the present application for the preparation of a substance for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease.

In another aspect, the present application also provides the use of a nucleic acid of the present application, a nucleic acid set of the present application and/or a kit of the present application for the preparation of a substance for determining the modification status of said DNA region or fragment thereof.

In another aspect, the present application also provides a nucleic acid, a nucleic acid set and/or a kit for determining the modification status of a DNA region, comprising a DNA region in which a BCAT1 gene is located or a fragment thereof, for use in the preparation of a substance for confirming the presence of a liver tumor, assessing liver tumor formation or risk of formation and/or assessing the progression of a liver tumor.

In another aspect, the present application also provides a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region comprising a DNA region selected from the group consisting of: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application also provides the use of the nucleic acids of the DNA region of BCAT1 gene, or the region transformed therefrom, or the fragments thereof, and the combination of the above nucleic acids, in the preparation of a substance for confirming the presence of liver tumor, assessing liver tumor formation or risk of formation, and/or assessing the progression of liver tumor.

In another aspect, the present application also provides the use of a nucleic acid selected from the group consisting of DNA regions of the following group, or complements thereof, or regions derived from transformation of the foregoing, or fragments of the foregoing, and combinations of the foregoing, in the preparation of a substance for confirming the presence of a disease, assessing the development or risk of development of a disease, and/or assessing the progression of a disease: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application also provides a storage medium recording a program that can execute the method of the present application.

In another aspect, the present application also provides an apparatus comprising the storage medium of the present application.

In one embodiment, the apparatus of the present application further comprises a processor coupled to the storage medium and configured to execute based on a program stored in the storage medium to implement the method of the present application.

Other aspects and advantages of the present application will be readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application have been shown and described in the following detailed description. As those skilled in the art will recognize, the disclosure of the present application enables those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention as it is directed to the present application. Accordingly, the descriptions in the drawings and the specification of the present application are illustrative only and not limiting.

Drawings

The specific features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates will be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings. The drawings are briefly described as follows:

FIG. 1 shows the comparison of DNA methylation signals of tissues beside cancer, cancer and leukocytes at the detection site.

FIG. 2 shows the comparison of the DNA methylation signals of the test sites in control plasma and plasma of liver cancer.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification.

Definition of terms

In the present application, the term "BCAT1" generally refers to a gene or its expression product. For example, BCAT1

The UniProt accession number for the (Branched-chain-amino-acid aminotransferase) protein may be P54687. In the present application, BCAT1 may encompass its raw form, any processed form, variants thereof or a substance comprising a functionally active fragment thereof.

In the present application, the term "sample to be tested" generally refers to a sample that is to be tested. For example, one can detect the presence or absence of a modification in one or more gene regions in a test sample.

In the present application, the term "cell-free nucleic acid" or "cfDNA" generally refers to DNA in a sample that is not contained within cells when collected. For example, cell-free nucleic acid may not refer to DNA that is rendered non-intracellular by the in vitro disruption of a cell or tissue. For example, cfDNA can include both normal and cancer cell-derived DNA. For example, cfDNA may be obtained from blood or plasma ("circulatory system"). For example, cfDNA can be released into the circulatory system through secretion or cell death processes, such as cell necrosis or apoptosis.

In the present application, the term "complementary nucleic acid" generally refers to a nucleotide sequence that is complementary compared to a reference nucleotide sequence. For example, complementary nucleic acids can be nucleic acid molecules, optionally with opposite orientations. For example, the complementarity may refer to having the following complementary associations: guanine and cytosine; adenine and thymine; adenine and uracil.

In the present application, the term "DNA region" generally refers to a sequence of two or more covalently bonded naturally occurring or modified deoxyribonucleotides. For example, a DNA region of a gene can refer to the location of a particular deoxyribonucleotide sequence in which the gene is located, e.g., the deoxyribonucleotide sequence encodes the gene. For example, a DNA region of the present application encompasses the full length of the DNA region, its complement, or fragments thereof. A

In the present application, the term "modified state" generally refers to a modified state that a gene fragment, nucleotide or base thereof has in the present application. For example, the modification state in the present application may refer to the modification state of cytosine. For example, a gene fragment having a modified state of the present application may have altered gene expression activity. For example, the modification state in the present application may refer to a methylation modification that a base has. For example, the modification state of the present application may mean that a methyl group is covalently bonded to the cytosine 5' carbon position of the CpG region of genomic DNA, and may be, for example, 5-methylcytosine (5 mC). For example, the modified state may refer to the presence or absence of 5-methylcytosine ("5-mCyt") within the DNA sequence.

In the present application, the term "methylation" generally refers to the methylation state that a gene fragment, nucleotide or base thereof has in the present application. For example, the DNA fragment in which the gene is located in the present application may have methylation on one or more strands. For example, the DNA fragment in which the gene is located in the present application may have methylation at one site or at multiple sites.

In the present application, the term "converting" generally refers to the transformation of one or more structures into another structure. For example, the transformation of the present application may be specific. For example, cytosine that does not have a methylation modification can be converted to another structure (e.g., uracil), and cytosine that has a methylation modification can be converted to be substantially unchanged. For example, cytosines that do not have a methylation modification can be cleaved upon conversion, and cytosines that have a methylation modification can be substantially unchanged upon conversion.

In this application, the term "deaminating agent" generally refers to a substance that has the ability to remove an amino group. For example, a deaminating agent can deaminate unmodified cytosine.

In the present application, the term "bisulphite" generally refers to an agent that can distinguish between regions of DNA that have a modified state and regions that do not. For example, the bisulfite salt can include a bisulfite salt, or an analog thereof, or a combination of the foregoing. For example, bisulfite can deaminate the amino group of an unmodified cytosine to distinguish it from a modified cytosine. In the present application, the term "analog" generally refers to substances having similar structures and/or functions. For example, an analog of bisulfite may have a similar structure to bisulfite. For example, an analog of bisulfite can refer to an agent that can likewise distinguish between regions of DNA that have a modified state and regions that do not have a modified state.

In the present application, the term "methylation sensitive restriction enzyme" generally refers to an enzyme that selectively digests nucleic acid based on the methylation state of its recognition site. For example, for restriction enzymes that specifically cleave when the recognition site is unmethylated, cleavage may not occur, or cleavage may be at a significantly reduced efficiency, when the recognition site is methylated. For restriction enzymes that specifically cleave when the recognition site is methylated, cleavage may not occur, or with significantly reduced efficiency, when the recognition site is unmethylated. For example, a methylation-specific restriction enzyme can recognize a sequence containing a CG dinucleotide (e.g., cgcg or cccggg).

In the present application, the term "tumor" generally refers to cells and/or tissues that exhibit at least partial loss of control in normal growth and/or development. For example, common tumor or cancer cells may often be deprived of contact inhibition and may be invasive and/or have the ability to metastasize. For example, the tumor of the present application may be benign or malignant.

In the present application, the term "progression" generally refers to the change in the disease from a less severe state to a more severe state. For example, tumor progression may include an increase in the number or severity of tumors, the degree of metastasis of cancer cells, the rate of growth or spread of cancer, and the like. For example, tumor progression may include stages of progression of such cancer from a less severe state to a more severe state, e.g., progression from stage I to stage II, from stage II to stage III, and the like.

In the present application, the term "formation" generally refers to the presence of a lesion in an individual. For example, when a tumor is formed, the individual may be diagnosed as a tumor patient.

In the present application, the term "fluorescent PCR" generally refers to a quantitative or semi-quantitative PCR technique. For example, the PCR technique may be real-time quantitative polymerase chain reaction, or kinetic polymerase chain reaction. For example, PCR amplification can be used to quantitate the amount of the initial target nucleic acid by means of an intercalating fluorescent dye or a sequence-specific probe, which may contain a fluorescent reporter that is detectable only by hybridization to the target nucleic acid.

In the present application, the term "PCR amplification" generally refers to a polymerase chain amplification reaction. For example, PCR amplification in the present application may comprise any polymerase chain amplification reaction currently known for DNA amplification.

In this application, the term "fluorescent Ct value" generally refers to a measurement that quantitatively or semi-quantitatively assesses a target nucleic acid. For example, it may refer to the number of amplification reaction cycles that the fluorescence signal has undergone when it reaches a set threshold.

Detailed Description

In one aspect, the present application provides a method for confirming the presence of, assessing the risk of or forming a liver tumor, and/or assessing the progression of a liver tumor, which may comprise determining the presence and/or amount of a modification state of a DNA region or fragment thereof in which a BCAT1 gene is located in a test sample. For example, the method of the present application may comprise confirming the presence or absence of a liver tumor based on the determination of the presence and/or amount of the modified state of the DNA region or fragment thereof in which the BCAT1 gene is present in the test sample. For example, the methods of the present application may comprise assessing whether liver neoplasia is diagnosed based on the determination of the presence and/or amount of the modified state of the DNA region or fragment thereof in which the BCAT1 gene is located in the test sample. For example, the method of the present application may comprise assessing whether there is a risk and/or the level of risk of liver neoplasia is diagnosed based on the determination of the presence and/or amount of the modified state of the DNA region or fragment thereof in which the BCAT1 gene is located in the test sample. For example, the method of the present application may comprise assessing the progression of a liver tumor based on the determination of the presence and/or amount of the modified state of the DNA region or fragment thereof in which the BCAT1 gene is located in the test sample.

In another aspect, the present application provides a method for assessing the methylation status of a liver tumor-associated DNA region, which can comprise determining the presence and/or amount of a modification status of a DNA region or a fragment thereof in which the BCAT1 gene is located in a test sample. For example, the methylation state of the liver tumor-associated DNA region is assessed based on the determination of the presence and/or amount of the modified state of the DNA region or fragment thereof in which the BCAT1 gene is present in the test sample. For example, the methylation status of a liver tumor-associated DNA region can refer to a confirmed presence of methylation of the DNA region or an increased amount relative to a reference level, and can be correlated with the occurrence of a liver tumor.

For example, the DNA region of the present application may be derived from human chr12:24964295-25102393. For example, the genes of the present application can be described by their names and their chromosomal coordinates. For example, the chromosome coordinates may be consistent with Hg19 version (or referred to as "Hg19 coordinates") of the human genome database released 2 months 2009. For example, the DNA region of the present application may be derived from the region defined by Hg19 coordinates.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of a specific sub-region of the DNA region in which the BCAT1 gene is located, or a complementary region thereof, or a modified state of a fragment thereof, in a test sample.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of a modification state in a test sample selected from the following group of DNA regions, or complements thereof, or fragments thereof: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363. For example, the method of the present application may comprise confirming the presence or absence of a disease based on the determination of the presence and/or amount of the modified state of the DNA region, or a complementary region thereof, or a fragment thereof in the test sample. For example, the methods of the present application may comprise assessing whether a disease formation is diagnosed based on the determination of the presence and/or amount of the modified state of the DNA region, or a complementary region thereof, or a fragment thereof, in the test sample. For example, the method of the present application may comprise assessing whether there is a risk and/or the level of risk of a diagnosed disease based on the determination of the presence and/or amount of the modified state of the DNA region, or the complementary region thereof, or the fragment thereof in the test sample. For example, the method of the present application may comprise assessing the progression of the disease based on the determination of the presence and/or amount of the modified state of the DNA region, or a complementary region thereof, or a fragment thereof, in the test sample.

In another aspect, the present application provides a method of determining the methylation state of a DNA region, which can comprise: determining the presence and/or amount of modification states in a test sample that may be selected from the following group of DNA regions, or their complements, or fragments thereof: derived from human chr12:25101630-25102393, derived from human chr: 12. For example, confirmation of the presence of methylation or an increased amount relative to a reference level of the DNA region can be correlated with the occurrence of a disease. For example, a DNA region of the present application may refer to a particular segment of genomic DNA. For example, a DNA region of the present application may be designated by a gene name or a set of chromosomal coordinates. For example, a gene can have its sequence and chromosomal location obtained by referring to its name, or can have its sequence and chromosomal location determined by referring to its chromosomal coordinates. The present application, using the methylation state of these particular DNA regions as a series of analytical indicators, can provide significant improvements in sensitivity and/or specificity and can simplify the screening process. For example, "sensitivity" may refer to the proportion of positive results that are correctly identified, i.e., the percentage of individuals correctly identified as having the disease in question; "specificity" may refer to the proportion of negative results that are correctly identified, i.e. the percentage of individuals correctly identified as not having the disease in question.

In another aspect, the present application provides a method of determining the methylation state of a DNA region, which can comprise: and determining the existence and/or the content of the DNA region derived from the human chr12:25101630-25102393, or the complementary region thereof, or the modification state of the fragment in the sample to be tested.

In another aspect, the present application provides a method of determining the methylation state of a DNA region, which can comprise: determining the existence and/or the content of the DNA region from human chr:12 25078661-25079410, or the complementary region thereof, or the modified state of the fragments.

In another aspect, the present application provides a method of determining the methylation state of a DNA region, which can comprise: and determining the existence and/or the content of the DNA region derived from the human chr12: 25054781-25056363, or the complementary region thereof, or the modified state of the fragment.

The DNA regions of the present application may comprise all forms of these molecules as well as fragments or variants thereof. For example, a variant may comprise at least 80%, at least 85%, at least 90%, 95%, 98%, or 99% sequence identity to a region of DNA described herein, and a variant may comprise one or more deletions, additions, substitutions, inversions, and the like. For example, the modification status of the variants described herein may achieve the same assessment results. The DNA regions of the present application may comprise any other mutation, polymorphic variation or allelic variation in its entirety.

For example, the methods of the present application may comprise: providing a nucleic acid capable of binding to a nucleic acid which may comprise a region selected from the group consisting of the following DNA regions, or the complement thereof, or a region transformed therefrom, or a fragment thereof: SEQ ID NO: 1. SEQ ID NO:8 and SEQ ID NO:12.

for example, the method of the present application may comprise: providing a polypeptide capable of binding to SEQ ID NO:1, or a complementary region thereof, or a region obtained by transformation thereof, or a fragment thereof. For example, the methods of the present application may comprise: providing a polypeptide capable of binding to SEQ ID NO:8, or a complementary region thereof, or a region obtained by transformation thereof, or a fragment thereof. For example, the methods of the present application may comprise: providing a polypeptide capable of binding to SEQ ID NO:12, or a complementary region thereof, or a region obtained by transformation thereof, or a fragment thereof.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease, and/or assessing the progression of a disease, which may comprise: determining the presence and/or amount of modification states in a test sample that may be selected from the following group of DNA regions, or their complements, or fragments thereof: human chr12:25102016-25102110 in origin, human chr12:25101992-25102093 in origin, human chr12:25079051-25079133 in origin and human chr12:25056027-25056134 in origin.

In another aspect, the present application provides a method of determining the methylation state of a DNA region, which can comprise: determining the presence and/or amount of modification states in a test sample that may be selected from the following group of DNA regions, or their complements, or fragments thereof: human chr12:25102016-25102110 in origin, human chr12:25101992-25102093 in origin, human chr12:25079051-25079133 in origin and human chr12:25056027-25056134 in origin.

For example, the methods of the present application may comprise: providing a nucleic acid capable of binding to a nucleic acid which may comprise a region selected from the group consisting of the following DNA regions, or the complement thereof, or a region transformed therefrom, or a fragment thereof: human chr12:25102016-25102110 in origin, human chr12:25101992-25102093 in origin, human chr12:25079051-25079133 in origin and human chr12:25056027-25056134 in origin.

For example, one or more of the above regions may serve as an amplification region and/or a detection region.

For example, the method of the present application may comprise: providing a nucleic acid or a complementary nucleic acid thereof, or a fragment thereof, which may be selected from the group consisting of: the amino acid sequence of SEQ ID NO: 2. SEQ ID NO: 5. the amino acid sequence of SEQ ID NO:9 and SEQ ID NO:13. for example, the nucleic acid may be used to detect a target region. For example, the nucleic acid may serve as a probe.

For example, the method of the present application may comprise: providing SEQ ID NO:2 or a complementary nucleic acid thereof, or a fragment thereof. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr12: 25101630-25102393. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr12: 25102016-25102110.

For example, the method of the present application may comprise: providing SEQ ID NO:5 or a complementary nucleic acid thereof, or a fragment thereof. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr12: 25101630-25102393. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr12: 25101992-25102093.

For example, the method of the present application may comprise: providing SEQ ID NO:9 or a nucleic acid complementary thereto, or a fragment thereof. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr: 12. For example, the nucleic acid can be used as a probe for detecting a region of DNA derived from human chr12: 25079051-25079133.

For example, the methods of the present application may comprise: providing SEQ ID NO:13 or a nucleic acid complementary thereto, or a fragment thereof. For example, the nucleic acid can be used as a probe for detecting a DNA region derived from human chr12: 25054781-25056363. For example, the nucleic acid can be detected as a probe for a DNA region derived from human chr12:25056027-25056134.

For example, the methods of the present application may comprise: providing a nucleic acid set which may be selected from the group consisting of: the amino acid sequence of SEQ ID NO:3 and 4, SEQ ID NO:6 and 7, SEQ ID NO:10 and 11 and SEQ ID NO:14 and 15. For example, the nucleic acid set can be used to amplify a target region. For example, the nucleic acid set may serve as a primer set.

For example, the methods of the present application may comprise: providing SEQ ID NO:3 and 4 or a complementary nucleic acid set thereof, or a fragment thereof. For example, the nucleic acid set can be used as a primer set for amplification of a DNA region derived from human chr12: 25101630-25102393. For example, the nucleic acid set can be directed against a nucleic acid sequence derived from human chr12:25102016-

25102110 and amplifying the DNA region.

For example, the methods of the present application may comprise: providing SEQ ID NO:6 and 7 or a complementary nucleic acid set thereof, or a fragment thereof. For example, the nucleic acid set can be used as a primer set for amplification of a DNA region derived from human chr12: 25101630-25102393. For example, the nucleic acid set can be directed against a nucleic acid sequence derived from human chr12:25101992-

25102093 DNA region was amplified.

For example, the method of the present application may comprise: providing SEQ ID NO:10 and 11 or a complementary set of nucleic acids thereof, or a fragment thereof. For example, the nucleic acid set can be used as a primer set for amplifying a DNA region derived from human chr: 12. For example, the nucleic acid set can be used as a primer set for amplification of a DNA region derived from human chr12: 25079051-25079133.

For example, the methods of the present application may comprise: providing SEQ ID NO:14 and 15 or a complementary set of nucleic acids thereof, or a fragment thereof. For example, the nucleic acid set can be used as a primer set for amplifying a DNA region derived from human chr12: 25054781-25056363. For example, the nucleic acid set can be used as a primer set for amplifying a DNA region derived from human chr12:25056027-25056134.

For example, the disease may comprise a tumor. For example, the disease may comprise a solid tumor. For example, the disease may include any tumor such as a liver tumor.

For example, "complementary" and "substantially complementary" of the present application may include hybridization or base pairing or duplex formation between nucleotides or nucleic acids, e.g., between two strands of a double-stranded DNA molecule, or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid. Complementary nucleotides may typically be A and T (or A and U) or C and G. For two single-stranded RNA or DNA molecules, the nucleotides of one strand may be considered substantially complementary when they are aligned for optimal alignment and comparison with at least about 80% (typically at least about 90% to about 95%, even about 98% to about 100%) of the other strand when the nucleotides are aligned with the appropriate nucleotide insertions or deletions. In one aspect, two complementary nucleotide sequences are capable of hybridizing and may have less than 25% mismatches between inverted nucleotides, more preferably less than 15% mismatches, less than 5% mismatches, or no mismatches. For example, two molecules may hybridize under high stringency conditions.

For example, a modification state herein may refer to the presence, absence and/or amount of the modification state at a particular nucleotide or nucleotides within a DNA region. For example, the modification state of the present application may refer to the modification state of each base or each specific base (e.g., cytosine) in a specific DNA sequence. For example, the modification state of the present application may refer to a base pair combination and/or a modification state of a base combination in a specific DNA sequence. For example, the modification status of the present application may refer to information about the density of regional modifications in a particular DNA sequence (including the region of DNA in which the gene is located or a particular region fragment thereof), and may not provide precise positional information of where in the sequence the modifications occur.

For example, the modified state of the present application may refer to a methylated state or a state similar to methylation. For example, a state with or having a higher methylation can be associated with transcriptional silencing of a particular region. For example, a state with or having a higher methylation may be associated with being capable of being converted by a methylation specific conversion reagent (e.g., a deaminating reagent and/or a methylation sensitive restriction enzyme). For example, transformation may refer to being converted to other substances and/or being sheared or digested.

For example, the method can further comprise obtaining nucleic acids in the test sample. For example, the nucleic acid may comprise cell-free nucleic acid. For example, the test sample may comprise tissue, cells, and/or bodily fluids. For example, the test sample may comprise plasma. For example, the detection methods of the present application can be performed on any suitable biological sample. For example, the sample to be tested can be any sample of biological material, which can be derived from an animal, for example, but not limited to, cellular material, biological fluid (e.g., blood), effluent, tissue biopsy specimen, surgical specimen, or fluid that has been introduced into the animal's body and subsequently removed. For example, the sample to be tested of the present application may comprise a sample that has been subjected to any form of treatment after the sample has been isolated.

For example, the method may further comprise transforming the DNA region or fragment thereof. For example, by the transformation step of the present application, a base having the modified state and a base not having the modified state may form different substances after transformation. For example, a base with the modified state is not substantially altered after transformation, and the base without the modified state may be altered to another base different from the base after transformation (e.g., the other base may comprise uracil), or cleaved after transformation. For example, the base may comprise cytosine. For example, the modification state may comprise a methylation modification. For example, the conversion may comprise conversion by a deaminating agent and/or a methylation sensitive restriction enzyme.

For example, the deaminating agent can comprise bisulfite or an analog thereof. For example, sodium bisulfite or potassium bisulfite.

For example, the method may further comprise amplifying the DNA region or fragment thereof in a test sample prior to determining the presence and/or amount of the modification of the DNA region or fragment thereof. For example, the amplification may comprise PCR amplification. For example, amplification of the present application may comprise any of the known amplification systems. For example, the amplification step of the present application may be optional. For example, "amplification" may refer to a process that produces multiple copies of a desired sequence. "multiple copies" may refer to at least two copies. "copy" may not imply perfect sequence complementarity or identity to the template sequence. For example, the copies may include nucleotide analogs such as deoxyinosine, intentional sequence alterations (e.g., sequence alterations introduced by primers comprising sequences that are hybridizable but not complementary to the template), and/or sequence errors may occur during the amplification process.

For example, the method of determining the presence and/or amount of a modification state may comprise confirming the presence and/or amount of a substance formed after the transformation of a base having the modification state. For example, the method of determining the presence and/or amount of a modification state may comprise determining the presence and/or amount of a DNA region or fragment thereof having the modification state. For example, the presence and/or amount of a DNA region or fragment thereof having the modified state can be directly detected. For example, detection may be by: a region of DNA or fragment thereof having the modification state may have different properties during a reaction (e.g., an amplification reaction) than a region of DNA or fragment thereof not having the modification state. For example, in the fluorescent PCR method, a DNA region or a fragment thereof having the modified state may be specifically amplified and fluoresce; a region of DNA or fragment thereof that does not have the modification state may be substantially unamplified and emit substantially no fluorescence. For example, alternative methods of determining the presence and/or amount of species formed after the transformation of a base having the modified state may be included within the scope of the present application.

For example, the presence and/or amount of a DNA region or fragment thereof having the modified state can be determined by the fluorescent Ct value detected by the fluorescent PCR method. For example, the presence of, or the risk of, liver tumor formation may be determined by the presence of a modified state of the DNA region or fragment thereof and/or the presence of a higher amount of a modified state of the DNA region or fragment thereof relative to a reference level. For example, when the fluorescence Ct value of the test sample is lower relative to the reference fluorescence Ct value, the presence of the modification state of the DNA region or fragment thereof may be determined and/or the content of the modification state of the DNA region or fragment thereof may be determined to be higher than the content of the modification state in the reference sample. For example, the reference fluorescence Ct value can be determined by detecting a reference sample. For example, the presence of a modified state of the DNA region or fragment thereof may also not be excluded when the fluorescence Ct value of the test sample is higher or substantially equivalent relative to the reference fluorescence Ct value; when the fluorescence Ct value of the test sample is higher or substantially equivalent to the reference fluorescence Ct value, it may be confirmed that the content of the modified state of the DNA region or the fragment thereof is lower than or substantially equal to the content of the modified state in the reference sample.

For example, the present application may indicate the presence and/or amount of the modification state of a particular DNA region or fragment thereof by a cycle threshold (i.e., ct value), including, for example, the methylation level and a reference level of a test sample. For example, the Ct value can refer to the cycle number at which fluorescence of the PCR product can be detected above a background signal. For example, the Ct value may be inversely related to the initial amount of the target marker in the sample, i.e., the lower the Ct value, the greater the amount of the modified state of the DNA region or fragment thereof in the sample to be tested.

For example, a test sample having a Ct value that is the same or lower relative to its corresponding reference Ct value can be identified as having a particular disease, diagnosed as developing or at risk of developing a particular disease, or assessed as having a certain progression of a particular disease. For example, a test sample can be confirmed to be present, diagnosed or at risk of developing a particular disease, or assessed for some progression of a particular disease when the Ct value is at least 1 cycle, at least 2 cycles, at least 5 cycles, at least 10 cycles, at least 20 cycles, or at least 50 cycles lower than its corresponding reference Ct value.

For example, when the Ct value of a cell sample, tissue sample, or sample derived from a subject is the same or higher relative to its corresponding reference Ct value, it can be confirmed that a particular disease is not present, diagnosed or at risk of developing the particular disease, or assessed as a certain progression of the particular disease. For example, a cell sample, tissue sample, or subject-derived sample can be confirmed as absent, diagnosed with or at risk of developing a particular disease, or assessed for some progression of a particular disease when the Ct value is at least 1 cycle, at least 2 cycles, at least 5 cycles, at least 10 cycles, at least 20 cycles, or at least 50 cycles higher relative to its corresponding reference Ct value. For example, when the Ct value of a cell sample, tissue sample, or subject-derived sample is the same as its corresponding reference Ct value disease, the presence or absence of a particular disease can be confirmed, diagnosed as the development or non-development of a particular disease, with or without risk of development, or assessed as some progression of a particular disease, and at the same time a recommendation can be given that further testing is required.

For example, a reference level or control level in the present application may refer to a normal level or a healthy level. For example, the normal level can be the level of modification status of a region of sample DNA derived from a cell, tissue or individual without the disease. For example, when used in the assessment of a tumor, the normal level may be the level of modification status of a region of sample DNA derived from a cell, tissue or individual that is tumor-free. For example, when used in the evaluation of liver tumors, the normal level can be the level of modification status of a sample DNA region derived from a cell, tissue or individual without a liver tumor.

For example, a reference level in this application may refer to a threshold level at which a subject or sample is identified as present or absent a particular disease. For example, a reference level in this application may refer to a threshold level at which a subject is diagnosed as developing or at risk of developing a particular disease. For example, a reference level in this application may refer to a threshold level at which a subject is assessed for a certain progression of a particular disease. For example, when the modification state of a DNA region in a cell sample, tissue sample, or subject-derived sample is higher than or substantially equal to a corresponding reference level, e.g., where a reference level can refer to a modification state of a DNA region of a patient that does not have a particular disease, can be confirmed as the presence of the particular disease, diagnosed as the development of the particular disease or as having a risk of development, or assessed as some progression of the particular disease. For example, a and B herein "substantially equal" can mean that a differs from B by 1% or less, 0.5% or less, 0.1% or less, 0.01% or less, 0.001% or less, or 0.0001% or less. For example, the presence of, diagnosis of, or risk of developing a particular disease may be confirmed or assessed as a certain progression of a particular disease when the modification status of a DNA region in a cell sample, tissue sample, or subject-derived sample is at least 1%, at least 5%, at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, or at least 20-fold higher than a corresponding reference level. For example, a presence of a particular disease, a diagnosis of the formation of a particular disease or the risk of the formation, or an assessment of a certain progression of a particular disease may be confirmed when the modification status of a DNA region in a cell sample, a tissue sample, or a subject-derived sample is at least 1%, at least 5%, at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, or at least 20-fold above a corresponding reference level in at least one, at least two, or at least three of a plurality of assays.

For example, when the modification status of a DNA region in a cell sample, tissue sample, or subject-derived sample is lower than or substantially equal to a corresponding reference level, e.g., where a reference level can refer to the modification status of a DNA region of a patient with a particular disease, it can be confirmed that the particular disease is not present, diagnosed as developing or at risk of developing the particular disease, or assessed as some progression of the particular disease. For example, the absence of a particular disease, the diagnosis of the development of a particular disease or the risk of development, or the assessment of a certain progression of a particular disease may be confirmed when the modification status of a DNA region in a cell sample, a tissue sample, or a subject-derived sample is at least 1%, at least 5%, at least 10%, at least 20%, at least 50%, at least 100% below a corresponding reference level.

The reference level can be selected by one skilled in the art according to the desired sensitivity and specificity. For example, reference levels in various instances in the present application can be readily ascertained by one skilled in the art, such as from a limited number of attempts to ascertain suitable reference levels and/or suitable means for obtaining reference levels, e.g., reference levels can be derived from one or more reference samples, wherein the reference levels are obtained from experiments performed in parallel with experiments conducted to detect samples of interest. Alternatively, the reference levels may also be obtained in a database comprising a collection of data, standards or levels from one or more reference samples or disease reference samples. In some embodiments, the set of data, standards, or levels may be normalized or normalized so as to be available for comparison with data from one or more samples for reducing errors arising under different detection conditions.

For example, the reference levels may be derived from a database, which may be a reference database, e.g., including modification status levels of target markers and/or other laboratory and clinical data from one or more reference samples. For example, a reference database can be established by aggregating reference level data obtained from reference samples of healthy individuals and/or non-corresponding disease patient individuals (i.e., individuals known to be free of the disease). For example, a reference database may be established by aggregating reference level data obtained from reference samples of individuals with the respective disease undergoing treatment. For example, a reference database may be established by aggregating data obtained from reference samples of individuals at different stages of disease. For example, different stages can be evidenced by different levels of modification state of the markers of interest herein. One skilled in the art can also determine whether an individual suffers from or is at risk of suffering from a corresponding disease based on various factors, such as age, sex, medical history, family history, symptoms, and the like.

For example, the method of the present application may comprise the steps of: obtaining nucleic acid in a sample to be detected; transforming said DNA region or fragment thereof; confirming the presence and/or content of a substance formed after the transformation of the base having the modified state.

For example, the method of the present application may comprise the steps of: obtaining nucleic acid in a sample to be detected; transforming said DNA region or fragment thereof; amplifying the DNA region or the fragment thereof in a sample to be tested; confirming the presence and/or content of a substance formed after the transformation of the base having the modified state.

For example, the method of the present application may comprise the steps of: obtaining nucleic acid in a sample to be detected; treating DNA obtained from a sample to be tested with a reagent capable of distinguishing unmethylated sites from methylated sites in said DNA, thereby obtaining treated DNA; optionally amplifying said DNA region or fragment thereof in a test sample; quantitatively, semi-quantitatively or qualitatively analyzing the presence and/or content of the methylation state of the treated DNA in the sample to be tested; comparing the methylation level of the treated DNA in the test sample with a corresponding reference level, the presence of a particular disease, the diagnosis of the development or risk of development of a particular disease, or the assessment of a certain progression of a particular disease can be confirmed when the methylation status of the DNA region in the test sample is higher than or substantially equal to the corresponding reference level.

In another aspect, the present application provides a nucleic acid which may comprise a sequence capable of binding to the region of DNA in which the BCAT1 gene is located, or the complementary region thereof, or the region transformed therefrom, or a fragment thereof. For example, the nucleic acid can be any of the probes of the present application. In another aspect, the present application provides a method for preparing a nucleic acid, which may comprise designing a nucleic acid capable of binding to a DNA region in which a BCAT1 gene is present, or a complementary region thereof, or a region transformed therefrom, or a modified state of the above-mentioned fragment, based on the DNA region, or the complementary region thereof, or the above-mentioned transformed region, or the above-mentioned fragment. For example, the method of preparing the nucleic acid may be any suitable method known in the art.

In another aspect, the present application provides a nucleic acid set which may comprise a sequence capable of binding to a region of DNA in which the BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a fragment thereof. For example, the nucleic acid set can be any of the primer sets of the present application. In another aspect, the present application provides a method for preparing a nucleic acid set, which may comprise designing a nucleic acid set capable of amplifying a DNA region in which a BCAT1 gene is present, or a complementary region thereof, or a region transformed therefrom, or a modified state of the above fragment, based on the DNA region, or the complementary region thereof, or the above transformed region, or the above fragment. For example, the method of preparing the nucleic acids in the nucleic acid set can be any suitable method known in the art. For example, the methylation state of a target polynucleotide can be assessed using a single probe or primer configured to hybridize to the target polynucleotide. For example, the methylation state of a target polynucleotide can be assessed using a plurality of probes or primers configured to hybridize to the target polynucleotide.

In another aspect, the present application provides a kit that can comprise a nucleic acid of the present application and/or a set of nucleic acids of the present application. For example, a kit of the present application may optionally contain a reference sample for a corresponding use or provide a reference level for a corresponding use.

Diagnostic method and preparation use

In another aspect, the present application provides the use of a nucleic acid as described herein, a nucleic acid set as described herein and/or a kit as described herein, in the manufacture of a product for the detection of a disease.

In another aspect, the present application provides a method of disease detection, which can comprise providing a nucleic acid of the present application, a nucleic acid set of the present application, and/or a kit of the present application.

In another aspect, the present application provides nucleic acids as described herein, nucleic acid sets as described herein and/or kits as described herein, which can be used for disease detection.

In another aspect, the present application provides the use of a nucleic acid as herein, a nucleic acid panel as herein and/or a kit as herein for the preparation of a substance that can confirm the presence of a disease, assess the development or risk of development of a disease and/or assess the progression of a disease.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing disease development or risk of development and/or assessing progression of a disease, which may comprise providing a nucleic acid of the present application, such as a nucleic acid panel of the present application and/or a kit of the present application.

In another aspect, the present application provides nucleic acids as described herein, nucleic acid sets as described herein and/or kits as described herein, which can be used to confirm the presence of a disease, assess the development or risk of development of a disease and/or assess the progression of a disease.

In another aspect, the present application provides the use of a nucleic acid as herein, a nucleic acid set as herein and/or a kit as herein for the preparation of a substance that allows the determination of the modification status of said DNA region or fragment thereof.

In another aspect, the present application provides a method of determining the modification status of said DNA region or fragment thereof, which may comprise providing a nucleic acid of the present application, a nucleic acid set as described herein and/or a kit of the present application.

In another aspect, the present application provides a nucleic acid as herein, a nucleic acid set as herein and/or a kit as herein, which can be used to determine the modification status of said DNA region or fragment thereof.

In another aspect, the present application provides a nucleic acid, a nucleic acid set and/or a kit for determining the modification status of a DNA region comprising a DNA region or a fragment thereof in which a BCAT1 gene is located, for use in the preparation of a substance that can be used to confirm the presence of, assess the risk of, and/or assess the progression of a liver tumor.

In another aspect, the present application provides methods of confirming the presence of a liver tumor, assessing liver tumor formation or risk of formation, and/or assessing the progression of a liver tumor, which may comprise providing a nucleic acid, nucleic acid set, and/or kit for determining the modification status of a DNA region comprising the DNA region in which the BCAT1 gene is located, or a fragment thereof.

In another aspect, the present application provides a nucleic acid, a nucleic acid set and/or a kit for determining the modification status of a DNA region, which can be used to confirm the presence of a liver tumor, to assess the formation or risk of formation of a liver tumor and/or to assess the progression of a liver tumor, the DNA region for determination comprising the DNA region in which the BCAT1 gene is located or a fragment thereof.

In another aspect, the present application provides a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region, which DNA region may comprise a DNA region selected from the group consisting of: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application provides methods of confirming the presence of, assessing the risk of or forming a liver tumor, and/or assessing the progression of a liver tumor, which may comprise providing a nucleic acid, a set of nucleic acids, and/or a kit for determining the modification status of a DNA region, which may comprise a DNA region selected from the group consisting of: derived from human chr12:25101630-25102393, derived from human chr: 12.

In another aspect, the present application provides a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region, which may be used for confirming the presence of a liver tumor, assessing liver tumor formation or risk of formation and/or assessing the progression of a liver tumor, which DNA region may comprise a DNA region selected from the group consisting of: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application provides nucleic acids of the DNA region of the BCAT1 gene, or a region transformed therefrom, or a fragment thereof, and combinations thereof.

In another aspect, the present application provides the use of a nucleic acid of the DNA region of the BCAT1 gene, or a region transformed therefrom, or a fragment thereof, and combinations thereof, in the preparation of a substance that can be used to confirm the presence of a liver tumor, to assess liver tumor formation or risk of formation, and/or to assess liver tumor progression.

In another aspect, the present application provides methods for confirming the presence of, assessing the risk of or forming a liver tumor, and/or assessing the progression of a liver tumor, comprising providing a nucleic acid that provides a DNA region in which a BCAT1 gene is located, or a region transformed therefrom, or a fragment thereof, and combinations thereof.

In another aspect, the present application provides nucleic acids of the DNA region in which the BCAT1 gene is located, or a region transformed therefrom, or fragments thereof, and combinations thereof, which can be used to confirm the presence of a liver tumor, assess liver tumor formation or risk of formation, and/or assess liver tumor progression.

In another aspect, the present application provides nucleic acids selected from the following group of DNA regions, or complementary regions thereof, or transformed regions thereof, or fragments thereof, and combinations thereof: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application provides the use of a nucleic acid selected from the group consisting of DNA regions, or complements thereof, or regions derived from transformation of the above, or fragments of the above, and combinations of the above, in the preparation of a substance that can be used to confirm the presence of a disease, to assess the development or risk of development of a disease, and/or to assess the progression of a disease: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

In another aspect, the present application provides a method useful for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, comprising providing a nucleic acid selected from the group consisting of DNA regions, or complements thereof, or transformed regions thereof, or fragments thereof, and combinations thereof: derived from human chr12:25101630-25102393, derived from human chr: 12.

In another aspect, the present application provides nucleic acids selected from the following group of DNA regions, or complements thereof, or regions derived from transformation of the above, or fragments of the above, and combinations of the above, which can be used to confirm the presence of a disease, assess the development or risk of development of a disease, and/or assess the progression of a disease: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

For example, a nucleic acid of the present application may refer to an isolated nucleic acid. For example, the isolated polynucleotide may be a DNA molecule, an RNA molecule, or a combination thereof. For example, the DNA molecule may be a genomic DNA molecule or a fragment thereof.

In another aspect, the present application provides a storage medium recording a program operable to execute the method of the present application.

In another aspect, the present application provides an apparatus that may contain the storage medium of the present application. In another aspect, the present application provides a non-transitory computer readable storage medium having stored thereon a computer program for execution by a processor to perform any one or more of the methods described herein. For example, the non-volatile computer-readable storage medium may include a floppy disk, a flexible disk, a hard disk, a Solid State Storage (SSS) (e.g., a Solid State Drive (SSD)), a Solid State Card (SSC), a Solid State Module (SSM)), an enterprise-level flash drive, a tape, or any other non-transitory magnetic medium, and so forth. The non-volatile computer-readable storage medium may also include punch cards, paper tape, a cursor sheet (or any other physical medium with a pattern of holes or other optically recognizable indicia), a compact disc read-only memory (CD-ROM), a compact disc rewritable (CD-RW), a Digital Versatile Disc (DVD), a blu-ray disc (BD), and/or any other non-transitory optical medium.

For example, the apparatus of the present application may further comprise a processor coupled to the storage medium and configured to execute based on a program stored in the storage medium to implement the method of the present application. For example, the device may implement various mechanisms to ensure that the methods described herein performed on the database system produce correct results. In this application, the device may use a magnetic disk as the permanent data storage. In the present application, the apparatus may provide database storage and processing services for a plurality of database clients. The device may store database data across multiple shared storage devices and/or may utilize one or more execution platforms having multiple execution nodes. The devices may be organized such that storage and computing resources may be effectively expanded indefinitely.

Target point combination

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in a DNA region or fragment thereof in a test sample of at least two genes selected from the group consisting of: septin9 (UniProt accession number may be Q9UHD 8), BCAT1 (UniProt accession number may be P54687), IKZF1 (UniProt accession number may be Q13422), VAV3 (UniProt accession number may be Q9UKW 4), and IRF4 (UniProt accession number may be Q15306). For example, regions of multiple genes or fragments thereof can be used as markers for methylation for joint detection with greater specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9 and BCAT1 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9 and IKZF1 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modified states of the DNA region or fragments thereof in which Septin9 and VAV3 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in a test sample in the region of DNA or fragment thereof in which BCAT1 and IKZF1 are located. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in a test sample in the region of DNA or fragment thereof in which BCAT1 and VAV3 are located. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of a modification state in a DNA region or fragment thereof in which BCAT1 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in the region of DNA or fragment thereof in which IKZF1 and VAV3 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in the DNA region or fragment thereof in which IKZF1 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which VAV3 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modifications in a DNA region or fragment thereof of at least three genes selected from the group consisting of: septin9 (UniProt accession number may be Q9UHD 8), BCAT1 (UniProt accession number may be P54687), IKZF1 (UniProt accession number may be Q13422), VAV3 (UniProt accession number may be Q9UKW 4), and IRF4 (UniProt accession number may be Q15306). For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1 and IKZF1 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1 and VAV3 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, IKZF1 and VAV3 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, IKZF1 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, VAV3 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in a test sample in the region of DNA or fragment thereof in which BCAT1, IKZF1 and VAV3 are located. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in the DNA region or fragment thereof in which BCAT1, IKZF1 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in the DNA region or fragment thereof in which BCAT1, VAV3 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification in the DNA region or fragment thereof in which IKZF1, VAV3 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modifications in the DNA regions or fragments thereof of at least four genes selected from the group consisting of: septin9 (UniProt accession number may be Q9UHD 8), BCAT1 (UniProt accession number may be P54687), IKZF1 (UniProt accession number may be Q13422), VAV3 (UniProt accession number may be Q9UKW 4), and IRF4 (UniProt accession number may be Q15306). For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1, IKZF1 and VAV3 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1, IKZF1 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, BCAT1, VAV3 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification of the DNA region or fragment thereof in which Septin9, IKZF1, VAV3 and IRF4 are present in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modification states in the DNA region or fragment thereof in which BCAT1, IKZF1, VAV3 and IRF4 are located in a test sample. For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease, which may comprise determining the presence and/or amount of modifications in the DNA region or fragment thereof of five genes selected from the group consisting of: septin9 (UniProt accession number may be Q9UHD 8), BCAT1 (UniProt accession number may be P54687), IKZF1 (UniProt accession number may be Q13422), VAV3 (UniProt accession number may be Q9UKW 4), and IRF4 (UniProt accession number may be Q15306). For example, the regions of the genes or their fragments can be used as methylation markers for joint detection, which can have higher specificity and/or accuracy. For example, the disease may be a tumor. For example, the disease may be a solid tumor. For example, the disease may be a liver tumor.

Detailed description of the preferred embodiments

1. A method for confirming the presence of, assessing the risk of or forming, and/or assessing the progression of a liver neoplasm, comprising determining the presence and/or amount of a modification of the DNA region or fragment thereof in which the BCAT1 gene is located in a test sample.

2. A method for assessing the methylation status of a liver tumor-associated DNA region comprises determining the presence and/or amount of a modification status of the DNA region or fragment thereof in which the BCAT1 gene is present in a test sample.

3. The method according to any of embodiments 1 to 2, wherein the DNA region is derived from human chr12:24964295-25102393.

4. The method according to any one of embodiments 1-3, further comprising obtaining nucleic acids from a test sample.

5. The method of embodiment 4, wherein the nucleic acid comprises cell-free nucleic acid.

6. The method of any of embodiments 1-5, wherein the test sample comprises a tissue, cell, and/or bodily fluid.

7. The method of any one of embodiments 1-6, wherein the sample to be tested comprises plasma.

8. The method of any one of embodiments 1-7, further comprising transforming the DNA region or fragment thereof.

9. The method of embodiment 8, wherein a base with said modified state and said base without said modified state form different species upon transformation.

10. The method of any one of embodiments 8-9, wherein a base with the modified state is not substantially altered after transformation, and wherein the base without the modified state is altered to another base different from the base after transformation, or is cleaved after transformation.

11. The method of any one of embodiments 9-10, wherein the base comprises a cytosine.

12. The method of any one of embodiments 1-11, wherein the modification state comprises a methylation modification.

13. The method of any one of embodiments 10-12, wherein the additional base comprises uracil.

14. The method of any one of embodiments 8-13, wherein said converting comprises converting by a deaminating agent and/or a methylation sensitive restriction enzyme.

15. The method of any one of embodiments 14, wherein the deaminating agent comprises bisulfite or an analog thereof.

16. The method of any one of embodiments 1-15, wherein the method of determining the presence and/or amount of a modification state comprises confirming the presence and/or amount of a substance formed after the transformation of a base having the modification state.

17. The method according to any one of embodiments 1 to 16, wherein the method for determining the presence and/or amount of a modification state comprises determining the presence and/or amount of a DNA region or fragment thereof having said modification state.

18. The method of any one of embodiments 1-17, determining the presence and/or amount of a DNA region or fragment thereof having the modified state by a fluorescent Ct value detected by the fluorescent PCR method.

19. The method of any one of embodiments 1 to 18, wherein the presence of, or the risk of, liver tumor formation or formation is determined by confirming the presence of a modification state of the DNA region or fragment thereof and/or the presence of a higher amount of the modification state of the DNA region or fragment thereof relative to a reference level.

20. The method of any one of embodiments 1-19, further comprising amplifying the DNA region or fragment thereof in a test sample prior to determining the presence and/or amount of the modification of the DNA region or fragment thereof.

21. The method of embodiment 20, wherein said amplifying comprises PCR amplification.

22. A method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease comprising determining the presence and/or amount of a modification state in a test sample selected from the group consisting of DNA regions from the following group, or complements thereof, or fragments thereof: derived from human chr12:25101630-25102393, derived from human chr: 12.

23. A method of determining the methylation status of a DNA region, comprising determining the presence and/or amount of a modification status in a test sample selected from the group consisting of DNA regions from the following group, or their complements, or fragments thereof: derived from human chr12:25101630-25102393, derived from human chr: 12.

24. The method of any one of embodiments 22 to 23, comprising providing a nucleic acid capable of binding to a nucleic acid comprising a region selected from the group consisting of the DNA regions of: SEQ ID NO: 1. SEQ ID NO:8 and SEQ ID NO:12.

25. the method of any one of embodiments 22-24, comprising providing a nucleic acid capable of binding a nucleic acid comprising a DNA region selected from the group consisting of: human chr12:25102016-25102110 in origin, human chr12:25101992-25102093 in origin, human chr12:25079051-25079133 in origin and human chr12:25056027-25056134 in origin.

26. The method of any one of embodiments 22-25, comprising providing a nucleic acid selected from the group consisting of: SEQ ID NO: 2. SEQ ID NO: 5. SEQ ID NO:9 and SEQ ID NO:13.

27. the method of any one of embodiments 22-26, comprising providing a nucleic acid selected from the group consisting of: the amino acid sequence of SEQ ID NO:3 and 4, SEQ ID NO:6 and 7, SEQ ID NO:10 and 11 and SEQ ID NO:14 and 15.

28. The method of any one of embodiments 22-27, wherein the disease comprises a tumor.

29. The method of any one of embodiments 22-28, further comprising obtaining nucleic acids in a test sample.

30. The method of embodiment 29, wherein the nucleic acid comprises cell-free nucleic acid.

31. The method of any one of embodiments 22-30, wherein the test sample comprises a tissue, cell, and/or bodily fluid.

32. The method of any one of embodiments 22-31, wherein the test sample comprises plasma.

33. The method of any one of embodiments 22-32, further comprising transforming the DNA region or fragment thereof.

34. The method of any one of embodiments 33, wherein a base with the modified state and a base without the modified state form different species upon transformation.

35. The method of any one of embodiments 33-34, wherein a base with the modified state is not substantially altered after transformation, and wherein the base without the modified state is altered to another base different from the base after transformation, or is cleaved after transformation.

36. The method of any one of embodiments 34-35, wherein the base comprises a cytosine.

37. The method of any one of embodiments 22-36, wherein the modification state comprises a methylation modification.

38. The method of any one of embodiments 35-37, wherein the additional base comprises uracil.

39. The method of any one of embodiments 33-38, wherein said converting comprises converting by a deaminating agent and/or a methylation sensitive restriction enzyme.

40. The method of embodiment 39, wherein the deaminating agent comprises bisulfite or an analog thereof.

41. The method of any one of embodiments 22 to 40, wherein the method of determining the presence and/or amount of a modification state comprises confirming the presence and/or amount of a substance formed after the transformation of a base having the modification state.

42. The method according to any one of embodiments 22 to 41, wherein the method for determining the presence and/or amount of the modification state comprises determining the presence and/or amount of a DNA region or fragment thereof having the modification state.

43. The method of any one of embodiments 22 to 42, wherein the presence and/or amount of a DNA region or fragment thereof having the modified state is determined by a fluorescent Ct value detected by the fluorescent PCR method.

44. The method of any one of embodiments 22 to 43, determining the presence of, or the risk of, liver tumor formation or formation by confirming the presence of a modification state of the DNA region or fragment thereof and/or the presence of a higher amount of a modification state of the DNA region or fragment thereof relative to a reference level.

45. The method of any one of embodiments 22-44, further comprising amplifying the DNA region or fragment thereof in a test sample prior to determining the presence and/or amount of the modification of the DNA region or fragment thereof.

46. The method of embodiment 45, wherein said amplifying comprises PCR amplification.

47. A nucleic acid comprising a sequence capable of binding to the region of DNA in which the BCAT1 gene is located, or the complementary region thereof, or a region derived from a transformation of the above, or a fragment of the above.

48. A method for producing a nucleic acid, which comprises designing a nucleic acid capable of binding to a DNA region in which a BCAT1 gene is present, or a complementary region thereof, or a region transformed therefrom, or a modified state of a fragment thereof, wherein the DNA region is a region complementary thereto, or a region transformed therefrom, or a fragment thereof.

49. A nucleic acid set comprising a sequence capable of binding to a region of DNA in which a BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a fragment thereof.

50. A method for preparing a nucleic acid set, comprising designing a nucleic acid set capable of amplifying a DNA region in which a BCAT1 gene is present, or a complementary region thereof, or a region transformed therefrom, or a modified state of the above-mentioned fragment, based on the DNA region, or the complementary region thereof, or the above-mentioned transformed region, or the above-mentioned fragment.

51. A kit comprising a nucleic acid according to embodiment 47 and/or a nucleic acid set according to embodiment 49.

52. Use of a nucleic acid according to embodiment 47, a nucleic acid set according to embodiment 49 and/or a kit according to embodiment 51 in the preparation of a product for detecting a disease.

53. Use of a nucleic acid according to embodiment 47, a nucleic acid set according to embodiment 49 and/or a kit according to embodiment 51 in the preparation of a substance for confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease.

54. Use of a nucleic acid according to embodiment 47, a nucleic acid set according to embodiment 49 and/or a kit according to embodiment 51 for the preparation of a substance for determining the modification status of a DNA region or fragment thereof.

55. Use of a nucleic acid, a nucleic acid set and/or a kit for determining the modification status of a DNA region comprising the DNA region of the BCAT1 gene or a fragment thereof for the preparation of a substance for confirming the presence of a liver tumor, assessing the formation or risk of formation of a liver tumor and/or assessing the progression of a liver tumor.

56. Use of a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region comprising a DNA region selected from the group consisting of: derived from human chr12:25101630-25102393, derived from human chr: 12.

Use of nucleic acids of the DNA region of the BCAT1 gene, or a region transformed therefrom, or fragments thereof, and combinations thereof, for the preparation of a substance for confirming the presence of a liver tumor, assessing liver tumor formation or risk of formation, and/or assessing liver tumor progression.

58. Use of a nucleic acid selected from the group consisting of the following DNA regions, or the complementary regions thereof, or the transformed regions mentioned above, or fragments of the above, and combinations of the above, for the preparation of a substance for confirming the presence of a disease, assessing the development or risk of development of a disease, and/or assessing the progression of a disease: derived from human chr12:25101630-25102393, derived from human chr: 12.

59. A storage medium recording a program that can execute the method of any one of embodiments 1-46.

60. An apparatus comprising the storage medium of embodiment 59.

61. The apparatus of embodiment 59, further comprising a processor coupled to the storage medium and configured to execute, based on a program stored in the storage medium, to implement the method of any of embodiments 1-46.

Without wishing to be bound by any theory, the following examples are intended only to illustrate the products, preparation methods and uses of the present application, and the like, and are not intended to limit the scope of the invention of the present application.

Examples

Example 1 comparison of methylation abundance of liver cancer, tissue adjacent to cancer and leukocyte DNA samples

DNA samples (10 leukocyte samples, 24 cancer tissues) were obtained from leukocytes from healthy people with no abnormal liver, cancer tissues and cancer tissues from liver cancer patients, and the leukocyte DNA was selected as a reference sample because most of plasma free DNA is derived from DNA released after leukocyte rupture, and its background can be a basic background signal of the detection site of the plasma free DNA. Leukocyte DNA was extracted using Qiagen QIAamp DNAmini Kit and Tissue DNA was extracted using Qiagen QIAamp DNAFFFPE Tissue Kit as required by the instructions.

A20 ng sample of the DNA obtained in the above step was treated with a bisulfite reagent (D5031, ZYMO RESEARCH) to obtain a converted DNA.

Alternatively, PCR amplification was performed using a pool of primers containing target BCAT1 methylation specific primer pairs (e.g., SEQ ID NOS: 3 and 4) and internal control (ACTB, probes can be shown as SEQ ID NO:16, and forward and reverse primers can be shown as SEQ ID NOS: 17 and 18, respectively) at a final concentration of 100nM each, using the transformed DNA as a template. The PCR reaction system comprises: 10. Mu.L of the transformed DNA (containing 2.5. Mu.L of the above primer premix) and 12.5. Mu.L of PCR reagent: (

Universal Probe qPCR Master Mix (NEB). The PCR reaction conditions are as follows: 5 minutes at 95 ℃;95 ℃ for 30 seconds, 56 ℃ for 60 seconds, 10 cycles. For example, the positions of lower case letters in a sequence of a table of the present application can correspond to the positions of native cytosines on a region of the genome to which the sequence binds. For example, bases in the tables of the present application, which are indicated by lower case letters of the sequences, can be used for base pairing with the converted base; for example, a natural cytosine can be converted to uracil after bisulfite treatment, a lower case base a can be paired with the converted uracil, and a lower case base t can be further coupled with the uracilPaired adenine pairs. Wherein the primer sequences are shown in Table 1.

TABLE 1 BCAT1 specific primers

SEQ ID NO.	Name (R)	Sequence of
			3	BCAT1 Forward primer 1	TACGTGGCGGGTTGG
4	BCAT1 reverse primer 1	AAAAAAACAACCTTAATATCTTC
			6	BCAT1 Forward primer 1a	GTTTTTTTGTTGATGTAATTCGTTAGGTC
7	BCAT1 reverse primer 1a	CAATACCCGAAACGACGACG
			10	BCAT1 Forward primer 2	tAGGGtAGAGGCGtTttttAtAT
11	BCAT1 reverse primer 2	CCGaCTaCCATCCCGTCTAa
			14	BCAT1 Forward primer 3	tTGGGACGAGACGGTTGGAG
15	BCAT1 reverse primer 3	AaaaCGCTaaaTACCACGACCTa
			17	ACTB forward primer	GTGATGGAGGAGGTTTAGTAAGTT
18	ACTB reverse primer	CCAATAAAACCTACTCCTCCCTTAA

Diluting the obtained pre-amplification product by 10 times, and detecting by multiple fluorescence PCR to obtain the fluorescence Ct value of the marker. In the fluorescent PCR reaction system, the final concentration of each primer was 500nM and the final concentration of each detection probe was 200nM. The PCR reaction system comprises: 10 μ L of pre-amplification dilution, 2.5 μ L of primer and probe premix containing the detection site; 12.5 μ L of PCR reagent (C)

Universal Probe qPCR Master Mix (NEB). Wherein the primer sequences are shown in Table 1 (e.g., SEQ ID NOS: 3 and 4) and the probe sequences are shown in Table 2 (e.g., SEQ ID NOS: 2). The PCR reaction conditions were as follows: 5 minutes at 95 ℃; 30 seconds at 95 ℃ and 60 seconds at 56 ℃ (fluorescence collected) for 50 cycles. Different fluorescence was detected at the corresponding fluorescence channels using the ABI 7500Real-Time PCR System. Calculating and comparing Ct values of samples obtained from leucocytes, paracancerous tissues and cancerous tissues, and calculating Ct value of target point without detection of amplification signalSet to 50.

TABLE 2 BCAT1 detection Probe sequences

SEQ ID NO.	Name (R)	Sequence of
			2	BCAT1 Probe 1	TCGGTTTTTTCGCGGCG
5	BCAT1 Probe 1a	TTCGTCGCGAGAGGGTCGGTT
			9	BCAT1 Probe 2	TtAGACGATGGGCGGtCG
13	BCAT1 Probe 3	TGCGTCGTAtttTGCGttTG
			16	ACTB probes	ACCACCACCCAACACACAATAACAAACACA

The results are shown in FIG. 1, and it can be seen that the methylation of these detection sites has very low background signal in leukocyte DNA, tissue signal is stronger than leukocyte DNA signal, and cancer tissue signal is stronger than signal of tissues beside cancer. The selected target marker is proved to have feasibility and specificity to the tumor tissue.

Example 2 comparison of methylation signals in plasma samples of patients with liver cancer and of persons without liver abnormalities

Plasma samples of 65 liver cancer individuals and 76 control individuals were tested using a fluorescent PCR assay:

extracellular free DNA from the plasma samples was extracted using the commercial Qiagen QIAamp Circulating Nucleic Acid Kit. The extracted extracellular free DNA was subjected to sulfite Conversion treatment using a commercial Bisulfite Conversion reagent, methyCodeTM bisufite Conversion Kit, to obtain converted DNA.

Alternatively, the above-mentioned transformed DNA is used for pre-amplification, and PCR amplification is performed using the transformed DNA as a template with a primer pool containing target BCAT1 methylation specific primers shown in Table 1 (e.g., SEQ ID NOS: 3 and 4) and internal control (ACTB, a probe may be shown as SEQ ID NO:16, and a forward primer and a reverse primer may be shown as SEQ ID NOS: 17 and 18, respectively) primer pairs, each primer having a final concentration of 100nM. The PCR reaction system is 10. Mu.L of transformed DNA and contains 2.5. Mu.L of the primer premix; PCR reagent (C)

Universal Probe qPCR Master Mix (NEB) 12.5. Mu.L. The PCR reaction conditions were as follows: 5 minutes at 95 ℃;95 ℃ for 30 seconds, 56 ℃ for 60 seconds, 15 cycles.

Diluting the obtained pre-amplification product by 10 times and using the diluted pre-amplification product for fluorescent PCR detection. As a control, primers shown in Table 1 (e.g., SEQ ID NOS: 3 and 4), a detection probe sequence shown in Table 2 (e.g., SEQ ID NO: 2) and the reference gene ACTB were simultaneously detected. The final concentration of the primers was 500nM and the final concentration of the probes was 200nM. The PCR reaction system comprises: 10 μ L of pre-amplification dilution containing 2.5 μ L of primer and probe premix for the detection site; PCR reagent (C)

Universal Probe qPCR Master Mix(NEB)12.5μL。

The fluorescent PCR reaction system was the same as in example 1. The PCR reaction conditions were as follows: 5 minutes at 95 ℃;95 ℃ for 15 seconds, 56 ℃ for 40 seconds (fluorescence acquisition), 50 cycles. And aiming at the modified fluorescence of different gene probes, selecting corresponding detection fluorescence channels. The target Ct value at which no amplified signal was detected was set to 50.

The results are shown in FIG. 2, comparing the DNA methylation signals of the test sites in the control plasma and the plasma of liver cancer. The selected target marker proved to have a higher sensitivity to tumor tissue.

In the case of greater than 90% specificity, the detection sensitivity statistics of the detection sites are shown in table 3:

TABLE 3 detection sensitivity of detection sites

Site of the body	Sensitivity of the probe
		BCAT1	34％

When 5 marker groups (Septin 9, IKZF1, IRF4, VAV3 and BCAT 1) are comprehensively considered, the detection sensitivity of the liver cancer can achieve 90.8% under the condition that the specificity of a control group is 90.8%, and the specific information is as shown in the following table 4:

TABLE 4 detection accuracy for multiple sites

The foregoing detailed description is provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications of the presently recited embodiments will be apparent to those of ordinary skill in the art and are intended to be within the scope of the appended claims and their equivalents.

Sequence listing

<110> Jiangsu \40525

<120> tumor detection method and application

<130> 0266-PA-001

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 764

<212> DNA

<213> human (Homo sapiens)

<400> 1

agtagggagg tgggcaggag ccagtgatga cggaatggca atcacatttg acctctgatc 60

tgtttatttc ctcctccttg acgtctccat ataaatgtta cacgggcatc cccacactcg 120

gatacgcacc cacagtggct gattcggggg taaccgtgtc atttgcttgc aacactggca 180

cctctgccct gcaccccggg agtgagcagt gagtgaggct cgggtctggg cgctggctcc 240

gaatcttcgg gctgggagag actccaccat ctgggggcgg cctgggggag cagccttagt 300

gtcttcctgc tgatgcaatc cgctaggtcg cgagtctccg ccgcgagagg gccggtctgc 360

aatccagccc gccacgtgta ctcgccgccg cctcgggcac tgccccaggt cttgctgcag 420

ccgggaccgc gctctgcagc cgcagacccg gtccacacgg ccaggggcta cgacccttgg 480

gatctgccct ccgctcagct cgagcttccc tcgtggccga cggaacaatg aaggtaacta 540

cttatggttt tgtccgtgtt ttacaaaaat gtgtgcgtga atcgaaccgg cgatttctcc 600

aagaaacata gttggcaggg aggggaggaa ggcgagacaa ccatggctta tatcccccgc 660

aaacgtctca gtatcttctt tatcaatcgt agtttgcggg gaccgtgcat tctgttcaga 720

tttcggttta acctccactc gcaggacgtg ccttctcgga cttt 764

<210> 2

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Probe 1

<400> 2

tcggtttttt cgcggcg 17

<210> 3

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Forward primer 1

<400> 3

tacgtggcgg gttgg 15

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 reverse primer 1

<400> 4

aaaaaaacaa ccttaatatc ttc 23

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Probe 1a

<400> 5

ttcgtcgcga gagggtcggt t 21

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Forward primer 1a

<400> 6

gtttttttgt tgatgtaatt cgttaggtc 29

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 reverse primer 1a

<400> 7

caatacccga aacgacgacg 20

<210> 8

<211> 750

<212> DNA

<213> human (Homo sapiens)

<400> 8

tcaatgagct gttgggtaca cctcccagac ggggtggcgg ccgggcagag gggctcctca 60

cttcccagaa ggggtggcct ggcagaggca cccccaacct ccctcccgga cggggcggct 120

ggccaggcgg gggctgcccc caacttccca gacggggtgg ctgctgggcg gaggggctct 180

ttacttctca gatggggcgg ctgccgggtg gaggggctcc tcacttctca gacggggcgg 240

ccgggcagag gcgctcctca cctcccagac ggggcagcag ggcagaggcg ctccccacat 300

ctcagacgat gggcggccgg gcagagacgc tcctcacttc ctagacggga tggcagccgg 360

gaagaggcgc tcctcacttc ccagactggg cagccaggca gaggggctcc tcacatccca 420

gacgatgggc agccaggcag agaagctcct cacttcccag atggggtggc ggccgggcag 480

aggctgcaat ctcggcactt tgggaggcca aggcaggcgg ctgggaggtg gaggttgtag 540

cgagccgaga tcacgccact acactccagc ttgggcaaca ttgagcactg agtgaacgag 600

actccgtctg caatcccggc acctcgggag gccgaggctg gcagatcact cccggttagg 660

agctggagac cagcccggcc aacacagcga aaccccgtct ccaccaaaaa aatacgaaaa 720

ccagtcaggc atggtggcgc gcgcctgcaa 750

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Probe 2

<400> 9

ttagacgatg ggcggtcg 18

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Forward primer 2

<400> 10

tagggtagag gcgtttttta tat 23

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 reverse primer 2

<400> 11

ccgactacca tcccgtctaa 20

<210> 12

<211> 1531

<212> DNA

<213> human (Homo sapiens)

<400> 12

ttagccttga ccgaggggcg cttcccggcc attcacctag aggttgttta ataaacaagg 60

atgctcgcga aatatctgcg cttggaaagg cgctcgttcg tggcgcgcat tctcgggcct 120

ccgcaagcga ccccggtgac agggacaacc gcttcggttt tagcgactgc agacagactg 180

ggacgagacg gttggaggct cctccccaag ggatgctgga ggggttgcgt cgtaccctgc 240

gcctggccct ggcgcgcggc cccaggtcgt ggtacccagc gccctatggg ccgtgcgccg 300

gggcttggcc acaccgcctg ctttcgcttc cagccgcgcg ctccgtgcca ctgccgctct 360

ctgcagcccc gcgtccccgc agcctcccca tggccagccc gcttcgctcc gctgcggccc 420

ttgcccgcca ggtacctcga acccgggcgt ttgcggaagg ggggaggatt ggaacccggg 480

tctcggtagc tcgcgggcct ggccgggcgc cttgtcgccg tttcctgcac catcctcctt 540

cgccttgccc tccattccgc ctccagcgag gcgtcttccc ttccccgcat ccctgcccga 600

aatctggagt cccagcctgc aatctccacc tcttcgaggt tcccgctgcc caggtctagc 660

accctcatgg gtaacccgct ccggagcgtg gcgaggaccg ccacggggga cgtgagggta 720

gctatggact cgctctgagg gaggaggcgg gagctgaatc tctgggctgc cagaacccac 780

agccacatcc tacgtgactc tgccacccca aaatattttg accgcagcct tctgcctcct 840

tggatctctt ccttccccac ccccaccccc gtagttattt agcagattac gcattaaaac 900

aaatgtctgc aggttttccc aattagtccc gcttccctgt gtctttatct tttaaattgc 960

ccactaatac catgaggttt aaggtgtggg gtggatgctg cggcatcgga ggaccctgct 1020

ggtggaggaa atggttcacg cccgtccccg ttccctttgc aggcttgcta ttgtgcgtct 1080

gtgattgaca agaccacgag gctgagcgcg ccctggagat ttttctataa atggcttaac 1140

accccagtct agactatttg ctcggatata agggagacaa ttgttttttt gttctttgcc 1200

ggcgaaccct ggctctgtag ggctgacctg gaatttaacc agtcttccct gagccggcgg 1260

aggaggacaa aaaccgccgc gaccccggca gggtgggaag tgcagggcag cgctcccaag 1320

acacgcttgt tggaggttcg ggcctgggtg cttggttgtc tgagcctcct tttttgtgtt 1380

tgcctgggtc ctggagagga gcgcacggta tcatggtgag cgtcacgtag gttaccccgg 1440

gtcccgctta cccacctgca tttacttaat ggtggtttaa ttcttcttta aggattgcag 1500

taacggatgc tccgcagagt gtaccggaga a 1531

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Probe 3

<400> 13

tgcgtcgtat tttgcgtttg 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 Forward primer 3

<400> 14

ttgggacgag acggttggag 20

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BCAT1 reverse primer 3

<400> 15

aaaacgctaa ataccacgac cta 23

<210> 16

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ACTB Probe

<400> 16

accaccaccc aacacacaat aacaaacaca 30

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ACTB Forward primer

<400> 17

gtgatggagg aggtttagta agtt 24

<210> 18

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ACTB reverse primer

<400> 18

ccaataaaac ctactcctcc cttaa 25

Claims

3. A method of confirming the presence of a disease, assessing the development or risk of development of a disease and/or assessing the progression of a disease comprising determining the presence and/or amount of a modification state in a test sample selected from the group consisting of DNA regions from the following group, or complements thereof, or fragments thereof: derived from human chr12:25101630-25102393, derived from human chr: 12.

4. A method of determining the methylation status of a DNA region, comprising determining the presence and/or amount of a modification status in a test sample selected from the group consisting of DNA regions from the following group, or their complements, or fragments thereof: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

5. A nucleic acid comprising a sequence capable of binding to the DNA region of the BCAT1 gene, or a complementary region thereof, or a region transformed therefrom, or a fragment thereof.

6. A nucleic acid set comprising a sequence capable of binding to a region of DNA in which a BCAT1 gene is located, or a complementary region thereof, or a region transformed therefrom, or a fragment thereof.

7. Use of a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region comprising the DNA region of the BCAT1 gene or a fragment thereof for the preparation of a substance for confirming the presence of a liver tumor, assessing the formation or risk of formation of a liver tumor and/or assessing the progression of a liver tumor.

8. Use of a nucleic acid, a set of nucleic acids and/or a kit for determining the modification status of a DNA region comprising a DNA region selected from the group consisting of: from human chr12:25101630-25102393, from human chr12: 25078661-25079410 and from human chr12: 25054781-25056363.

10. Use of a nucleic acid selected from the group consisting of the following DNA regions, or the complementary regions thereof, or the transformed regions mentioned above, or fragments of the above, and combinations of the above, for the preparation of a substance for confirming the presence of a disease, assessing the development or risk of development of a disease, and/or assessing the progression of a disease: derived from human chr12:25101630-25102393, derived from human chr: 12.