CN115896251A - LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology - Google Patents
LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology Download PDFInfo
- Publication number
- CN115896251A CN115896251A CN202211252133.9A CN202211252133A CN115896251A CN 115896251 A CN115896251 A CN 115896251A CN 202211252133 A CN202211252133 A CN 202211252133A CN 115896251 A CN115896251 A CN 115896251A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- lamp
- molecular beacon
- taqman probe
- single nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a detection technology of target nucleic acid sequences and single nucleotide polymorphisms based on loop-mediated isothermal nucleic acid amplification (LAMP), heat-resistant nuclease HII and RNA chimeric molecular beacons or Taqman probes. The whole detection technique comprises the following 4 steps. A first step; LAMP amplification is carried out on a target nucleic acid area to be detected; secondly, hybridizing and pairing a molecular beacon or a Taqman probe with an RNA base in the middle with target nucleic acid to form a double-stranded pairing region, cutting off the molecular beacon or the Taqman probe at a ribonucleotide by using thermostable ribonuclease HII, releasing a fluorescent signal, and carrying out fluorescent quantitative detection on the target nucleic acid; thirdly, if the ribonucleotide of the molecular beacon or the Taqman probe forms mismatched base pairs with the corresponding base of the target nucleic acid, the ability of the thermostable ribonuclease HII to cut off the ribonucleotide is greatly reduced, and the final result is that only a very small amount of the molecular beacon or the Taqman probe is cut off, and the released fluorescent signal is far lower than that of the correctly paired molecular beacon or the Taqman probe, so that the base type of the single nucleotide polymorphism site can be determined through the intensity difference of the released fluorescent signals.
Description
Technical Field
The invention relates to a novel technology for quickly detecting nucleic acid and determining single nucleotide polymorphism, in particular to a technology for quickly detecting and determining single nucleotide polymorphism based on loop-mediated isothermal amplification (LAMP) technology, which can be used for detecting single nucleotide polymorphism of nucleic acid molecules and genes and belongs to the technical field of nucleic acid detection.
Background
Nucleic acid detection is one of the three major technologies for molecular diagnostics, and has the fastest development speed and huge market capacity. The nucleic acid detection technology not only can be widely applied to scientific research, but also has more and more obvious importance in the fields of clinical diagnosis, food detection, forensic identification and the like. The current nucleic acid detection technologies are diverse in types, and mainly include Polymerase Chain Reaction (PCR), isothermal nucleic acid amplification, nucleic acid hybridization detection, and nucleic acid sequence analysis. The method has the advantages of simple operation, short detection time and high detection flux and sensitivity, and is the development direction of gene detection.
Polymerase Chain Reaction (PCR) is one of the three major techniques for molecular diagnostics, and the most developed and mature technique in molecular diagnostics is the longest. Among them, the fluorescent quantitative PCR (qPCR) technology is considered as the gold standard for molecular diagnosis, and its diagnostic products are widely used for screening and detecting infectious diseases, venereal diseases, tumors, genetic diseases and mononucleotide polymorphisms, occupying most markets of infectious disease detection. However, the qPCR process is complicated, centralized inspection is needed, the time consumption is long, reports cannot be issued within 4 hours, the requirement on a thermocycler is high, the operation needs to be carried out in a specific PCR laboratory, operators also need to keep on duty on PCR certificates, at present, part of medical institutions do not have the nucleic acid detection capability, and a great deal of difficulty and limitation exist in the construction of PCR laboratories in county-level hospitals.
The detection time duration Of the Point-Of-Care Testing (POCT) technology is the development requirement Of in vitro diagnosis, and the current biochemical diagnosis and immune diagnosis Of in vitro diagnosis basically realize the POCT. Although molecular diagnosis is accurate and sensitive, POCT detection cannot be realized no matter qPCR and gene sequencing, so that the POCT convenient and fast detection technology is a future development trend of the molecular diagnosis industry.
LAMP is also called loop-mediated isothermal amplification technology, 6 specific primers are designed aiming at 6 regions of a target gene, and under the action of strand displacement DNA polymerase (Bst DNA polymerase), gene templates, primers, dNTP and the like are utilized to carry out constant-temperature amplification at the temperature of 60-65 ℃, and 10-60 minutes can be realized in about 15-60 minutes 9 ～10 10 Amplification of nucleic acids. The method is a novel nucleic acid amplification method, has the characteristics of simple operation, strong specificity, easy detection of products and the like, and is a main technical platform for rapid detection of nucleic acid. If the fluorescent probe molecules and the enzymes for cutting the paired probe molecules are added into the reaction system, the LAMP amplification product quantity can be monitored in real time, and quantitative analysis similar to qPCR can be carried out on the amplification product of the target gene.
The molecular beacon (molecular beacon) is a stem-loop structure formed by short oligonucleotide single strands, one end of the stem-loop structure is marked by a fluorescent group, and the other end of the stem-loop structure is marked by a quenching group. The molecular beacon fluorescent group and the quenching group of the neck ring structure are close to each other, and the fluorescent group is quenched by the quenching group and does not emit fluorescence. If the detected nucleic acid molecule can hybridize with the single-chain loop region of the molecular beacon, the stem structure of the molecular beacon is destroyed, the spatial distance between the fluorophore and the quencher is increased, and the fluorophore emits a fluorescent signal. The intensity of the fluorescence signal depends on the amount of the DNA molecule to be detected. Since molecular beacons do not have a signal amplification and accumulation function, the sensitivity of the technology for detecting target nucleic acid by directly hybridizing molecular beacons is low.
The Taqman probe is a stem-loop structure formed by short oligonucleotide single strands, one end of the Taqman probe is marked by a fluorescent group, and the other end of the Taqman probe is marked by a quenching group. The fluorophore and the quencher are in close proximity such that the fluorophore is not capable of emitting fluorescence. If the target nucleic acid molecule is hybridized with the Taqman probe, the double-stranded DNA exonuclease hydrolyzes the end of the Taqman probe, so that the fluorescent group can emit a fluorescent signal. Taqman probes perform a fluorescent quantitation function and require double-stranded DNA exonuclease activity. However, most of DNA polymerases in the normal temperature nucleic acid amplification technology do not have double-stranded DNA exonuclease activity, and the conventional Taqman probe method fluorescent quantitative detection cannot be carried out.
RNase HII is an endoribonuclease that hydrolyzes the RNA strand in RNA/DNA hybrid systems. The enzyme is unable to digest single-stranded or double-stranded DNA. RNase HII can also hydrolyze heteroduplex DNA-rN-DNA/DNA only containing one RNA base, so that the RNase HII can hydrolyze molecular beacons and Taqman probes containing one RNA base to amplify and accumulate signals, and the defect that the conventional molecular beacons and Taqman probes cannot amplify signals is overcome. The cut molecular beacon or Taqman probe is coupled with LAMP technology, so that the fluorescent quantitative detection of the constant temperature amplification of DNA becomes possible, and the basis is laid for the POCT application of molecular diagnosis.
Disclosure of Invention
The invention aims to provide an isothermal nucleic acid fluorescence quantitative rapid detection technology based on LAMP and a cutting type molecular beacon or a Taqman probe, which overcomes the defects that the conventional hybridization type molecular beacon or Taqman probe detection technology cannot amplify signals and LAMP cannot carry out specific detection similar to Taq DNA polymerase catalyzed Taqman probe method. Compared with the traditional LAMP nucleic acid amplification technology, the invention cuts off the molecular beacon or Taqman probe with a ribonucleotide in the middle through the heat-resistant nuclease HII, accumulates the fluorescent signal and achieves the effect of signal amplification. The method can be used for nucleic acid detection and genotyping assays. The method can be used for detecting nucleic acid of food-polluted microorganisms, environmental microorganisms, pathogenic microorganisms and the like, and detecting mononucleotide haplotypes of gene mutation and the like.
In order to achieve the purpose, in the invention, the middle position of a molecular beacon or a Taqman probe is a ribonucleotide, and meanwhile, a heat-resistant nuclease HII is adopted, so that the kit can be coupled with a LAMP nucleic acid amplification technology of 65-degree reaction, and the fluorescent quantitative detection and the single nucleotide polymorphism determination of isothermal index amplification of nucleic acid can be carried out without depending on an expensive qPCR instrument.
The method comprises the following specific steps:
in the first step, a molecular beacon or Taqman probe with a ribonucleotide in the middle is prepared. The molecular beacon is 37 nucleotides in length, a ribonucleotide is arranged in the middle, the nucleotides on the ring of the molecular beacon are matched with target DNA, 6 nucleotides on two sides are matched with each other, the two sides are respectively marked by a fluorescence emitting group and a fluorescence quenching group, and the whole molecular beacon forms a stem-ring structure without fluorescence release. As the fluorescence emitting group, FAM, TET, etc. can be used, and as the fluorescence quenching group, DACBYL, etc. can be used. The Taqman probe is 20-30 nucleotides long, the middle of the Taqman probe contains 1 RNA base, two sides of the Taqman probe are respectively marked by a fluorescence emission group and a fluorescence quenching group, the fluorescence emission group can be FAM, TET and the like, the fluorescence quenching group can be BHQ1, DACBYL and the like, and the Taqman probe does not release fluorescence.
And step two, establishing a LAMP isothermal nucleic acid amplification reaction system. Adding a primer sequence for amplifying a target DNA, dNTP, a Bst DNA polymerase large fragment, a detection sample DNA, tth nuclease HII, a molecular beacon or a Taqman probe into a reaction system for LAMP isothermal nucleic acid amplification to prepare a reaction mixture.
Thirdly, LAMP amplification reaction and fluorescence signal amplification reaction. And (3) preserving the reaction mixture in the second step in a fluorescence quantitative PCR instrument or a portable fluorescence detector at 65 ℃ for a certain time, and performing LAMP isothermal nucleic acid amplification and fluorescence signal release reaction.
In the fourth step, the concentration or single nucleotide polymorphism of the target nucleic acid molecule is determined. And determining whether the detected sample contains the target nucleic acid detection and the concentration thereof according to the amplification curve of the fluorescence quantitative PCR instrument or the final fluorescence signal intensity of the portable fluorescence quantitative instrument. And if the single nucleotide polymorphism typing is carried out, determining the single nucleotide polymorphism of the base of the site to be detected of the detection sample by comparing the difference of the fluorescence signals among different samples.
Compared with the existing nucleic acid detection and single nucleotide polymorphism genotyping technology based on molecular beacons or conventional Taqman probes, the invention has remarkable progress. The main advantages are as follows: (1) The middle of the molecular beacon or the Taqman probe is provided with a ribonucleotide which can cut off the molecular beacon or the Taqman probe and permanently release and accumulate a fluorescent signal. (2) The nuclease HII is derived from heat-resistant microorganisms, so that the whole release reaction of a fluorescence signal can be coupled with LAMP isothermal amplification technology at 65 ℃, isothermal nucleic acid fluorescence quantitative detection and single nucleotide polymorphism genotyping are realized, and the detection sample DNA can be double-stranded DNA. (3) The coupled detection of the release reaction of the fluorescent signal and the LAMP isothermal amplification reaction realizes the nucleic acid amplification and signal detection at constant temperature, overcomes the absolute dependence on the fluorescent quantitative PCR and improves the detection sensitivity of the target nucleic acid.
Drawings
FIG. 1 is a schematic diagram of the LAMP amplification-based fluorescent quantitative detection of target nucleic acid and the genotyping technique of single nucleotide polymorphism of the present invention.
FIG. 2 shows the results of the present invention for detecting the glyceraldehyde-3-phosphate dehydrogenase gene of Escherichia coli.
FIG. 3 shows the result of single nucleotide polymorphism at base 470 of E.coli glyceraldehyde-3-phosphate dehydrogenase gene in accordance with the present invention.
Specific example 1 LAMP isothermal fluorescent quantitative determination of glyceraldehyde-3-phosphate dehydrogenase Gene of Escherichia coli
The technical solution of the present invention is further described in detail by examples below. The following examples are not to be construed as limiting the invention.
In one embodiment of the invention, firstly, a molecular beacon with a ribonucleotide in the middle and an LAMP isothermal amplification primer are designed and synthesized, the molecular beacon, the LAMP primer, dNTP, a heat-resistant Bst DNA polymerase large fragment, a heat-resistant nuclease HII and a sample DNA are added into an LAMP reaction system, and the sample DNA is incubated in a portable fluorescence detector with controllable temperature to determine the existence of the 3-glyceraldehyde phosphate dehydrogenase gene of the sample. The specific implementation steps are as follows:
in the first step, a molecular beacon with a ribonucleotide in the middle is prepared. The molecular beacon is 37 nucleotides long, a ribonucleotide rc is arranged in the middle, the middle 25 nucleotides are matched with 459-483 nucleotides of the glyceraldehyde-3-phosphate dehydrogenase gene of escherichia coli, 6 nucleotides at two sides are matched with each other, the two sides are respectively marked by a fluorescence emission group and a fluorescence quenching group, the whole molecular beacon forms a stem-loop structure, and no fluorescence is released. The molecular beacons were as follows:
Ecgapdh-MB：
5’FAM-CGCGCCCT GCCTGGCTCrc GCTGGCTAAA GTT GGCGCG-BHQ1
and step two, establishing a LAMP detection reaction system. 3 pairs of LAMP primer sequences (0.2. Mu.M Ecgapdh-F3, 1.0. Mu.M Ecgapdh-F2F1, 0.5. Mu.M Ecgapdh-loop-F, 0.2. Mu.M Ecgapdh-B3, 1.0. Mu.M Ecgapdh-B2B1, 0.5. Mu.M Ecgapdh-loo) were designed to synthesize 384-556 nucleotide sequences of the glyceraldehyde-3-phosphate dehydrogenase gene of amplified E.colip-B), and 0.4mM dNTP (final concentration), bst DNA polymerase large fragment (8U), tth nuclease HII (100 ng), molecular beacon (0.5. Mu.M), DNA samples of various concentrations were added to LAMP reaction system (20 mM Tris-HCl (pH 8.8), 1M betaine, 10mM KCl,10mM (NH) 4 ) 2 SO 4 ,4mM MgSO 4 0.1% Triton X-100), a reaction mixture was prepared. The LAMP isothermal amplification primer sequence is as follows:
Ecgapdh-F3:5’ggtccgtcta aagacaacac tc
Ecgapdh-F2F1:5’ggtggtgcaggaagcgttggaaac TTTT gatgttc gttaaaggcg ctaacttc
Ecgapdh-loop-F:5’tgtcctggccagcatatttg
Ecgapdh-B3:5’tctttgtgagacgggccatc
Ecgapdh-R2B1:5’atcaacg ataacttcgg catcatcgaa TTTT cggttttctgagtagcggtagtag
Ecgapdh-loop-B:5’gtctgatga ccaccgttca c
and step three, LAMP amplification reaction and fluorescent signal release accumulation reaction. And (3) putting the LAMP amplification reaction mixture of the glyceraldehyde-3-phosphate dehydrogenase gene aiming at the escherichia coli in the second step into a portable fluorometer, incubating for 30-60 minutes at 65 ℃, and performing amplification and fluorescent quantitative detection on the glyceraldehyde-3-phosphate dehydrogenase gene of the escherichia coli.
And fourthly, determining the concentration of the glyceraldehyde-3-phosphate dehydrogenase gene of the escherichia coli. According to the final fluorescence signal of the reaction (FIG. 2), the corresponding relation between the concentration of the Escherichia coli gapdh gene in the detected sample and the fluorescence signal is determined, and the fluorescence signal of the negative control added with water is very low and is a background value.
Specific example 2 LAMP method for quantitative fluorescent detection of 470-base polymorphism in glyceraldehyde-3-phosphate dehydrogenase gene of E.coli
The technical solution of the present invention is further described in detail by examples below. The following examples are not to be construed as limiting the invention.
In one embodiment of the invention, aiming at the type of 470-base of the Escherichia coli glyceraldehyde-3-phosphate dehydrogenase gene, firstly, four Taqman probes with a ribonucleotide in the middle and an LAMP isothermal amplification primer are designed and synthesized, one Taqman probe, the LAMP primer, dNTP, a heat-resistant Bst DNA polymerase large fragment, a heat-resistant nuclease HII and a sample DNA are added into an LAMP reaction system, and the temperature is controlled in a portable fluorescence detector to carry out incubation so as to determine the single nucleotide polymorphism of 470-base of the glyceraldehyde-3-phosphate dehydrogenase gene of the sample.
Firstly, preparing a Taqman probe with a ribonucleotide in the middle. The Taqman probe is 25 nucleotides long, a ribonucleotide is arranged in the middle, the 25 nucleotides are in base pairing with 459-483 th sites of a glyceraldehyde-3-phosphate dehydrogenase gene of escherichia coli, RNA bases of the ribonucleotide are in base pairing with 470 th sites of the gene, two ends of the RNA bases are respectively marked by a fluorescence emission group and a fluorescence quenching group, and the whole Taqman probe is free from fluorescence release. 4 Taqman probes were as follows:
Ecgapdh-ru：5’FAM-CT GCCTGGCTCru GCTGGCTAAA GTT-BHQ1
Ecgapdh-ra：5’FAM-CT GCCTGGCTCra GCTGGCTAAA GTT-BHQ1
Ecgapdh-rc：5’FAM-CT GCCTGGCTCrc GCTGGCTAAA GTT-BHQ1
Ecgapdh-rg：5’FAM-CT GCCTGGCTCrg GCTGGCTAAA GTT-BHQ1
and secondly, establishing a single nucleotide polymorphism detection reaction system. 3 pairs of LAMP primer sequences (0.2. Mu.M Ecgapdh-F3, 1.0. Mu.M Ecgapdh-F2F1, 0.5. Mu.M Ecgapdh-loop-F, 0.2. Mu.M Ecgapdh-B3, 1.0. Mu.M Ecgapdh-B2B1, 0.5. Mu.M Ecgapdh-loop-B) were designed to synthesize 384-556 base sequences of the glyceraldehyde-3-phosphate dehydrogenase gene that amplified E.coli, and 0.4mM dNTP (final concentration), bst DNA polymerase large fragment (8U), tth nuclease HII (100 ng), a Taqman probe (0.5. Mu.M), DNA samples were added to the LAMP reaction system (20 mM Tris-HCl (pH 8.8), 1M betaine, 1mM KCl,10mM (NH) (NH. Mu.M), and 4 ) 2 SO 4 ,4mM MgSO 4 0.1% Triton X-100), a reaction mixture was prepared. 4 Taqman probes are respectively added into a reaction system containing a detection sample DNA, and one sample corresponds to 4 reactions. The LAMP primer sequence is as follows:
Ecgapdh-F3:5’ggtccgtcta aagacaacac tc
Ecgapdh-F2F1:5’ggtggtgcaggaagcgttggaaac TTTT gatgttc gttaaaggcg ctaacttc
Ecgapdh-loop-F:5’tgtcctggccagcatatttg
Ecgapdh-B3:5’tctttgtgagacgggccatc
Ecgapdh-R2B1:5’atcaacg ataacttcgg catcatcgaa TTTT cggttttctgagtagcggtagtag
Ecgapdh-loop-B:5’gtctgatga ccaccgttca c
and step three, LAMP amplification reaction and Taqman probe fluorescent signal amplification reaction. And (3) putting the 4 reaction mixtures aiming at the detection sample in the second step into a portable temperature-controlled fluorescence detector, and incubating for 30-60 minutes at 65 ℃ to perform LAMP amplification reaction and genotyping detection of the glyceraldehyde-3-phosphate dehydrogenase.
Fourthly, determining the gene polymorphism of the Escherichia coli glyceraldehyde-3-phosphate dehydrogenase. Comparing the fluorescent signals of 4 detection reactions (figure 3), according to the RNA base types of the Taqman probes corresponding to the 4 reactions, the fluorescent signal generated by the Taqman probe-rc is the highest and is more than 5 times of other 3 probes, thereby determining that the single nucleotide polymorphism of the to-be-detected site of the detection sample is C base.
Claims (2)
1. A target nucleic acid detection and Single Nucleotide Polymorphism (SNP) detection technology based on loop-mediated isothermal nucleic acid amplification (LAMP), heat-resistant nuclease HII, RNA chimeric molecular beacons or Taqman probes is characterized in that:
(1) Amplification reactions of target nucleic acid molecules (comprising the pairing sequences of molecular beacons or Taqman probes) are based on LAMP isothermal amplification;
(2) The middle of the molecular beacon or the Taqman probe is provided with a ribonucleotide, the two sides of the molecular beacon or the Taqman probe are respectively marked by a fluorescence emission group and a fluorescence quenching group, the fluorescence emission group can be FAM, TET and the like, the fluorescence quenching group can be BHQ1, DACBYL and the like, and the molecular beacon or the Taqman probe is hybridized and paired with a single-stranded DNA formed in LAMP amplification;
(3) The nuclease HII is heat-resistant nuclease HII and can be coupled with LAMP amplification reaction carried out at 65 ℃ to detect DNA target molecules;
(4) The pairing region of the molecular beacon or the Taqman probe can be a sequence of a neck ring structure part of a DNA product amplified by LAMP, and can also be a double-stranded DNA sequence between two neck ring structures;
(5) When the single nucleotide polymorphism is measured, the fluorescent signals generated by the 4 probes are different, and the probe with a high signal value corresponds to the base type of the single nucleotide polymorphism.
2. The detection of target nucleic acid and the determination of single nucleotide polymorphism based on the technology are applied.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211252133.9A CN115896251A (en) | 2022-10-13 | 2022-10-13 | LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211252133.9A CN115896251A (en) | 2022-10-13 | 2022-10-13 | LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115896251A true CN115896251A (en) | 2023-04-04 |
Family
ID=86488690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211252133.9A Pending CN115896251A (en) | 2022-10-13 | 2022-10-13 | LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115896251A (en) |
-
2022
- 2022-10-13 CN CN202211252133.9A patent/CN115896251A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220033891A1 (en) | Amplification with primers of limited nucleotide composition | |
| US20210189469A1 (en) | Probes for improved melt discrimination and multiplexing in nucleic acid assays | |
| JP6480511B2 (en) | Compositions and methods for quantifying nucleic acid sequences in a sample | |
| US8673567B2 (en) | Method and kit for nucleic acid sequence detection | |
| CA2537810C (en) | Nucleic acid detection assay | |
| JP6638122B2 (en) | Target nucleic acid detection method and kit | |
| US20060240462A1 (en) | Methods for amplification and detection of nucleic acids | |
| JP2004526442A (en) | Circular probe amplification (CPA) using energy transfer primers | |
| KR102323375B1 (en) | Multiplex Probes | |
| EP2058406A2 (en) | RNA detection method | |
| JP2023518217A (en) | Loop primer and loop de loop method for detecting target nucleic acid | |
| CN110172500B (en) | Isothermal typing method for single nucleotide polymorphism | |
| KR101785687B1 (en) | Method for detection of target nucleic acid sequence by multiple amplification nested signal amplification | |
| CN115896251A (en) | LAMP-based rapid nucleic acid detection and single nucleotide polymorphism determination technology | |
| CN103124797A (en) | Method for cell lysis and PCR within the same reaction vessel | |
| EP2625286B1 (en) | Method for cell lysis in a pcr reaction buffer | |
| CN113574180A (en) | Single nucleic acid for real-time detection of genetic variation of single target gene and detection method using same | |
| CN117089605B (en) | FQ-RCA-based RNA isothermal real-time genotyping method | |
| CN116445589A (en) | Isothermal nucleic acid fluorescent quantitative rapid detection method based on LAMP and cleavage type Taqman probe and application thereof | |
| KR20190092883A (en) | Method for Detecting Target Nucleic Acid using Three-way Junction Structure-induced Isothermal Amplification〔ThIsAmp〕 | |
| Kitaoka et al. | Simultaneous visual detection of single-nucleotide variations in tuna DNA using DNA/RNA chimeric probes and ribonuclease A | |
| WO2024023510A1 (en) | Method and kit for detecting single nucleotide polymorphisms (snp) by loop-mediated isothermal amplification (lamp) | |
| KR20240058020A (en) | Primer sets for rapid detection of Escherichia coli O146 or O51 serotype and a method of detecting a serotype of Escherichia coli using the same | |
| KR20240058025A (en) | Primer sets for rapid detection of Escherichia coli O110, O113, O167 or O116 serotype and a method of detecting a serotype of Escherichia coli using the same | |
| CN116287169A (en) | Novel detection method suitable for LAMP detection of genes or gene mutations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |