CN115896124A - Alfalfa MsFER1 coding gene and protein and application thereof - Google Patents

Abstract

The invention discloses an alfalfa MsFER1 coding gene, a protein and an application thereof, wherein the MsFER1 coding gene is a DNA molecule with a coding region shown as SEQ ID NO.2, and an amino acid sequence of the protein is shown as SEQ ID NO. 1; the MsFER1 gene salt tolerance research provided by the invention provides a new gene resource for alfalfa salt-tolerant molecule design breeding, has certain reference and reference values for breeding alfalfa salt-tolerant new materials, and can have substantial influence on livestock husbandry, agriculture, forestry and the like in China.

Description

Alfalfa MsFER1 coding gene and protein and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an alfalfa MsFER1 encoding gene, a protein and an application thereof.

Background

Alfalfa (medicago. Satival L.) is a perennial herbaceous plant of the genus Medicago of the family Leguminosae, is one of the largest pastures planted in the world, and is known as the king of pasture because of its high nutritive value and aboveground biomass. The alfalfa has good palatability, high nutritional value, rich trace elements and rich protein. The content of crude protein of alfalfa reaches 16% -22%, the content of alfalfa in the bud stage is 2.74 times of that of corn, and the alfalfa is mainly distributed in leaves. The coarse fodder is an important fodder source for ruminant, the daily ration using crop straw as the coarse fodder source can only meet the nutritional requirements of 5000kg dairy cows with single-yield level, the daily ration using common hay and silage corn as the coarse fodder source can maintain the nutritional requirements of 7000kg dairy cows with single-yield level, and the high-quality alfalfa hay fed by the feed can reach the single-yield level of more than 8000 kg. The alfalfa is a high-quality feed which is very important for the animal husbandry, and has important significance for improving the quality and the yield of the alfalfa, developing the animal husbandry industry, promoting the improvement of agricultural supply and side structure, promoting the overall raising of farmers through feeding, and improving the market competitiveness of the quality of grass products and animal products. The alfalfa ensiling storage technology is increased, the contradiction of supply and demand of high-quality protein feed in China can be relieved, the breeding cost is reduced, and the economic benefit of the breeding industry is improved.

The north of China is a main cultivation area of alfalfa and is also a large-scale distribution area of drought and saline-alkali soil. In recent years, the problems of seasonal drought and aggravation of soil salinization degree in China are increasingly highlighted under the influence of global warming. In the life cycle of alfalfa, the growing period of seedlings is a sensitive period, and the seedlings are easily affected by drought and salt stress. Salt stress can inhibit the growth of plants by affecting the osmotic pressure in alfalfa bodies, the photosynthesis of plants, the activity of certain enzymes and the like. With the rapid development of the alfalfa industry in China, the seed demand of alfalfa varieties in China is continuously increased, and the seed supply in China has a large gap, so that foreign varieties introduced and applied in large quantities in production are very common. However, it is difficult to evaluate the tolerance of introduced varieties to drought and saline-alkali effectively before their utilization to reduce the production loss caused by blind selection in practical production applications.

The plant ferritin responds to abiotic stress factors such as high salt, high light intensity, high temperature, heavy metal and the like, and is considered as stress response related protein. The plant's ability to regulate the redox environment and antioxidant capacity is closely related to stress tolerance. Enzymatic detoxification and the chelation balance of metal ions are two important mechanisms to prevent the generation of highly toxic hydroxyl radicals and to protect cells from oxidative damage. Plants participate in antioxidant pathways by increasing the transcription of antioxidant genes such as SOD (superoxide dismutase), CAT (catalase), and FER (ferritin), and respond to toxic free radicals. The barley HvFER1 is strongly expressed in seedling leaves under the induction of PEG and salt stress, the expression is increased along with the extension of the stress time, and is rapidly reduced after reaching the peak, and the HvFER1 has a typical adversity stress response mode.

The method for mining the abiotic stress tolerance gene of the alfalfa mainly comprises homologous cloning, transcriptome, proteomics, GWAS and the like. In recent years, alfalfa research has made breakthrough progress, some genes related to abiotic stress tolerance are excavated, and related functions are identified, so that the method has great significance for improving alfalfa yield, promoting alfalfa quality and enlarging alfalfa production and planting scale, and can provide wider prospects for development of feed and animal husbandry.

Disclosure of Invention

The invention aims to overcome the defects of the technology and provides an alfalfa MsFER1 coding gene, a protein and an application thereof.

In order to solve the technical problems, the invention provides the following technical scheme:

the invention provides an alfalfa MsFER1 coding gene, wherein the MsFER1 coding gene is a DNA molecule with a coding region shown as SEQ ID NO. 2.

Furthermore, the fluorescent quantitative PCR primers of the MsFER1 coding gene are MsFER1-F, SEQ ID No.4, msFER1-R and SEQ ID No.5.

The invention also provides a protein of the MsFER1 coding gene in the technical scheme, and the amino acid sequence of the protein is shown in SEQ ID NO. 1.

The invention also provides application of the alfalfa MsFER1 encoding gene in the technical scheme in improving the tolerance of plant salt stress.

Further, the application comprises the steps of: introducing the MsFER1 coding gene into a plant through a recombinant expression vector, and culturing to obtain a salt stress tolerant plant; the introduction is realized by a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into a recombination site of a vector pBIB-BASTA-35S-GWR-FLAG of a restriction enzyme system.

Further, the plant is a monocot or a dicot.

Compared with the prior art, the invention has the advantages that: according to the invention, firstly, the salt stress induction of the expression of the MsFER1 gene is determined through a qRT-PCR (real-time fluorescence quantification) experiment, and then the MsFER1 gene is over-expressed in arabidopsis thaliana, so that the transgenic arabidopsis thaliana has stronger salt tolerance than that of wild arabidopsis thaliana; the MsFER1 gene salt tolerance research provided by the invention provides a new gene resource for alfalfa salt-tolerant molecule design breeding, has certain reference and reference values for breeding alfalfa salt-tolerant new materials, and can have substantial influence on livestock husbandry, agriculture, forestry and the like in China.

Drawings

FIG. 1 is a diagram showing the alignment of amino acid sequence homology of MsFER1 of the present invention with other 12 species.

FIG. 2 is a graph showing the results of qRT-PCR expression of the MsFER1 gene of the present invention when induced by stress;

wherein A: the expression conditions of the MsFER1 proteins of the aerial part and the underground part of the alfalfa at each time point under the condition that the final concentration is 80 mu M;

b: the expression conditions of MsFER1 proteins in an overground part and an underground part under the condition that the final concentration of NaC1 is 150mM at each time point;

c: and (3) the MsFER1 protein of the overground part and the underground part under the condition that the final concentration of the Mannito1 is 500mM, and expressing the MsFER1 protein at each time point.

FIG. 3 is a diagram showing the correlation between the molecular assay of the present invention and the target gene in transgenic Arabidopsis;

a: a nucleic acid electrophoresis picture, wherein M is a DL5000 Marker, control is water contrast, and 1-21 are 21T 3 generation homozygous lines;

b: histogram of related protein expression, col-0 (Columbia ecotype) is wild type, and OE1 to OE21 are 21 homozygous lines of T3 generation.

FIG. 4 is a graph comparing the results of comparison of salt tolerance of transgenic and wild type Arabidopsis seedlings of the present invention.

FIG. 5 is a graph comparing the results of comparison of germination salt tolerance of transgenic and wild type Arabidopsis seeds of the present invention;

t3 generation strains OE2, OE15, OE16 and wild type strain Col-0 were compared for germination in MS medium, MS medium containing 100mM NaCl, 150mM NaCl, respectively.

FIG. 6 is a graph comparing the growth of the T3 generation strains OE2, OE15, OE16 and wild type strain Col-0 of the present invention after normal water supply (Before Salt stress treatment) and Salt stress treatment (Salt stress 35 days), respectively.

Detailed Description

The alfalfa MsFER1 encoding gene, the protein and the use of the invention are further described in detail with reference to the following examples.

Example 1 cloning and sequencing of the MsFER1 encoding gene, comprising the following steps:

plant material: alfalfa 1.

Healthy plump seeds were germinated in double filter paper-plated petri dishes for 5d under normal conditions, and when the seedling cotyledons spread, were transferred to a prepared 1/2MS nutrient solution (PH = 5.8). After culturing for 7 days, adding NaC1 into 1/2MS nutrient solution until the final concentration is 150mM, processing for 24h, respectively and rapidly taking the overground part and the underground part of the plant, quickly freezing in liquid nitrogen, and storing at-80 ℃ for later use.

The RNA of the sample is extracted by a Trizo1 extraction method, and then is reversely transcribed into cDNA by a cDNA synthesis reverse transcription kit. The total volume of the PCR detection system is 20 mu L, and the system is a primer (SEQ ID No. 4) MsFER1-F (5 '-3'): CTCATGGCTCTTTTCTTGTTC 1. Mu.L, primer (SEQ ID No. 5) MsFER1-R (5 '-3'): GATTAAACAGCATGTTCCTC 1. Mu.L, 2 XEcoTaq PCR Supermix 10. Mu.L, ddH ₂ O6. Mu.L and cDNA 2. Mu.L; the reaction procedure is as follows: a first round: pre-denaturation at 94 ℃ for 3min; and a second round: denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 30s, and second cycle for 38 times; a third wheel: extending for 7min at 72 ℃; the reaction was terminated at 16 ℃ and was completed.

Detecting the result by electrophoresis in 1% agarose, wherein the length of a target gene is 771bp, recovering a DNA fragment of the gene, carrying out double enzyme digestion together with an expression vector pBIB-BASTA-35S-GWR-FLAG, selecting BamHI and ScalI at enzyme digestion sites, confirming the enzyme digestion result by gel electrophoresis, then using a DiaSpin column type DNA gel recovery kit (B110092, shanghai Bioengineering Co., ltd.) to carry out product recovery, finally, using T4 DNA ligase (M0202, new England Biolabs Beijing Co., ltd.) to connect the enzyme-digested target fragment with the expression vector, transferring the product to Escherichia coli DH5a competent cells, uniformly coating the cells on an LB resistant plate containing Kan, carrying out overnight culture in a 37 ℃ incubator, detecting and selecting a proper positive clone bacterial plaque, selecting the bacterial plaque into a liquid culture medium containing Kan resistance, and carrying out overnight culture in a shaker at 37 ℃ at 200 rpm. And (4) after the bacteria liquid is detected properly, sending the bacteria liquid to Shanghai biological engineering company Limited for sequencing. Sequencing results show that the colony has nucleotide sequences in SEQ ID No.2 (DNA) and SEQ ID No.3 (cDNA), the colony is named as MsFER1 gene, protein coded by the gene is named as MsFER1 protein, and the protein sequence is shown in SEQ ID No. 1.

The MsFER1 protein was aligned in GeneBank with 12 other species (FIG. 1) and showed the highest homology to XP-003623359.1 of Medicago truncatula.

Example 2: qRT-PCR analysis of expression characteristics of MsFER1 coding gene

The method comprises the following steps:

alfalfa seeds were germinated and hydroponically grown as in example 1, with 12d alfalfa seedlings for stress treatment:

drought treatment: mannitol was added to the 1/2MS hydroponic nutrient solution to a final concentration of 500mM for treatment times of 0,1,3,6, 12 and 24h, respectively. Respectively and rapidly taking the overground part and the underground part of the plant, quickly freezing the sample in liquid nitrogen, and storing at-80 ℃ for later use.

Salt treatment: naC1 was added to the 1/2MS hydroponic nutrient solution to a final concentration of 150mM for 0,1,3,6, 12 and 24h, respectively. Respectively and rapidly taking the overground part and the underground part of the plant, quickly freezing the sample in liquid nitrogen, and storing at-80 ℃ for later use.

ABA treatment: ABA was added to a 1/2MS hydroponic nutrient solution to a final concentration of 80. Mu.M for 0,1,3,6, 12 and 24h, respectively. Respectively and rapidly taking the overground part and the underground part of the plant, setting 3 technical repeats for each sample, quickly freezing the sample in liquid nitrogen, and storing the sample at-80 ℃ for later use.

The sample RNA extraction and reverse transcription of cDNA were performed as in example 1. The cDNA was diluted to 50 ng/. Mu.L. With (SEQ ID No. 6) qRTMsFER1-F (5 '-3'): CGGTTCCTTTGACTGGGGTT and (SEQ ID No. 7) qRTMsFER1-R (5' -3): ACGAGCCAAAGAACTTGAGGA amplification of samples to detect the gene of interest, expressed as MsActin-F (5 '-3'): GACAATGGAACTGGAATGG and MsACTIN-R (5 '-3'): CAATACCGTGGCTCAATGG as internal reference. The total volume of the qRT-PCR detection system is 10 muL, the system is a primer qRTMsFER 1-F0.2 muL, a primer qRTMsFER 1-R0.2 muL, a 2xSG Fast qPCR Master Mix 5 muL, a DNF buffer 1 muL, ddH ₂ O ₂ 6 μ L and cDNA 1 μ L: the reaction procedure is as follows: a first round: pre-denaturation at 95 ℃ for 10min; and a second round: denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 1min, and circulating for 40 times in the second round to finish the reaction. The instrument is ABI7500 real-time fluorescent quantitative PCR.

By use of 2 ^-ΔΔCt The method calculates relative expression amount. Δ Δ Ct = (C) _{t. target Gene} -C _{t. reference gene} ) _Timex -(C _{t. target Gene} -C _{t. reference gene} ) _Time0 (ii) a Time x represents any 5 Time points of the stress treatment, specifically 1h,3h,6h,12h, or 24h. Time 0 tableStress treatment was performed for 0h (control). Mapping was performed using Origin 9 software.

The experimental result is shown in figure 2, the MsFERR 1 gene is induced by Mannitol, naC1 and ABA in the aerial part and the underground part of the alfalfa. It was shown that MsFER1 is affected at the gene level under stress conditions, but to a different extent above and below ground.

Example 3 application of MsFER1 in improving stress resistance of Arabidopsis thaliana

It is worth mentioning that: the Arabidopsis is used as a model plant, the function analysis and verification of the MsFER1 gene are carried out by utilizing the Arabidopsis, and the conclusion can be considered to be equal to the molecular mechanism of MsFER1 in alfalfa for regulating and controlling plant response to salt stress.

The experimental operation of this example includes the following steps:

1. preparation of transgenic MsFER1 Arabidopsis thaliana

1. Construction of recombinant vectors

1) Cloning of MsFER1 Gene

Designing primers MsFER1-G-F and MsFER1-G-R according to the sequence of the MsFER1 gene, and respectively introducing BamHI and ScalI enzyme cutting sites into the 5' end of the primers: (SEQ ID No. 8) MsFER1-G-F (5 '-3'): CGGGGTACCTCTCATGGCTCTTTCTTGTTC (SEQ ID No. 9) MsFER1-G-R (5 '-3'): CGCGTCGACAACAGCATGTTCCTCATGAAG.

PCR was performed using the alfalfa cDNA of example 1 as a template and MsFER1-G-F and MsFER 1-G-R. The total volume of the PCR amplification system is 50. Mu.L, which comprises 5 XPisus HF Buffer 10. Mu.L, 2.5mM dNTP 4. Mu.L primer MsFER 1-G-F1. Mu.L, msFER 1-G-R1. Mu.L, ddH ₂ 32.5 μ L of O, 0.5 μ L of Phusion DNA Polymerase and 1 μ L of cDNA; the amplification conditions were, first round: pre-denaturation at 98 ℃ for 30s; and a second round: denaturation at 98 ℃ for 10s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 15s, and second cycle for 32 times; and a third round: extending for 5min at 72 ℃; fourth wheel: and stopping at 16 ℃.

2) Enzyme digestion of MsFER1 Gene and expression vector

The electrophoresis detection result in 1% agarose is used, the length of the target gene is 771bp, the DNA fragment of the gene is recovered, the DNA fragment and an expression vector pBIB-BASTA-35S-GWR-FLAG are subjected to double enzyme digestion, bamHI and ScalI are selected as enzyme digestion sites, the enzyme digestion result is confirmed by gel electrophoresis, and then a DiaSpin column type DNA gel recovery kit (B110092, shanghai biological engineering Co., ltd.) is used for product recovery.

3) Ligation of MsFER1 Gene to expression vector

Connecting the enzyme-cut target fragment with an expression vector by using T4 DNA ligase (M0202, new England Biolabs Beijing Co., ltd.), transferring the enzyme-cut target fragment into escherichia coli DH5a competent cells, uniformly coating the competent cells on an LB resistant plate containing Kan, culturing overnight in an incubator at 37 ℃, detecting and selecting proper positive clone bacterial plaques, selecting the bacterial plaques into a liquid culture medium containing Kan resistance, and culturing overnight in a shaker at 37 ℃ at 200 rpm. And (4) after the bacteria liquid is detected properly, sending the bacteria liquid to Shanghai biological engineering company Limited for sequencing. Obtaining a colony extracting plasmid of a positive clone which is completely consistent with the CDS sequence of the MsFER1 gene.

4) Obtaining recombinant Agrobacterium

Transferring the recombinant pBIB-BASTA-35S-GWR-FLAG-MsFER1 vector into agrobacterium EHA105 to obtain recombinant agrobacterium pBIB-BASTA-35S-GWR-FLAG-MsFER1, mixing the bacterial solution with 50% glycerol according to the ratio of 1:1, quickly freezing by liquid nitrogen, and storing at-80 ℃ for later use.

2. Transgenic MsFER1 Arabidopsis thaliana

The recombinant Agrobacterium EHA105/pBIB-BASTA-35S-GWR-FLAG-MsFER1 was removed from-80 ℃ and placed on ice, and the pellet was picked up in a partially frozen-thawed state in 3mLLB liquid, resistant to rifampicin and kanamycin, and shaken in a shaker at 28 ℃ and 200rpm for 24h.

2mL of the activated strain solution cultured with shaking was added to 200mLLB liquid, and the resistance was rifampicin and kanamycin, and the mixture was shaken at 28 ℃ and 200rpm for 20h to 24h to OD600=1.2 to 2.0.

Centrifuging a part of the large shake culture solution at the rotating speed of 4500g for 15min, pouring out LB liquid, and resuspending and diluting the liquid to flower soaking buffer solution with OD600=0.8 by using 5% sucrose.

Soaking an arabidopsis thaliana (Col-0) inflorescence (the fruit pod can be cut off in the first 2d to improve the transfection efficiency) into the dye solution for infection for 3-5s;

after soaking, dark treatment is carried out for 24h, the culture is continued in a greenhouse, and the infection is carried out for the 2 nd time after 1 week.

Harvesting T1 generation seeds, screening positive plants, screening by using kanamycin (Kan, 10 mg/mL), and carrying out passage until homozygous lines are obtained from T3 generation.

T2 represents the seeds produced by T1 generation selfing and the plants grown from the seeds, and T3 represents the seeds produced by T2 generation selfing and the plants grown from the seeds.

DNA of the whole plant of the regenerated plant of the T3 generation was used as a template, and the DNA of the whole plant was purified by using a primer set for the target gene (SEQ ID No. 10) 35sF (5 '-3'): GATGACGCCAATCCCAACTATC and (SEQ ID No. 5) MsFER1-R (5 '-3'): GATTAAACAGCATGTTCCTC, and Kan primer pair (SEQ ID No. 11) NPTII-F (5 '-3'): CAATCCATCGGCCAGAT and (SEQ ID No. 12) NPTII-R (5 '-3'): AGCTGCCTGTTCCAAAGG was subjected to PCR amplification. The PCR detection system and the amplification condition of the target gene and the Kan gene are consistent. The PCR detection system is as follows: the total volume of PCR is 20. Mu.L, including 2 XEcoTaq PCR Supermix 10. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, ddH ₂ O6. Mu.L and DNA template (50 ng/. Mu.L), 2. Mu.L; the amplification conditions were: (1) pre-denaturation at 94 ℃ for 4min; (2) denaturation at 94 ℃ for 30s; (3) annealing at 56 ℃ for 30s; (4) extension at 72 ℃ for 30s; (5) 2-4, circulating the steps for 35 times; (6) extension at 72 ℃ for 7min. As shown in FIG. 3 (A), 21 homozygous lines of the T3 generation amplified a single band at 771 bp.

The qRT-PCR system comprises 2xSG Fast qPCR Master Mix 10 uL primer qRTMsFER 1-F0.5 uL, primer qRTMsFER 1-R0.5 uL, DNF buffer 2 uL and ddH ₂ O5. Mu.L and cDNA 2. Mu.L in a total volume of 20. Mu.L. The qRT-PCR amplification conditions are as follows: (1) pre-denaturation at 95 ℃ for 10min; (2) denaturation at 95 ℃ for 15s; (3) annealing at 60 ℃ for 1min; and (4) circulating the steps (2) to (3) for 40 times. As shown in FIG. 4 (B), msFER1 was not expressed in the wild-type strain (Col-0) but was expressed to a different degree in the homozygous strain. 3 high expression strains were selected from the homozygous strains for subsequent physiological analysis.

2. Evaluation of salt tolerance of transgenic plants

1. Effect of salt stress on root Length

After 3 representative strains OE2, OE15 and OE16 of MsFER1 Arabidopsis thaliana transferred from T3 generation and seeds of wild type Col-0 are sterilized, healthy and plump seeds are selected, 10 muL of gun heads are uniformly spotted on a culture medium (an MS culture medium and an MS culture medium containing 150mmol/L NaCl), sealing is carried out by using a sealing film, after 3d of vernalization, the seeds are moved into an incubator with the temperature of 22 ℃, the illumination time of 16h and the relative humidity of 60% for culture for 7d, 3 transgenic strains and wild type Col-0 seedlings with consistent root length are selected and respectively moved onto the MS culture medium and the MS culture medium containing 150mM NaCl, after 10d of culture, the relative root length and the number of lateral roots of each strain are counted, three biological repetitions are set for each treatment, the average value is taken, and the standard deviation is calculated.

The results are shown in FIG. 4, in MS plates, the root length and lateral root number of wild type and transgenic lines are basically consistent; on a 150mmol/L NaCl plate, the relative root lengths of the wild type and the transgenic line are not obviously different; on the 150mmol/L NaCl plate, the number of lateral roots of the transgenic line is obviously larger than that of the wild type.

2. Effect of salt stress on Germination Rate

50 seeds of 3 representative strains OE2, OE15 and OE16 of T3 generation MsFER1 Arabidopsis thaliana and 50 seeds of wild type Col-0 are disinfected, evenly distributed on an MS culture medium and an MS culture medium containing 100mmol/L and 150mmol/L NaCl by a10 mu L gun head, sealed by a sealing film, treated at 4 ℃ for 3 days at low temperature, moved into a germination box at 22 ℃,16h of light-8 h of darkness and 60 percent of relative humidity for culture for 7 days, the statistical rate is calculated every day, three biological repetitions are set for each treatment, the result is averaged, and the standard deviation is calculated.

The results are shown in FIG. 5, in the MS plate, the germination rates and germination rates of the wild type and transgenic lines are basically consistent; on a 100mmo1/L and 150mmol/L NaCl plate, the germination rate and the germination speed of the MsFER1 transgenic arabidopsis line are obviously higher than those of a wild type.

3. Effect of soil salt stress on transgenic plant resistance

The plant materials are 3 representative lines OE2, OE15, OE16 and wild type Col-0 of T3 generation MsFER1 Arabidopsis thaliana. After the seeds of each strain are sterilized, healthy and plump seeds are selected, a 10-microliter gun head is used for uniformly dropping the seeds on a culture medium, a sealing film is used for sealing the seeds, the seeds are vernalized for 3 days, the seeds are moved into an incubator with the temperature of 22 ℃, the illumination time of 16h and the relative humidity of 60% for culture for 14 days, seedlings are moved into small square pots, the weight of soil in each square pot is consistent, 4 wild type plants and 4 transgenic plants are cultured in each square pot, salt treatment is started after normal culture for 14 days, 200mmol/L NaCl solution is poured into each square pot, and the seedlings are poured once every 3 days. Watch phenotype, count survival and take pictures.

The results are shown in FIG. 6, before salt treatment, the growth conditions of the transgenic lines and the wild type are basically consistent; after salt treatment, the growth of the transgenic line is obviously better than that of the wild type.

The invention provides an MsFER1 protein with a stress tolerance function, which is characterized in that the salt stress induction of the expression of an MsFER1 gene is firstly determined through a qRT-PCR experiment, and then the MsFER1 gene is over-expressed in arabidopsis thaliana, so that the transgenic arabidopsis thaliana has stronger salt tolerance than that of wild arabidopsis thaliana. The MsFER1 gene salt tolerance research provided by the invention provides a new gene resource for alfalfa salt tolerance molecule design breeding, has reference and reference significance for cultivating and obtaining plants with salt tolerance and new functional enhancement varieties thereof, and brings substantial influence on animal husbandry, agriculture, forestry and the like in China.

The present invention and its embodiments have been described above, and the description is not intended to be limiting, and the drawings are only one embodiment of the present invention, and the actual structure is not limited thereto. In summary, those skilled in the art should be able to conceive of the present invention without creative design of the similar structural modes and embodiments without departing from the spirit of the present invention, and all such modifications should fall within the protection scope of the present invention.

Claims (6)

1. Alfalfa MsFER1 coding gene, which is characterized in that: the MsFER1 coding gene is a DNA molecule with a coding region shown as SEQ ID NO. 2.

2. The alfalfa MsFER1 encoding gene of claim 1, wherein: the fluorescent quantitative PCR primer of the MsFER1 coding gene is MsFER1-F, SEQ ID No.4, msFER1-R and SEQ ID No.5.

3. The protein of the alfalfa MsFER1 encoding gene of any of claims 1-2, wherein: the amino acid sequence of the protein is shown as SEQ ID NO. 1.

4. The use of the alfalfa MsFER1 encoding gene of claim 1 or 2 to increase the tolerance of a plant to salt stress.

5. Use according to claim 4, characterized in that it comprises the following steps: introducing the MsFER1 coding gene into a plant through a recombinant expression vector, and culturing to obtain a salt stress tolerant plant; the introduction is realized by a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into a recombination site of a restriction enzyme system vector pBIB-BASTA-35S-GWR-FLAG.

6. Use according to any one of claims 4 to 5, characterized in that: the plant is a monocotyledon or a dicotyledon.

Images