CN115894681B - Preparation for mesenchymal stem cell differentiation - Google Patents

Abstract

The present application relates to a preparation for mesenchymal stem cell differentiation. The application takes NOGGIN protein as a target to prepare and obtain a specific NOGGIN monoclonal antibody, the monoclonal antibody has the activity of inhibiting the NOGGIN protein, and when the monoclonal antibody is used for the bone induction differentiation of mesenchymal stem cells, the expression of bone related genes can be obviously improved, and the better capacity of inducing the stem cells to differentiate into bone cells is shown.

Description

Preparation for mesenchymal stem cell differentiation

Technical Field

The application relates to the field of biology, in particular to a preparation for mesenchymal stem cell differentiation.

Background

Noggin gene was originally isolated from xenopus embryos, and mRNA was injected into the embryos to cause the head of xenopus to be enlarged, and was designated Noggin. Expression of Noggin gene was found in chordae, nodes and dorsal body segments of mice, and it was revealed that Noggin gene has an important role in nerve tube growth. The Noggin gene plays an important role in embryo development, and through gene sequence homology analysis, the Noggin gene is found to be highly conserved among species. Noggin is known to localize to chromosome 17 in humans, to chromosome 11 in mice and rats, and encodes a protein product of molecular weight 26kD, which is a secreted protein.

The Noggin gene has the main functions of regulating the dorsal-ventral axis development mode, participating in the development of nerve tubes, inducing endogenous nerves, mediating the development and the remodeling of skeletal system, regulating the differentiation of stem cells and the like. Noggin can act as an endogenous neuro-induction signal during development to promote the development of a portion of the cells into nervous system tissue. Experiments prove that the growth and development of the forebrain of the mouse are regulated and controlled by Noggin and another important embryo protein chord, and forebrain development disorder can be influenced, so that Noggin is also regarded as an effective neuroinducer. Noggin's neuroinduction is associated with antagonism of BMP2/4, by antagonism of BMP4, it can be induced into forebrain tissue. In addition to the important role of Noggin gene in the development and differentiation of nervous system, noggin is also an essential key regulatory gene for skeletal system development, ovarian development, cardiac septum formation and other processes. Researchers have proposed Noggin as an inhibitor of BMP signaling, which inhibits BMP function by specifically binding BMP, thereby preventing BMP from binding to cell surface receptors. The basis for Noggin to function in the nervous system, skeletal system and stem cells is to inhibit BMP activity.

At the cellular level, noggin has an inhibiting effect on the proliferation of in vitro cultured osteoblasts (MG 63), and has obvious concentration and time dependence, and the inhibiting effect on the proliferation of the osteoblasts is gradually enhanced along with the increase of the Noggin protein concentration. The research shows that Noggin has the function of inhibiting osteoblast differentiation similar to FGF-2, can completely inhibit the secretion of differentiated osteoblast markers bone sialoprotein and osteocalcin, and plays a role in regulating the early stage of osteoblast differentiation. In vivo, excessive expression of Noggin gene can also cause the defect of mature osteoblast before U-33, prevent osteoblast differentiation and osteoclast activity, reduce the expression of cell factors Runx-2, bone sialoprotein, osteocalcin and RANK-L, cause the obvious reduction of bone density and the obvious reduction of trabecular bone. Noggin also reduces the formation of osteoclasts in bone marrow cell cultures co-cultures with bone stromal cells and hematopoietic cells by reducing the expression of RANK-L in osteoblasts in osteoblast lines, indicating that Noggin is not only a direct inhibitor of osteoblast differentiation but also an indirect regulator of osteoclast formation. The research shows that the inflammation can promote anabolism of bone formation by inducing Noggin, further induce BMP-2 receptor and BMP-2 to activate the differentiation process of mesenchymal stem cells, regulate bone tissue mineralization, and show that Noggin has important regulation effect on differentiation and maturation of mesenchymal stem cells. Studies show that the siRNA is transfected to cause the Noggin not to be expressed, so that the inhibiting effect of the Noggin on BMP signals is reduced, and the differentiation of the BMP-induced osteoblast can be accelerated.

Mesenchymal Stem Cells (MSCs) are a class of adult multipotent stem cells of non-embryonic origin that are present in various tissues such as bone marrow, muscle, fat, umbilical cord, skin, etc. In addition to high self-renewal capacity, MSCs can achieve multidirectional differentiation into osteoblasts, adipocytes, chondroblasts, muscle cells, and the like under certain induction conditions. Meanwhile, research shows that MSCs hardly express costimulatory molecules related to Human Leukocyte Antigen (HLA) recognition and Major Histocompatibility Complex (MHC), and have lower immunogenicity; and can secrete a large amount of chemotactic factors and migrate to the damaged part in the tissue injury and inflammatory reaction, thereby playing the roles of inflammatory regulation and tissue repair. Based on the above characteristics, MSCs are considered as "ideal seed cells" that can be used to repair tissue organ damage caused by aging or lesions. Osteoblasts secrete organic bone matrix, promote mineralization of bone matrix, and maintain bone homeostasis. Osteoblast dysfunction or dysfunction may cause destruction of bone tissue microstructure, bone formation defects, resulting in bone metabolic diseases such as osteoporosis and osteoarthritis. Whereas differentiation of MSCs into osteoblasts is the primary pathway of osteoblast formation, which plays a key role in bone formation and functional maintenance. Therefore, the induction of mesenchymal stem cells into osteoblasts for the treatment of human diseases is an important research direction.

Disclosure of Invention

The application provides a method for promoting mesenchymal stem cell differentiation.

Further, the present application provides a method for promoting differentiation of mesenchymal stem cells into osteogenesis.

For example, but not by way of limitation, a BMSC type that has the potential to produce at least osteogenic lineage cells is a mesenchymal stem cell. The term "mesenchymal stem cells" or "MSCs" as used herein refers to adult stem cells of mesodermal origin, which are capable of producing cells of a mesenchymal lineage (typically two or more mesenchymal lineages, such as bone cell lineage (bone), cartilage cell lineage (cartilage), muscle cell lineage (muscle), tendon cell lineage (tendon), fibroblast lineage (connective tissue), fat cell lineage (fat) and mesenchymal lineage (bone marrow stroma)). MSCs may be isolated from, for example, bone marrow, blood, umbilical cord, placenta, fetal yolk sac, skin (dermis) (particularly fetal and juvenile skin), periosteum and adipose tissue. Human MSCs, their isolation, in vitro expansion and differentiation have been described, for example, in U.S. Pat. No.5,486,359, U.S. Pat. No.5,811,094, U.S. Pat. No.5,736,396, U.S. Pat. No.5,837,539 or U.S. Pat. No.5,827,740. Any MSCs described in the art, as well as any MSCs isolated by any method described in the art, are suitable for use in the present application, provided that such MSCs are capable of producing cells of at least the bone cell (bone) lineage.

Further, a medium for promoting differentiation of mesenchymal stem cells into osteogenesis is provided, the medium containing the monoclonal antibody of the present application.

Further, the monoclonal antibody is a monoclonal antibody 1G22 specific to NOGGIN, the monoclonal antibody is of the IgG1 type, and the light chain is of the kappa chain.

Specifically, total RNA extraction is carried out on a 1G22 monoclonal antibody cell strain, the total RNA is reversely transcribed into cDNA, then the cDNA is used as a template for PCR amplification of a heavy chain variable region and a light chain variable region of the antibody, and sequencing is carried out, and finally the heavy chain variable region is determined to be shown as SEQ ID NO:1, and the light chain variable region is determined to be shown as SEQ ID NO: 2.

Further, the medium also contains components necessary for mammalian cell development, which are known per se. By way of illustration and not limitation, these ingredients may include inorganic salts (particularly salts including Na, K, mg, ca, cl, P and possibly Cu, fe, se and Zn), physiological buffers (e.g., HEPES, bicarbonate), nucleotides, nucleosides and/or nucleobases, ribose, deoxyribose, amino acids, vitamins, antioxidants (e.g., glutathione) and carbon sources (e.g., glucose, sodium pyruvate, sodium acetate), and the like.

For use in culturing, the basal medium may be provided with one or more additional components. For example, other supplements may be used to provide cells with the necessary trace elements and substances for optimal growth and expansion. These supplements include insulin, transferrin, selenate, and combinations thereof. These components may be included in a salt solution such as, but not limited to Hanks' balanced salt solution (HBSS), earle salt solution. Additional antioxidant supplements, such as beta-mercaptoethanol, may be added. Although many basal media already contain amino acids, certain amino acids, such as L-glutamine (which are known to be less stable in solution), can be supplemented later. The culture medium may also be supplemented with antibiotics and/or antifungal compounds, typically for example, a mixture of penicillin and streptomycin and/or additional compounds such as, but not limited to: amphotericin, ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampin, spectinomycin, tetracycline, tylosin and giemycin (zeocin).

During the culture, the medium may contain supplements required for cellular metabolism, such as glutamine and other amino acids, vitamins, minerals and useful proteins such as transferrin, etc. The medium may also contain antibiotics to prevent contamination by yeasts, bacteria and fungi, such as penicillin, streptomycin, gentamicin, etc. If the cells are to be cultured, the conditions should approximate physiological conditions (preferably, pH is about 6 to about 8, and the temperature is about 30℃to about 40 ℃).

Further, the present application provides the use of monoclonal antibody 1G22 of NOGGIN in the preparation of a medium for inducing differentiation of mesenchymal stem cells into osteoblasts.

Further, the present application provides the use of monoclonal antibody 1G22 of NOGGIN in the preparation of a reagent for promoting differentiation of stem cells into bone-related cells for treating bone-related diseases.

The term "bone-related disease" as used herein refers to any type of bone disease for which treatment may benefit from administration of cells of the osteogenic lineage (e.g., osteoblasts, or osteoblast phenotype cells) to a subject suffering from the disease. In particular, these diseases can be characterized, for example, by: reduced bone formation or excessive bone resorption, reduced numbers, viability or function of osteoblasts or bone cells present in the bone, reduced bone mass in the subject, reduced bone thinning, reduced bone strength or bone elasticity, etc.

For example, and without limitation, bone related diseases that may benefit from administration of osteoblasts or osteoblast phenotype cells of the present application may include local or systemic diseases such as any type of osteoporosis or osteopenia (e.g., primary, postmenopausal, senile, adrenocortical hormone-induced, any secondary, single or multi-site osteonecrosis), any type of fracture (e.g., non-healing, poorly healing, delayed healing or compression fractures), conditions requiring bone fusion (e.g., spinal fusion and remodeling, maxillofacial fracture, bone remodeling (e.g., bone remodeling following traumatic injury or cancer surgery), craniofacial bone remodeling), osteogenesis imperfecta, osteolytic bone cancer, paget's disease, endocrine disease, hypophosphaemia, hypocalcemia, renal osteodystrophy, osteomalacia, debilitating bone disease, rheumatoid arthritis, parathyroid hyperfunction, primary hyperthyroidism, secondary parathyroid hyperfunction, gor-stram, and mcbright-handicap syndrome (mctty-alright disease).

Advantageous effects

The application takes NOGGIN protein as a target to prepare and obtain a specific NOGGIN monoclonal antibody, the monoclonal antibody has the activity of inhibiting the NOGGIN protein, and when the monoclonal antibody is used for the bone induction differentiation of mesenchymal stem cells, the expression of bone related genes can be obviously improved, and the better capacity of inducing the stem cells to differentiate into bone cells is shown.

Drawings

FIG. 1 SDS-PAGE of NOGGIN recombinant proteins

FIG. 21G22 monoclonal antibody specificity assay, lane 1 is NOGGIN recombinant protein, lane 2 is BSA protein;

FIG. 3 shows the results of the expression level of NOGGIN protein after 14d of stem cell osteoinduction.

Detailed Description

Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. While specific embodiments of the application are shown in the drawings, it should be understood that the application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art.

EXAMPLE 1 preparation of NOGGIN recombinant proteins

Amplifying NOGGIN gene by PCR, designing a specific Primer according to the sequence of the human NOGGIN gene provided in GenBank by using Primer5 software, and designing an upstream Primer F GCATGGAGCGCTGCCCCAGCC; the downstream primer R CTAGCACGAGCACTTGCACT is synthesized by Shanghai bioengineering company by adding NotI and XbaI cleavage sites. The NOGGIN gene was amplified using specific primers using human cDNA as a template. The PCR reaction condition is 94 ℃ pre-denaturation for 5min; denaturation at 94 ℃ for 45s, annealing at 62 ℃ for 35s, extension at 72 ℃ for 1min, and circulation for 35 times; and at 72℃for 10min. Detecting the amplified target fragment by 1% agarose electrophoresis, and amplifying about 700bp to obtain a target band. The target gene was ligated to pcDNA3.1 (+) vector to obtain pcDNA-NOGGIN vector.

CHO cells were passaged at appropriate densities 1d prior to electrotransfection, allowing the cells to be in the logarithmic growth phase prior to transfection. The next day the cells were digested and the cell concentration was adjusted to 5X 10 with PBS ⁶ Individual cells/mL. To 200. Mu.L of the above cell suspension, 20. Mu.L of pcDNA-NOGGIN plasmid and 5. Mu. Mol/L of salmon sperm DNA were added and the mixture was blown uniformly. And transferring the mixed cell suspension to a 0.4mm electric rotating cup for electric shock operation. After electric shock is finished, culturing the electrotransfer cell suspension for 48 hours, adopting PCR identification, selecting positive clone, transferring the positive clone into a T25 cell culture flask, placing the T25 cell culture flask at 37 ℃ and placing the T25 cell culture flask in a volume fraction of 5% CO ₂ Culturing in an incubator for 48 hours.

The cell culture supernatant was collected, centrifuged at 5000g for 20min at 4℃and the supernatant was collected and filtered through a 0.22 μm filter. The NOGGIN protein was purified by reference to the GE nickel column affinity chromatography instructions. Western blot detects the expression of NOGGIN protein. The commercial NOGGIN recombinant protein, positive recombinant cells and empty vector control cell culture supernatant were prepared into 12% polyacrylamide gel, 4% polyacrylamide gel concentrate, and subjected to polyacrylamide gel electrophoresis. Proteins were transferred from SDS-PAGE gels onto PVDF membranes, 5% skim milk was blocked at 37℃for 2h, rabbit anti-NOGGIN monoclonal antibodies were incubated overnight at 4℃and HRP-labeled goat anti-rabbit IgG was incubated at 37℃for 1h and developed using ECL development system. The results are shown in FIG. 1.

Westernblot was performed with anti-NOGGIN monoclonal antibodies to verify NOGGIN expression, while the commercial NOGGIN protein was used as a positive control, which showed that the commercial NOGGIN protein group and plasmid pcDNA-NOGGIN expression products had positive signals for protein expression at approximately 26KD, while the pCA empty vector group immunoblotting was negative, as shown in FIG. 1.

EXAMPLE 2 preparation of NOGGIN monoclonal antibodies

Mice were immunized by conventional methods subcutaneously and intraperitoneally for 6 weeks, once every 2 weeks, at 100 μg/dose, with the immunogen being the NOGGIN recombinant protein prepared in example 1. After 6 weeks, mice No. 3 with the highest serum titers were boosted with 80 μg/dose. After 3d, spleen cells were taken and cell fusion was performed using polyethylene glycol methods conventional in the art. After HAT culture solution is cultured for 2 weeks, HT culture solution is changed to HT culture solution for 1 week, conventional heat-inactivated calf serum RPMI1640 culture solution containing 10% is changed to be cultured, the solution is changed once every 3d for half a dose, and ELISA is used for primary screening when colonies grow to 1/3 hole. A total of 48 clones with stronger positive signals were obtained. Obtaining monoclonal cells positive for antibodies by a rapid limiting dilution method: 100 μl of medium was added to the 96-well plate, antibody positive well cells in the 24-well plate were resuspended by pipetting, 100 μl of cell suspension was aspirated, and the suspension was added to the first well on the left side of the 96-well plate, diluted by a factor of 10 in the first row on the top. The dilution was performed by a row gun from the upper first row down each row. Cells were observed daily, half-changed every 3d, and after 10d, monoclonal positive wells were screened by ELISA to obtain specific hybridoma cell 1G22 capable of secreting anti-NOGGIN positive response and stabilizing secretion. And (5) amplifying, culturing and freezing the hybridoma cells.

The BALB/c mice were sensitized with paraffin wax in the abdominal cavity, and ascites was prepared by injecting hybridoma cells after 8 d. The prepared ascites monoclonal antibody is used for measuring the antibody titer by an indirect ELISA method, 1 mu g of NOGGIN recombinant N protein is used as a coating antigen, and the ascites monoclonal antibody is serially diluted from 1:10 to measure the antibody titer to 1:10 after being blocked ⁵ . The prepared ascites is subjected to crude extraction by an ammonium sulfate salting-out method, then a protein G affinity chromatographic column is used for further purification to obtain an IgG antibody with higher purity, and the purified monoclonal antibody is subjected to SDS-PAGE identification, so that two specific strips exist in the purified antibody, namely a light chain and a heavy chain of the monoclonal antibody, and the purified monoclonal antibody is proved to be obtained. After the antibody was quantified, it was ready for use.

The monoclonal antibody subtype was determined with a mouse Ig class/subclass identification kit, the type of 1G22 monoclonal antibody being of the IgG1 type and the light chain being of the kappa chain.

The binding kinetics of the 1G22 monoclonal antibody to the recombinant protein of example 1 was measured using a BIAcore8K instrument based on surface plasmon resonance (SRP) technology. Through the GEanti-Human-IgG-Fc amino coupling kit,anti-humanIgG antibodies were amino-coupled to CM5 biosensor chips to obtain approximately 1000 Response Units (RU). For kinetic measurements, the recombinant protein prepared in example 1 was serially diluted 2-fold with HBS-EP buffer, starting at 100nM, diluted 2-fold for 5 concentration gradients, and set at 0 concentration. Startup3 times. Antibody: 2 mug/ml, sample injection time 120s, flow rate 8 mug/min; antigen protein: combining 140s, and dissociating 600s at the flow rate of 25 mu L/min; regeneration: with 3MMgCl ₂ buffer regeneration is performed for 40s, and the flow rate is 20 mu L/min. Equilibrium dissociation constants (KD) were calculated using either the 1:1binding model or the Twotactatesection binding model. The results show that the antibody can bind with the corresponding antigen, the affinity is (2.34+/-0.13) nM, and the binding effect is better.

The NOGGIN recombinant protein and BSA protein were transferred to PVDF membrane by SDS-PAGE and electrotransport at 14V for 60min. The membranes were placed in plates pre-washed with PBST buffer, blocked with 1% skim milk overnight at 4℃and PVDF membrane washed 4 times with PBST buffer for 10min each. Adding 1G22 monoclonal antibody diluted in a ratio of 1:1000, incubating for 3 hours at 37 ℃, washing the PVDF membrane with PBST buffer for 4 times and 10 minutes each time, then adding horseradish peroxidase-labeled rabbit anti-sheep IgG diluted in a ratio of 1:4000, incubating for 3 hours at 37 ℃, and washing the PVDF membrane with PBST buffer for 4 times and 10 minutes each time. And then photographing after developing with a color developing agent. As can be seen from FIG. 2, the result of the Westernblot detection shows that the monoclonal antibody of the application can well bind to recombinant protein and has better specificity.

Extracting total RNA from the 1G22 monoclonal antibody cell strain, reversely transcribing the total RNA into cDNA, and then using the cDNA as a template to PCR amplify a heavy chain variable region and a light chain variable region of the antibody, and sequencing to finally determine that the heavy chain variable region is shown as SEQ ID NO. 1, and the light chain variable region is shown as SEQ ID NO: 2.

Example 3 preparation and identification of mesenchymal Stem cells

Waste human abdominal adipose tissues after operation are sheared into paste after PBS is washed for 4 times to remove impurities: adding 0.2% type I collagenase, shaking at 37deg.C for digestion for 50min; filtering with 200 mesh screen after digestion is stopped, centrifuging the obtained cell suspension at 2500r/min for 10min, discarding supernatant, and precipitating with inclusion bodiesThe culture medium of DMEM with the integration number of 10% of fetal calf serum and 1% of double antibody (green streptomycin) is resuspended and inoculated into 25cm ² Placing in culture flask at 37deg.C with volume fraction of 5% CO ₂ Culturing in an incubator; 1 culture medium is changed every 3d, and when the cells grow to 80% fusion, 0.25% pancreatin-0.02% EDTA is used for digestion and passage. Taking 3 rd generation human adipose-derived mesenchymal stem cells, preparing single cell suspension after digestion by pancreatin, respectively adding FITC-labeled mouse anti-human CD29, CD34, CD45, CD49d and CD90 monoclonal antibodies, and detecting the expression of cell surface molecular markers by a flow cytometer. The results are shown in Table 1.

TABLE 1 expression of surface molecular markers

Types of marks	Expression situation
		CD29	99.8％
CD49d	99.6％
		CD90	99.5％
CD34	1.1％
		CD45	0.09％

As can be seen from table 1, the prepared adipose-derived mesenchymal stem cells highly express CD29, CD49d and CD90, and lowly express CD34 and CD45, which accords with the characteristics of the mesenchymal stem cells.

EXAMPLE 4 Effect of monoclonal antibodies on mesenchymal Stem cell differentiation

The adipose-derived mesenchymal stem cells prepared in example 3 were inoculated into a 6-well plate, and a DMEM medium containing 10% fetal calf serum and 1% diabody (penicillin) was added thereto and placed at 37℃with 5% CO by volume ₂ The cells were incubated in an incubator for 12h and then replaced with an osteogenic culture medium consisting of 10% fetal bovine serum, 1% diabody, 10mM beta-phosphoglycerol, 50. Mu.g/ml ascorbic acid and 100nM dexamethasone and monoclonal antibodies at concentrations of 0, 50, 100. Mu.g/ml, respectively, for osteogenic culture for 7d. And detecting the bone formation related genes and proteins by adopting QRT-PCR.

QRT-PCR detects the level of osteogenic related gene expression in both sets of samples. First, total RNA was extracted using TRIZOL reagent and RNeasy Mini kit (Sigma-Aldrich). The total RNA is then reverse transcribed into cDNA using a cDNA transcription kit. Quantitative determination of the level of the osteogenic related gene was performed for each set of samples. Housekeeping Genes (GAPDH) were used as endogenous normalization controls. All primers in this test were purchased from Shanghai Biotechnology. Primer sequences are respectively

ALP:AAGGCTTCTTCTTGCTGGTG(F),GCCTTACCCTCATGATGTCC(R)；

RUNX2:CCACAAGGACAGAGTCAGAT(F),GATAGGAGGGGTAAGACTGG(R)；

BMP2:GTCATCCACCCCACATCA(F),TGACTGGAAGAGCGGAGAGT(R)；

OCN CAAGCAGGAGGGCAATAAGGT (F), AGCAGGGTCAAGCTCACATAG (R). The results are shown in Table 2.

TABLE 2 expression of bone related genes of groups after osteoinduction

As can be seen from the results of table 2, the monoclonal antibody prepared by the present application can significantly promote the high expression of the bone formation related genes after being added to the osteogenic induction medium, and the promoting effect is more remarkable with the increase of the monoclonal antibody dose, and the difference is extremely remarkable (#p < 0.01) compared with the blank group.

Total protein in the above three groups of cells was extracted with total protein extraction kit on day 14 of osteoinduction. Loading 200ug of total protein into each hole for SDS-PAGE, and transferring electrophoresis to NC membrane; NC membrane is blocked by 5% skimmed milk powder for 1h; the NOGGIN monoclonal antibody and the GAPDH polyclonal antibody prepared by the application are respectively added, and the mixture is placed at room temperature for 30min and is cooled at 4 ℃ overnight; the mixture was left at room temperature for 30min on day 2. Washing the membrane with TBST for 3 times for 10 min; covering NC membrane with human HRP-rabbit anti-mouse IgG, and reacting at 37deg.C for 1 hr. Taking out NC film, TBST washing film for 10minx2 times, adding high sensitivity luminous reagent for film exposure, obtaining Image, analyzing immunoblotting result by Image-ProPlus6.0 software, determining target strip area and gray value, comparing target protein with internal reference, and performing semi-quantitative analysis. Protein content = band area x average gray; protein of interest semi-quantitative value = protein of interest content/GAPDH protein content. The results are shown in FIG. 3.

As can be seen from FIG. 3, the NOGGIN protein in the cells was also effectively inhibited after continuous mab treatment with osteoinduction 14 d.

Although the embodiments of the present application have been described above with reference to the accompanying drawings, the present application is not limited to the above-described specific embodiments and application fields, and the above-described specific embodiments are merely illustrative, and not restrictive. Those skilled in the art, having the benefit of this disclosure, may effect numerous forms of the application without departing from the scope of the application as claimed.

Claims (5)

1. A NOGGIN specific monoclonal antibody is characterized in that the heavy chain variable region of the antibody is shown as SEQ ID NO. 1, and the light chain variable region is shown as SEQ ID NO: 2.

2. A culture medium for promoting the differentiation of adipose-derived mesenchymal stem cells into osteogenesis is characterized in that a NOGGIN specific monoclonal antibody with the final concentration of 50-100 mug/ml is added into the culture medium, the heavy chain variable region of the antibody is shown as SEQ ID NO:1, and the light chain variable region is shown as SEQ ID NO:2 is shown in the figure; the monoclonal antibody can inhibit the activity of NOGGIN to promote the osteogenic differentiation of stem cells.

3. The culture medium according to claim 2, wherein the culture medium comprises 10% heat-inactivated calf serum RPMI1640 medium.

Use of a monoclonal antibody specific for noggin in the preparation of a formulation for promoting differentiation of adipose-derived mesenchymal stem cells into osteogenesis, wherein the heavy chain variable region of the antibody is shown in SEQ ID No. 1, and the light chain variable region is shown in SEQ ID NO:2 is shown in the figure; the monoclonal antibody can inhibit the activity of NOGGIN to promote the osteogenic differentiation of stem cells; the antibody was used at a final concentration of 50. Mu.g/ml to 100. Mu.g/ml.

5. The use according to claim 4, wherein the adipose mesenchymal stem cells are commercially purchased or isolated from adipose tissue.